ID: 1031753889

View in Genome Browser
Species Human (GRCh38)
Location 7:125613154-125613176
Sequence TTGTGTCCTTCTCTTCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031753889_1031753899 18 Left 1031753889 7:125613154-125613176 CCGCCCTGAAGAGAAGGACACAA No data
Right 1031753899 7:125613195-125613217 CCTGCTGATTGTAGGGCCCTTGG No data
1031753889_1031753896 11 Left 1031753889 7:125613154-125613176 CCGCCCTGAAGAGAAGGACACAA No data
Right 1031753896 7:125613188-125613210 TTTGCCGCCTGCTGATTGTAGGG No data
1031753889_1031753895 10 Left 1031753889 7:125613154-125613176 CCGCCCTGAAGAGAAGGACACAA No data
Right 1031753895 7:125613187-125613209 ATTTGCCGCCTGCTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031753889 Original CRISPR TTGTGTCCTTCTCTTCAGGG CGG (reversed) Intergenic
No off target data available for this crispr