ID: 1031754371

View in Genome Browser
Species Human (GRCh38)
Location 7:125619082-125619104
Sequence GATCCCAGGAGACCAAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031754371_1031754374 -3 Left 1031754371 7:125619082-125619104 CCATCTTTTGGTCTCCTGGGATC No data
Right 1031754374 7:125619102-125619124 ATCACCTTATGTTAGTTTCAGGG No data
1031754371_1031754377 15 Left 1031754371 7:125619082-125619104 CCATCTTTTGGTCTCCTGGGATC No data
Right 1031754377 7:125619120-125619142 CAGGGGTTGAGAAGTTTGAGAGG No data
1031754371_1031754375 -2 Left 1031754371 7:125619082-125619104 CCATCTTTTGGTCTCCTGGGATC No data
Right 1031754375 7:125619103-125619125 TCACCTTATGTTAGTTTCAGGGG No data
1031754371_1031754373 -4 Left 1031754371 7:125619082-125619104 CCATCTTTTGGTCTCCTGGGATC No data
Right 1031754373 7:125619101-125619123 GATCACCTTATGTTAGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031754371 Original CRISPR GATCCCAGGAGACCAAAAGA TGG (reversed) Intergenic
No off target data available for this crispr