ID: 1031757216

View in Genome Browser
Species Human (GRCh38)
Location 7:125660199-125660221
Sequence TGACCTTTCCACAGTGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031757216_1031757223 9 Left 1031757216 7:125660199-125660221 CCCCATGCACTGTGGAAAGGTCA No data
Right 1031757223 7:125660231-125660253 GAACCAATCTGTGGGTCCCATGG No data
1031757216_1031757221 1 Left 1031757216 7:125660199-125660221 CCCCATGCACTGTGGAAAGGTCA No data
Right 1031757221 7:125660223-125660245 ACCTGGTCGAACCAATCTGTGGG 0: 4
1: 43
2: 117
3: 135
4: 161
1031757216_1031757220 0 Left 1031757216 7:125660199-125660221 CCCCATGCACTGTGGAAAGGTCA No data
Right 1031757220 7:125660222-125660244 CACCTGGTCGAACCAATCTGTGG 0: 5
1: 48
2: 112
3: 112
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031757216 Original CRISPR TGACCTTTCCACAGTGCATG GGG (reversed) Intergenic
No off target data available for this crispr