ID: 1031767563

View in Genome Browser
Species Human (GRCh38)
Location 7:125801107-125801129
Sequence TATCTCTCCCCCAGTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031767560_1031767563 -8 Left 1031767560 7:125801092-125801114 CCCATTGGAAGTGGCTATCTCTC No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data
1031767561_1031767563 -9 Left 1031767561 7:125801093-125801115 CCATTGGAAGTGGCTATCTCTCC No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data
1031767556_1031767563 2 Left 1031767556 7:125801082-125801104 CCTCCCTACTCCCATTGGAAGTG No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data
1031767558_1031767563 -1 Left 1031767558 7:125801085-125801107 CCCTACTCCCATTGGAAGTGGCT No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data
1031767552_1031767563 26 Left 1031767552 7:125801058-125801080 CCTCTACACCCTCAGCAGAAGTT No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data
1031767559_1031767563 -2 Left 1031767559 7:125801086-125801108 CCTACTCCCATTGGAAGTGGCTA No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data
1031767554_1031767563 17 Left 1031767554 7:125801067-125801089 CCTCAGCAGAAGTTGCCTCCCTA No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data
1031767553_1031767563 18 Left 1031767553 7:125801066-125801088 CCCTCAGCAGAAGTTGCCTCCCT No data
Right 1031767563 7:125801107-125801129 TATCTCTCCCCCAGTGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031767563 Original CRISPR TATCTCTCCCCCAGTGGTAG TGG Intergenic
No off target data available for this crispr