ID: 1031772314

View in Genome Browser
Species Human (GRCh38)
Location 7:125859895-125859917
Sequence CTTTGGATATGTATTCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031772314_1031772319 2 Left 1031772314 7:125859895-125859917 CCATGGGGAATACATATCCAAAG No data
Right 1031772319 7:125859920-125859942 CCGCATTGGATGTCTGAAACTGG No data
1031772314_1031772320 13 Left 1031772314 7:125859895-125859917 CCATGGGGAATACATATCCAAAG No data
Right 1031772320 7:125859931-125859953 GTCTGAAACTGGAGACAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031772314 Original CRISPR CTTTGGATATGTATTCCCCA TGG (reversed) Intergenic
No off target data available for this crispr