ID: 1031784874

View in Genome Browser
Species Human (GRCh38)
Location 7:126016851-126016873
Sequence CCAAAGAATGCATTTTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031784874_1031784876 -4 Left 1031784874 7:126016851-126016873 CCTCAATAAAATGCATTCTTTGG No data
Right 1031784876 7:126016870-126016892 TTGGTGCATACCATGTGTTTTGG No data
1031784874_1031784878 21 Left 1031784874 7:126016851-126016873 CCTCAATAAAATGCATTCTTTGG No data
Right 1031784878 7:126016895-126016917 TTACCCTGATGTATGATATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031784874 Original CRISPR CCAAAGAATGCATTTTATTG AGG (reversed) Intergenic
No off target data available for this crispr