ID: 1031787400

View in Genome Browser
Species Human (GRCh38)
Location 7:126050523-126050545
Sequence TGTAGTTAAAAGTCCAAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031787400_1031787405 30 Left 1031787400 7:126050523-126050545 CCAATCTTGGACTTTTAACTACA No data
Right 1031787405 7:126050576-126050598 ATAGGTATGGTTATGCAAAATGG No data
1031787400_1031787402 12 Left 1031787400 7:126050523-126050545 CCAATCTTGGACTTTTAACTACA No data
Right 1031787402 7:126050558-126050580 TTAACGTTTAATGTACCTATAGG No data
1031787400_1031787403 17 Left 1031787400 7:126050523-126050545 CCAATCTTGGACTTTTAACTACA No data
Right 1031787403 7:126050563-126050585 GTTTAATGTACCTATAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031787400 Original CRISPR TGTAGTTAAAAGTCCAAGAT TGG (reversed) Intergenic
No off target data available for this crispr