ID: 1031787405

View in Genome Browser
Species Human (GRCh38)
Location 7:126050576-126050598
Sequence ATAGGTATGGTTATGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031787401_1031787405 -2 Left 1031787401 7:126050555-126050577 CCATTAACGTTTAATGTACCTAT No data
Right 1031787405 7:126050576-126050598 ATAGGTATGGTTATGCAAAATGG No data
1031787400_1031787405 30 Left 1031787400 7:126050523-126050545 CCAATCTTGGACTTTTAACTACA No data
Right 1031787405 7:126050576-126050598 ATAGGTATGGTTATGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031787405 Original CRISPR ATAGGTATGGTTATGCAAAA TGG Intergenic
No off target data available for this crispr