ID: 1031788450

View in Genome Browser
Species Human (GRCh38)
Location 7:126065975-126065997
Sequence CTCCCATGACAGATGGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031788436_1031788450 7 Left 1031788436 7:126065945-126065967 CCCATGATTAAATTACCTCCCAC 0: 180
1: 3355
2: 6528
3: 9366
4: 10362
Right 1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG No data
1031788434_1031788450 9 Left 1031788434 7:126065943-126065965 CCCCCATGATTAAATTACCTCCC 0: 170
1: 3391
2: 6425
3: 9397
4: 10194
Right 1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG No data
1031788435_1031788450 8 Left 1031788435 7:126065944-126065966 CCCCATGATTAAATTACCTCCCA 0: 179
1: 3380
2: 6600
3: 9708
4: 11553
Right 1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG No data
1031788441_1031788450 -8 Left 1031788441 7:126065960-126065982 CCTCCCACGGGGTCCCTCCCATG 0: 7
1: 689
2: 1713
3: 3440
4: 4934
Right 1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG No data
1031788433_1031788450 12 Left 1031788433 7:126065940-126065962 CCACCCCCATGATTAAATTACCT 0: 82
1: 1396
2: 3477
3: 5324
4: 5923
Right 1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG No data
1031788437_1031788450 6 Left 1031788437 7:126065946-126065968 CCATGATTAAATTACCTCCCACG No data
Right 1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031788450 Original CRISPR CTCCCATGACAGATGGGGAT GGG Intergenic
No off target data available for this crispr