ID: 1031792578

View in Genome Browser
Species Human (GRCh38)
Location 7:126126617-126126639
Sequence TAGGGTAATCAGAAGTAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031792569_1031792578 15 Left 1031792569 7:126126579-126126601 CCAGAAAATAGCATCTCCAGAGA No data
Right 1031792578 7:126126617-126126639 TAGGGTAATCAGAAGTAAGATGG No data
1031792573_1031792578 -1 Left 1031792573 7:126126595-126126617 CCAGAGACAGGGCACCCTGGTAT No data
Right 1031792578 7:126126617-126126639 TAGGGTAATCAGAAGTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031792578 Original CRISPR TAGGGTAATCAGAAGTAAGA TGG Intergenic
No off target data available for this crispr