ID: 1031798098

View in Genome Browser
Species Human (GRCh38)
Location 7:126203725-126203747
Sequence GGATGATCACAGTTGCTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031798093_1031798098 24 Left 1031798093 7:126203678-126203700 CCAAGTGATTTAAAGAACAGCCT No data
Right 1031798098 7:126203725-126203747 GGATGATCACAGTTGCTATTTGG No data
1031798094_1031798098 4 Left 1031798094 7:126203698-126203720 CCTATTGTTTGATATACAGCCTC No data
Right 1031798098 7:126203725-126203747 GGATGATCACAGTTGCTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031798098 Original CRISPR GGATGATCACAGTTGCTATT TGG Intergenic
No off target data available for this crispr