ID: 1031807920

View in Genome Browser
Species Human (GRCh38)
Location 7:126329476-126329498
Sequence CCCAGTATGGACTCTGTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031807920_1031807925 6 Left 1031807920 7:126329476-126329498 CCCGACACAGAGTCCATACTGGG No data
Right 1031807925 7:126329505-126329527 CCTAGTGTAGCTGTGAGAAGAGG 0: 20
1: 1725
2: 2099
3: 1468
4: 845
1031807920_1031807926 7 Left 1031807920 7:126329476-126329498 CCCGACACAGAGTCCATACTGGG No data
Right 1031807926 7:126329506-126329528 CTAGTGTAGCTGTGAGAAGAGGG 0: 22
1: 1809
2: 2108
3: 1339
4: 934

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031807920 Original CRISPR CCCAGTATGGACTCTGTGTC GGG (reversed) Intergenic
No off target data available for this crispr