ID: 1031814652

View in Genome Browser
Species Human (GRCh38)
Location 7:126418336-126418358
Sequence ACCCATAAGCATGTGTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031814652_1031814655 15 Left 1031814652 7:126418336-126418358 CCAGGGCACACATGCTTATGGGT No data
Right 1031814655 7:126418374-126418396 CAAGCCTGCTAAAAAGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031814652 Original CRISPR ACCCATAAGCATGTGTGCCC TGG (reversed) Intergenic
No off target data available for this crispr