ID: 1031814655

View in Genome Browser
Species Human (GRCh38)
Location 7:126418374-126418396
Sequence CAAGCCTGCTAAAAAGTCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031814650_1031814655 16 Left 1031814650 7:126418335-126418357 CCCAGGGCACACATGCTTATGGG No data
Right 1031814655 7:126418374-126418396 CAAGCCTGCTAAAAAGTCATTGG No data
1031814652_1031814655 15 Left 1031814652 7:126418336-126418358 CCAGGGCACACATGCTTATGGGT No data
Right 1031814655 7:126418374-126418396 CAAGCCTGCTAAAAAGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031814655 Original CRISPR CAAGCCTGCTAAAAAGTCAT TGG Intergenic
No off target data available for this crispr