ID: 1031822027 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:126514165-126514187 |
| Sequence | CCCAGCAAGTCCGCAGATGC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1031822022_1031822027 | 18 | Left | 1031822022 | 7:126514124-126514146 | CCCAGTGCCTATGGAGATGAGCA | 0: 1 1: 0 2: 0 3: 15 4: 116 |
||
| Right | 1031822027 | 7:126514165-126514187 | CCCAGCAAGTCCGCAGATGCTGG | No data | ||||
| 1031822024_1031822027 | 11 | Left | 1031822024 | 7:126514131-126514153 | CCTATGGAGATGAGCATTTAGTG | 0: 1 1: 0 2: 2 3: 14 4: 169 |
||
| Right | 1031822027 | 7:126514165-126514187 | CCCAGCAAGTCCGCAGATGCTGG | No data | ||||
| 1031822023_1031822027 | 17 | Left | 1031822023 | 7:126514125-126514147 | CCAGTGCCTATGGAGATGAGCAT | 0: 1 1: 0 2: 2 3: 23 4: 182 |
||
| Right | 1031822027 | 7:126514165-126514187 | CCCAGCAAGTCCGCAGATGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1031822027 | Original CRISPR | CCCAGCAAGTCCGCAGATGC TGG | Intronic | ||
| No off target data available for this crispr | |||||