ID: 1031822027

View in Genome Browser
Species Human (GRCh38)
Location 7:126514165-126514187
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031822022_1031822027 18 Left 1031822022 7:126514124-126514146 CCCAGTGCCTATGGAGATGAGCA 0: 1
1: 0
2: 0
3: 15
4: 116
Right 1031822027 7:126514165-126514187 CCCAGCAAGTCCGCAGATGCTGG No data
1031822024_1031822027 11 Left 1031822024 7:126514131-126514153 CCTATGGAGATGAGCATTTAGTG 0: 1
1: 0
2: 2
3: 14
4: 169
Right 1031822027 7:126514165-126514187 CCCAGCAAGTCCGCAGATGCTGG No data
1031822023_1031822027 17 Left 1031822023 7:126514125-126514147 CCAGTGCCTATGGAGATGAGCAT 0: 1
1: 0
2: 2
3: 23
4: 182
Right 1031822027 7:126514165-126514187 CCCAGCAAGTCCGCAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr