ID: 1031827864

View in Genome Browser
Species Human (GRCh38)
Location 7:126588830-126588852
Sequence GGGTGAACACACACCCTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 270}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031827856_1031827864 16 Left 1031827856 7:126588791-126588813 CCCAAATACTATGAGTGCCCAAA 0: 5
1: 83
2: 225
3: 189
4: 240
Right 1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG 0: 1
1: 0
2: 4
3: 40
4: 270
1031827854_1031827864 28 Left 1031827854 7:126588779-126588801 CCCAGGAGACAGCCCAAATACTA 0: 2
1: 14
2: 120
3: 251
4: 332
Right 1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG 0: 1
1: 0
2: 4
3: 40
4: 270
1031827860_1031827864 -1 Left 1031827860 7:126588808-126588830 CCCAAAGTATGAAAGTGGGAAAG 0: 1
1: 2
2: 40
3: 134
4: 508
Right 1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG 0: 1
1: 0
2: 4
3: 40
4: 270
1031827857_1031827864 15 Left 1031827857 7:126588792-126588814 CCAAATACTATGAGTGCCCAAAG 0: 1
1: 8
2: 103
3: 208
4: 460
Right 1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG 0: 1
1: 0
2: 4
3: 40
4: 270
1031827861_1031827864 -2 Left 1031827861 7:126588809-126588831 CCAAAGTATGAAAGTGGGAAAGG 0: 1
1: 6
2: 48
3: 164
4: 422
Right 1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG 0: 1
1: 0
2: 4
3: 40
4: 270
1031827855_1031827864 27 Left 1031827855 7:126588780-126588802 CCAGGAGACAGCCCAAATACTAT 0: 1
1: 18
2: 124
3: 183
4: 222
Right 1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG 0: 1
1: 0
2: 4
3: 40
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031827864 Original CRISPR GGGTGAACACACACCCTCAC TGG Intronic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
900813614 1:4826644-4826666 AGGTGAACACCAACCCTCACAGG - Intergenic
900813636 1:4826739-4826761 AGGTGAACACCAACCCTCACAGG - Intergenic
903078531 1:20790097-20790119 GAGTGCACACACACACACACGGG + Intergenic
904572624 1:31478076-31478098 GCCTGAACACACACCCTCACTGG - Intergenic
905118713 1:35665039-35665061 AGGTGAATACCCACCCTCTCAGG - Intergenic
906569400 1:46823205-46823227 CCCTGAACACACACCCTCATTGG - Intergenic
906910444 1:49943495-49943517 CCCTGAACACACACCCTGACTGG + Intronic
907349028 1:53810988-53811010 TTCTGAACACACACCCCCACTGG + Intronic
908298724 1:62739532-62739554 TCCTGAACACACACCCCCACTGG + Intergenic
908795494 1:67827116-67827138 GCGTGATCACACATGCTCACTGG - Intronic
911317769 1:96376048-96376070 CCCTGAACACACACCCTCACTGG + Intergenic
912616271 1:111102686-111102708 TTCTGAACACACACCCCCACTGG - Intergenic
912990954 1:114485718-114485740 AGGTGAACATACACCCTACCTGG + Intronic
916566492 1:165983235-165983257 CCATGAAGACACACCCTCACTGG - Intergenic
917317541 1:173741090-173741112 CTCTGAACACACATCCTCACTGG - Intronic
917614440 1:176725706-176725728 GCGCGCACACACACACTCACGGG + Intronic
917985124 1:180308767-180308789 GGGTGAGCAAACACTCTAACTGG - Intronic
918171636 1:182003548-182003570 CTCTGAACACACATCCTCACTGG + Intergenic
920378633 1:205522971-205522993 GGGTGAACACCCACCCTCAGAGG + Intronic
920613972 1:207470875-207470897 GGGTGTCCACACCCCCTCAGAGG - Exonic
921574286 1:216815920-216815942 TGGGGAACACACACACACACAGG + Intronic
922999502 1:229995060-229995082 GGGTGAAAACACACCCTGCTGGG + Intergenic
923068952 1:230545438-230545460 GGGTGACAACTCATCCTCACAGG - Intergenic
923648101 1:235845198-235845220 TCCTGAACACACACCCCCACTGG + Intronic
923874569 1:238034125-238034147 TCCTGAACACACACCCCCACTGG + Intergenic
924302444 1:242652778-242652800 TTTTGAACACACACCCCCACTGG - Intergenic
1063280883 10:4628284-4628306 GGGTGACCTCTCACCATCACGGG + Intergenic
1064872438 10:19953398-19953420 GTGTGAACTTACACACTCACAGG - Intronic
1066501961 10:36003357-36003379 GCGTGCACACACACCCTCCCGGG - Intergenic
1068925160 10:62528040-62528062 CCTTGAACACACACCTTCACGGG - Intronic
1070267023 10:74913464-74913486 GGGTGAACACACAGCACAACAGG - Intronic
1070277209 10:75018483-75018505 TGGTGCACACACACCCTGTCAGG - Intronic
1070741388 10:78905518-78905540 GGGTGAACAAAAACACACACTGG - Intergenic
1071932248 10:90485198-90485220 CCCGGAACACACACCCTCACTGG - Intergenic
1072885093 10:99265841-99265863 GCCCAAACACACACCCTCACAGG + Intergenic
1074310928 10:112322777-112322799 GTGTGTACACACACACACACTGG + Intergenic
1076318074 10:129556932-129556954 CGGTGAACACTCAACATCACGGG - Intronic
1076342700 10:129760338-129760360 ACGTGACCACACACCATCACTGG - Intronic
1076622219 10:131797917-131797939 GTGTGCACCCACATCCTCACTGG + Intergenic
1076844593 10:133063099-133063121 GGGCGAACACATACGCCCACTGG + Intergenic
1077022133 11:421646-421668 GGGCGCACACACACACACACAGG + Intronic
1077332284 11:1988943-1988965 GGGTCAGCACACACGCTCCCAGG + Intergenic
1078047545 11:7930265-7930287 GGATGAACAAACACAATCACAGG + Intergenic
1079806178 11:24933096-24933118 CCCTGAACACACATCCTCACTGG - Intronic
1084164843 11:67370770-67370792 GGCTGAACTCTCACCCTCACTGG - Intronic
1084310013 11:68311654-68311676 GGAGGAACACACACGTTCACGGG + Intergenic
1084671962 11:70612161-70612183 GTGAGAACACACATCCCCACAGG - Intronic
1084683529 11:70680646-70680668 GGGTGAAGTCACACACTCACAGG + Intronic
1084840455 11:71842401-71842423 TCCTGAACACACACCCCCACTGG + Intergenic
1085917047 11:80902853-80902875 CCCTGAACACACACCCTCACTGG + Intergenic
1086183945 11:83990924-83990946 GAGAAAACACCCACCCTCACAGG + Intronic
1088239407 11:107758404-107758426 TCCTGAACACACACCCCCACTGG + Intergenic
1089028223 11:115294294-115294316 AGGTGTACACACACCACCACTGG - Intronic
1091210638 11:133855086-133855108 TCCTGAACACACACCCCCACTGG - Intergenic
1202815265 11_KI270721v1_random:44119-44141 GGGTCAGCACACACGCTCCCAGG + Intergenic
1092462561 12:8698615-8698637 GGGTTACCACACCCCCTCGCCGG - Intronic
1093720459 12:22436811-22436833 TTCTGAACACACACCCCCACTGG + Intronic
1095931957 12:47636558-47636580 TCCTGAACACACACCCGCACTGG + Intergenic
1098961036 12:76739762-76739784 TCCTGAACACACACCCTCACTGG - Intergenic
1099392552 12:82098476-82098498 CCCTGAACACACATCCTCACTGG - Intergenic
1099777527 12:87151950-87151972 TCTTGAACACACACCCCCACTGG - Intergenic
1102050007 12:109855511-109855533 GGGGGTAAACACAGCCTCACAGG + Intronic
1104597184 12:130127976-130127998 GGGTGAACCCAAACACTCAGTGG - Intergenic
1105314088 13:19241866-19241888 CTCTGAACACACATCCTCACTGG + Intergenic
1105314349 13:19243684-19243706 CCCTGAACACATACCCTCACTGG + Intergenic
1106156531 13:27162915-27162937 GGATAAATACACACCCACACAGG - Intronic
1108188842 13:47916857-47916879 CCCTGAACACACATCCTCACTGG + Intergenic
1108469904 13:50756996-50757018 TCCTGAACACACACCCTCACTGG - Intronic
1108753635 13:53474200-53474222 GTGTGCACACACACACACACTGG + Intergenic
1110793560 13:79612066-79612088 TCCTGAACACACACTCTCACTGG - Intergenic
1113078603 13:106492834-106492856 TGGTGAACACACACGCTCCCTGG - Exonic
1113343078 13:109446238-109446260 GGAGGAACACAGACCCCCACTGG - Intergenic
1115969694 14:38931996-38932018 CGCTGAACACACACCCCAACCGG + Intergenic
1116335438 14:43651145-43651167 CCCTGAACACACACCCCCACTGG + Intergenic
1116669140 14:47818194-47818216 CTCTGAACACACATCCTCACTGG - Intergenic
1117193525 14:53316995-53317017 CTCTGAACACACACCCCCACTGG - Intergenic
1118321200 14:64754345-64754367 GGGAGAACCCAGACCCTCCCTGG + Intronic
1119224662 14:72935643-72935665 GGGTGAACACATGCTCTCCCTGG + Intronic
1120076529 14:80165573-80165595 AGGTGAAAACACAATCTCACAGG - Intergenic
1121503582 14:94459283-94459305 CACTGAACACACACCCTCACTGG - Intergenic
1121514917 14:94543166-94543188 CTGTGAACACACACACTCAGAGG - Intergenic
1121660040 14:95627970-95627992 GGGTGAGAACCCACCCTCTCTGG + Intergenic
1122786220 14:104164399-104164421 GGGTGAACGAACACACACACTGG - Intronic
1125269517 15:37922247-37922269 CCCTGAACACACACCCCCACTGG - Intronic
1127766480 15:62190134-62190156 GGATGAGTACAGACCCTCACAGG - Intergenic
1129458053 15:75686269-75686291 GTGTGCACACACACACACACAGG + Intronic
1130633661 15:85595957-85595979 GGGAGAACACACACTTTCAATGG - Intronic
1130744068 15:86631653-86631675 GGATGAACACACTCCCTGATGGG + Intronic
1132224971 15:100133345-100133367 TGGAGAACACCCACACTCACAGG + Intronic
1132602174 16:778267-778289 GGGTGAACCCTCGTCCTCACTGG + Intronic
1133478572 16:6147482-6147504 AGGTGGACACACAGCCTCTCTGG - Intronic
1135940307 16:26816682-26816704 GTGTGGACACAGACCCTCCCGGG - Intergenic
1136024919 16:27463076-27463098 GGGTCAGCACACACACTCATGGG + Intronic
1137368012 16:47877538-47877560 AGGGGAACACACACCCACATTGG - Intergenic
1141996275 16:87638344-87638366 TGGTGAACAGACACGTTCACTGG + Intronic
1142106385 16:88305390-88305412 ATGTGCACACACACGCTCACAGG + Intergenic
1144278461 17:13699824-13699846 CCCTGAACACACACTCTCACTGG - Intergenic
1146845958 17:36182337-36182359 GCGTGCACACACACACACACAGG - Intronic
1148744154 17:49909145-49909167 GGGTGCACACACACACACACAGG + Intergenic
1151212905 17:72558218-72558240 GGGTAAATACACTCCCTCAAGGG - Intergenic
1152694067 17:81735035-81735057 GGGTGACCACACATGGTCACAGG - Intergenic
1153072138 18:1117392-1117414 CCCTGAACACACATCCTCACTGG - Intergenic
1154297760 18:13165360-13165382 CCCTGAACACACACCCTCACTGG + Intergenic
1159383402 18:67691185-67691207 TCCTGAACACACACCCCCACTGG - Intergenic
1159613007 18:70547043-70547065 CCCTGAACACACACCCTCACTGG - Intergenic
1160171769 18:76561341-76561363 GTGTGGACACACACACTCTCAGG - Intergenic
1160401398 18:78613763-78613785 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401499 18:78614127-78614149 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401507 18:78614155-78614177 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401515 18:78614183-78614205 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401523 18:78614211-78614233 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401531 18:78614239-78614261 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401539 18:78614267-78614289 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401547 18:78614295-78614317 GGTGGGACACACTCCCTCACTGG + Intergenic
1160401595 18:78614463-78614485 GGTGGGACACACTCCCTCACTGG + Intergenic
1160513762 18:79467172-79467194 GTGTGGACACGCACGCTCACAGG - Intronic
1160960406 19:1718340-1718362 GGGTGAACACAGGGCCTCAGCGG + Intergenic
1161170707 19:2811148-2811170 GTGTGAACACACATGCACACAGG - Intronic
1161474217 19:4475239-4475261 GGGTAAAGCCACCCCCTCACTGG + Intronic
1162383749 19:10348458-10348480 GGAACAACACACACCCACACCGG - Intergenic
1163138875 19:15332787-15332809 GTCTGAAGACAGACCCTCACAGG + Intergenic
1164267339 19:23632329-23632351 TCCTGAACACACACCCCCACTGG + Intronic
1166344513 19:42156928-42156950 GGGTGCTCACACACCCTGAGGGG - Intronic
1166604374 19:44127315-44127337 TACTGAACACACACCCTCACTGG - Intronic
1166780875 19:45342216-45342238 GGTTGAACTCACAACCACACAGG - Intronic
1167623282 19:50570229-50570251 TGGTGCACACACACATTCACTGG - Intergenic
925329136 2:3044776-3044798 GGGTGGCCACACACCCTGGCTGG + Intergenic
926872859 2:17441782-17441804 TCCTGAACACACACCCCCACTGG - Intergenic
927053241 2:19349794-19349816 GGGTGAACACACACACACACAGG - Intergenic
927458287 2:23276193-23276215 GGGTGAGCGCAGACCCTCACAGG + Intergenic
927677795 2:25119329-25119351 GAGTGGACAGACACCCTGACCGG + Intronic
927863253 2:26573574-26573596 AGGTGACCACACAGCCTCACAGG + Intronic
930066545 2:47332274-47332296 GGGTGAGTGCAGACCCTCACAGG + Intergenic
932737850 2:74267481-74267503 GGGTGAACTCACATACTGACAGG + Intronic
932954759 2:76337923-76337945 CCCTGAACACACACCCCCACTGG - Intergenic
934940133 2:98494959-98494981 GAGTGAACACACATTCTCTCTGG - Intronic
935007009 2:99089113-99089135 CCCTGAACACACACCTTCACTGG + Intronic
936313303 2:111404540-111404562 AGATGAACACACACACACACAGG + Intergenic
936911420 2:117597518-117597540 CTCTGAACACACACCCTCACTGG - Intergenic
937057740 2:118953778-118953800 TCCTGAACACACACCCTCACTGG + Intronic
937206368 2:120239394-120239416 GGACCAACACAGACCCTCACGGG - Intergenic
937767745 2:125680770-125680792 TCCTGAACACACACCCCCACTGG - Intergenic
938051329 2:128175212-128175234 GGGTCAACACATACACTCTCTGG - Intronic
942189396 2:173455743-173455765 AGATGAATACACACCCCCACTGG - Intergenic
942861180 2:180614156-180614178 AGCTGAACACACAACCTCATTGG - Intergenic
943909215 2:193542102-193542124 CCCTGAACACACACCTTCACTGG + Intergenic
944432186 2:199645283-199645305 CTCTGAACACACACCCCCACTGG - Intergenic
945132210 2:206585014-206585036 GTGGGAACACACACCCCCGCTGG - Intronic
945825521 2:214716552-214716574 TCCTGAACACACACCCCCACTGG + Intergenic
945864423 2:215161075-215161097 TCCTGAACACACACCCCCACTGG + Intergenic
947642678 2:231715706-231715728 GTGGCCACACACACCCTCACTGG + Intergenic
948282062 2:236754455-236754477 GGGTGCACGCACACACTCTCAGG - Intergenic
948531081 2:238606118-238606140 CCCTGAACACACACCCTCACTGG + Intergenic
948713897 2:239846666-239846688 CCCAGAACACACACCCTCACTGG + Intergenic
948765783 2:240217960-240217982 GGGTCAGCACAGCCCCTCACAGG - Intergenic
1169336319 20:4760094-4760116 AAGTGAACACACACCCCCAGTGG - Intergenic
1171160421 20:22917026-22917048 CCCTGAACACACACCCCCACTGG - Intergenic
1171378751 20:24715443-24715465 CCCTGAACACACATCCTCACTGG - Intergenic
1171461748 20:25301948-25301970 GGGGGGGCACACACGCTCACAGG - Intronic
1173842708 20:46168554-46168576 GGATGCACACACACCCTCTCTGG - Intergenic
1175952685 20:62591797-62591819 CCGTGAACACACACACACACAGG - Intergenic
1178512114 21:33214267-33214289 GGGTGAACATACCCCACCACTGG + Intergenic
1178934961 21:36853326-36853348 GGGAGAGCACTCACCCTCCCTGG + Intronic
1178958914 21:37046755-37046777 CCCTGAACACACACCCCCACTGG + Intergenic
1179545375 21:42109691-42109713 GGGTCGACACGTACCCTCACAGG - Exonic
1179793167 21:43767322-43767344 GGGCGCACACACACGCACACAGG + Intergenic
1179957473 21:44749574-44749596 TGGTGAACAGACATCCTCGCTGG - Intergenic
1180200244 21:46219792-46219814 GGCTGGACACACACACTCCCAGG - Intronic
1181454223 22:23047196-23047218 CCCTGAATACACACCCTCACTGG + Intergenic
1182125808 22:27815226-27815248 CTGTGACCACACAGCCTCACAGG - Intergenic
949177569 3:1084351-1084373 GGGTGGCCACACAGTCTCACTGG + Intergenic
950498710 3:13350217-13350239 TGCTGAACACACACACACACAGG - Intronic
953284372 3:41592169-41592191 CCTTGAACACACACCCTCACTGG + Intronic
957681275 3:83439437-83439459 CTTTGAACACACATCCTCACTGG + Intergenic
958480875 3:94643946-94643968 TCCTGAACACACACCCCCACTGG - Intergenic
958770564 3:98421340-98421362 CCCAGAACACACACCCTCACTGG + Intergenic
959875073 3:111373044-111373066 CCTTGAACACACACCCTCACTGG + Intronic
960153269 3:114272370-114272392 CTCTGAACACACATCCTCACTGG - Intergenic
960524658 3:118695713-118695735 CTGCGAACACACACCCCCACTGG + Intergenic
964248734 3:154685021-154685043 CCCTGAACACACACCCTCACTGG - Intergenic
964917600 3:161855101-161855123 TCCTGAACACACACCCACACTGG - Intergenic
964944137 3:162198035-162198057 TTGTGAACCCACACGCTCACAGG + Intergenic
965874493 3:173300062-173300084 TGCCGAACACACACCCCCACTGG - Intergenic
967651233 3:191989712-191989734 TCTTGAACACACACCCTCACTGG + Intergenic
969368582 4:6716081-6716103 GCGTGAACAGACGCCCTCGCAGG + Exonic
969781536 4:9408395-9408417 TCATGAACACACACCCGCACTGG + Intergenic
971031799 4:22645753-22645775 GTGTGTACACACACACACACAGG + Intergenic
971867280 4:32189479-32189501 GGGTGCACACACACCCGGCCAGG - Intergenic
974127051 4:57709586-57709608 CCCTGAACACACACCCTCCCTGG + Intergenic
974175306 4:58315192-58315214 ATCTGAACACACACCCACACTGG - Intergenic
974785189 4:66610012-66610034 CCCTCAACACACACCCTCACTGG - Intergenic
974801924 4:66828747-66828769 CCCTGAACACACACCCTCACTGG - Intergenic
976462832 4:85333074-85333096 TCCTGAACACACACCCTCACTGG + Intergenic
976791148 4:88880296-88880318 CCCCGAACACACACCCTCACTGG + Intronic
976963226 4:91003998-91004020 CCCTGAACACACACCCTGACTGG - Intronic
977746678 4:100558108-100558130 TTCTGAACACACACCCCCACTGG + Intronic
977845505 4:101762052-101762074 TTCTGAACACACATCCTCACTGG - Intronic
978362135 4:107942224-107942246 GGGTGAACCCAAGCCCTCCCAGG + Intronic
979446406 4:120818252-120818274 GCGTGCACACACACACACACAGG + Intronic
979704737 4:123708721-123708743 TCCTGAACACACACCCTCACTGG + Intergenic
980195174 4:129578708-129578730 AGCTGAACACACACCCCCACTGG - Intergenic
980386611 4:132093256-132093278 AGGTGCAGACACAGCCTCACCGG - Intergenic
980473367 4:133277960-133277982 AGCTGAACATACACCCTCATGGG - Intergenic
980908370 4:138971483-138971505 AGGTGAACACACACACACAAAGG + Intergenic
981213939 4:142140409-142140431 GGTTGAACACACATCCCCAAAGG + Intronic
981366890 4:143914313-143914335 TCCTGAACACACATCCTCACTGG + Intergenic
981376687 4:144024551-144024573 TCCTGAACACACATCCTCACTGG + Intergenic
981387189 4:144145897-144145919 TCCTGAACACACATCCTCACTGG + Intergenic
981559617 4:146032955-146032977 TCCTGAACACACACCCCCACTGG + Intergenic
981760910 4:148193254-148193276 TCCTGAACACACACCCCCACTGG - Intronic
983035778 4:162864542-162864564 CCCTGAACACACACCCTCACTGG + Intergenic
983895283 4:173074890-173074912 GCGTGCACACACACACACACGGG + Intergenic
984266817 4:177506018-177506040 TCCCGAACACACACCCTCACTGG - Intergenic
987901807 5:24022812-24022834 CCTTGAACACACATCCTCACTGG + Intronic
987964697 5:24856330-24856352 TGGTGAATACATATCCTCACAGG - Intergenic
988725296 5:33920471-33920493 CCCTGAACACACATCCTCACTGG - Intergenic
989747349 5:44845822-44845844 GCGTGCACACACACACACACGGG + Intergenic
990776324 5:59309534-59309556 TCCTGAACACACACCCCCACTGG - Intronic
990988336 5:61661483-61661505 TGGAGTACACACACCCTCAGGGG + Intronic
993742909 5:91562495-91562517 CTCAGAACACACACCCTCACTGG + Intergenic
994051410 5:95366234-95366256 CCCTGAACACACACTCTCACTGG - Intergenic
994844290 5:104966476-104966498 AGGTCTACACACACACTCACAGG - Intergenic
994871107 5:105351253-105351275 CCCTGAACACACATCCTCACTGG - Intergenic
996025190 5:118638138-118638160 CGCTGAACACACATCCTTACCGG + Intergenic
996080696 5:119255415-119255437 CCCTGAACACATACCCTCACTGG + Intergenic
996678338 5:126202303-126202325 TCCTGAACACACACCCTCACTGG + Intergenic
997687752 5:135800594-135800616 GGCTGTACACCCACCCTCCCGGG + Intergenic
998941052 5:147282301-147282323 TCCTGAACACACACCCCCACTGG + Intronic
999818391 5:155200391-155200413 TCCTGAACACACACCCCCACTGG + Intergenic
1000208419 5:159085309-159085331 GGGTGCACACCCACCCAAACAGG + Intronic
1000289225 5:159854678-159854700 GGGAGAACACTCACAGTCACTGG - Intergenic
1000758021 5:165184749-165184771 TCCTGAACACACATCCTCACTGG - Intergenic
1001166499 5:169373937-169373959 CCCTGAACACACACCCTCACTGG + Intergenic
1003058629 6:2844464-2844486 GGATGAACGCACTCCCTCAAGGG + Intergenic
1003216049 6:4113558-4113580 GGGAGCACACACACATTCACAGG - Intronic
1004096447 6:12559858-12559880 CTCTGAACACACATCCTCACTGG + Intergenic
1006517048 6:34550931-34550953 GTGTCCACACACACCCTCACTGG + Intronic
1007197393 6:40074333-40074355 CCCTGAACACACATCCTCACTGG - Intergenic
1007982347 6:46171692-46171714 GGCTGAACAGCCACCCTCTCTGG + Intergenic
1008797375 6:55320731-55320753 GGGTGAACACACTCCTTCCAGGG + Intergenic
1009800308 6:68528300-68528322 CCCTGAACACACACCCTCACTGG - Intergenic
1010633827 6:78232052-78232074 CTCTGAACACACACTCTCACTGG - Intergenic
1010679219 6:78780675-78780697 TCCTGAACACACACCCACACTGG + Intergenic
1011789850 6:90886078-90886100 TCCTGAACACACACCCTGACGGG - Intergenic
1011817927 6:91214115-91214137 CCCTGAACACACACCCTTACTGG - Intergenic
1011833619 6:91403908-91403930 CCCTGAACACACACCCCCACTGG + Intergenic
1012203677 6:96436172-96436194 TCCTGAACACACATCCTCACTGG + Intergenic
1013221433 6:108080919-108080941 CCCTGAACACATACCCTCACTGG - Intronic
1013856568 6:114580652-114580674 CCCTGAACACACACTCTCACTGG + Intergenic
1013913870 6:115310804-115310826 TTCTGAACACAAACCCTCACTGG - Intergenic
1014738655 6:125123823-125123845 TCCTGAACACACACCCCCACTGG + Intronic
1015644323 6:135369200-135369222 CCCTGAACACACATCCTCACTGG - Intronic
1015899746 6:138052612-138052634 CTCTGAACACACATCCTCACTGG + Intergenic
1016175848 6:141077187-141077209 CCCTGAACACACACCCTCACTGG + Intergenic
1017215531 6:151901712-151901734 CCCCGAACACACACCCTCACTGG - Intronic
1019932774 7:4234673-4234695 AGTTAAACACACACCCTCGCTGG + Intronic
1020349481 7:7202125-7202147 CTCTGAACACACATCCTCACTGG - Intronic
1020358677 7:7304068-7304090 CTCCGAACACACACCCTCACTGG - Intergenic
1022417698 7:30192104-30192126 GGTTGAGCACACACCTACACAGG - Intergenic
1025807656 7:64850223-64850245 CCTTGAACACATACCCTCACTGG - Intergenic
1027216314 7:76186058-76186080 GGGTGAACAGCCTCCCTCAGAGG - Intergenic
1028529751 7:91825275-91825297 CCCTGAACACACATCCTCACTGG - Intronic
1031418142 7:121517766-121517788 GGGGGAACACTCCCTCTCACTGG + Intergenic
1031827864 7:126588830-126588852 GGGTGAACACACACCCTCACTGG + Intronic
1032981963 7:137294331-137294353 AGGTGAACACAAGCCCACACAGG + Intronic
1034058999 7:148068456-148068478 TTCTGAACACATACCCTCACTGG - Intronic
1034748750 7:153548406-153548428 GGATGAACACACACCTACACCGG - Intergenic
1034967563 7:155400602-155400624 GGGTGACCTCACAGCCTCCCCGG - Intergenic
1035686073 8:1524301-1524323 GGGACAACACAGACCCTCACCGG + Intronic
1036837889 8:12090335-12090357 TCATGAACACACACCCCCACTGG - Intergenic
1036859679 8:12336583-12336605 TCATGAACACACACCCCCACTGG - Intergenic
1037925867 8:22843828-22843850 GGGAAAACAAAGACCCTCACAGG + Intronic
1039641382 8:39227230-39227252 TCCTGAACACACACCCCCACTGG + Intronic
1040018439 8:42719331-42719353 TGGTGAACACACATCCTGGCAGG + Intronic
1041088295 8:54278210-54278232 GGGAGAACTCACACACTCCCAGG + Intergenic
1041875401 8:62682196-62682218 CCTTGAACACACACCCTCACTGG + Intronic
1042122987 8:65507993-65508015 TCCTGAACACACACCCCCACTGG - Intergenic
1042467254 8:69141420-69141442 TCCTGAACACACACCCCCACTGG - Intergenic
1043207351 8:77462905-77462927 GCCTGAAGACACTCCCTCACAGG + Intergenic
1047063141 8:121250522-121250544 GGGTGAATGCAGACTCTCACAGG + Intergenic
1048094298 8:131274642-131274664 GGTTGAACACACATCTTCATGGG + Intergenic
1049069697 8:140347008-140347030 GGCAGGACACACACCCACACTGG + Intronic
1049182994 8:141232551-141232573 ACGTGAACACACACACTCAACGG + Intronic
1050082284 9:1927975-1927997 GGGTGAAAACTCACCCTCTGGGG + Intergenic
1050502567 9:6314670-6314692 TCCTGAACACACACCCCCACTGG + Intergenic
1051053439 9:12956383-12956405 CTTTGAACACACATCCTCACTGG - Intergenic
1051687782 9:19676149-19676171 CCCTGAACACACACCATCACTGG - Intronic
1053231905 9:36417157-36417179 CTCTGAACACACATCCTCACTGG - Intronic
1056793961 9:89644182-89644204 GGATGAACACACACTCACAATGG - Intergenic
1057071549 9:92104422-92104444 GGGATAAGACACAGCCTCACAGG - Intronic
1057855554 9:98598387-98598409 GGGTGAACACAAAACTACACAGG + Intronic
1059390128 9:113993959-113993981 CGGGGAACTCACTCCCTCACAGG - Intronic
1061803869 9:133127587-133127609 GGGTGAGCACACACCTTGGCAGG + Intronic
1061862035 9:133473091-133473113 GGCTGAACACTCACCACCACTGG + Exonic
1186223809 X:7376199-7376221 GGGTGGAGCCCCACCCTCACAGG - Intergenic
1186501911 X:10058028-10058050 GGGTGAAGACAGAACCTCAGAGG + Intronic
1189539455 X:41971184-41971206 CTCCGAACACACACCCTCACTGG + Intergenic
1189600240 X:42616071-42616093 CTCCGAACACACACCCTCACTGG - Intergenic
1189668219 X:43380490-43380512 CCCGGAACACACACCCTCACTGG + Intergenic
1190146077 X:47892785-47892807 TGGTGTACACACATCCTCATGGG + Intronic
1191100213 X:56718828-56718850 CCTTGAATACACACCCTCACTGG + Intergenic
1192713929 X:73619076-73619098 CCCTGAACACACACCCTCACTGG - Intronic
1192950781 X:76014205-76014227 CCCTGAACACACACCCTCAGTGG + Intergenic
1194471491 X:94302981-94303003 GCATGAACACACACCCTCACGGG - Intergenic
1194927026 X:99837132-99837154 TCCTGAACACACACCCCCACTGG - Intergenic
1195232089 X:102860029-102860051 CCCCGAACACACACCCTCACTGG - Intergenic
1195985238 X:110622099-110622121 CTCCGAACACACACCCTCACTGG - Intergenic
1196218799 X:113087778-113087800 TCCTGAACACACACCCCCACTGG + Intergenic
1196225288 X:113158489-113158511 CCCTGAACATACACCCTCACTGG - Intergenic
1197083422 X:122445840-122445862 CCCTGAACACACAACCTCACTGG + Intergenic
1197572271 X:128163783-128163805 CTCTGAACCCACACCCTCACTGG - Intergenic
1199162439 X:144628832-144628854 GGGAGAACTCACACCCTGATGGG + Intergenic
1200511527 Y:4085349-4085371 CCCTGAACACACACCCTCACTGG + Intergenic
1201502627 Y:14661561-14661583 GGGTTTTCACACAACCTCACTGG - Intronic