ID: 1031832614

View in Genome Browser
Species Human (GRCh38)
Location 7:126646054-126646076
Sequence GATGATGACCAGAGTGCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031832614_1031832617 -6 Left 1031832614 7:126646054-126646076 CCCACTGCACTCTGGTCATCATC 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1031832617 7:126646071-126646093 ATCATCCCTCCACATGCCCAGGG 0: 1
1: 1
2: 0
3: 16
4: 165
1031832614_1031832616 -7 Left 1031832614 7:126646054-126646076 CCCACTGCACTCTGGTCATCATC 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1031832616 7:126646070-126646092 CATCATCCCTCCACATGCCCAGG No data
1031832614_1031832618 -5 Left 1031832614 7:126646054-126646076 CCCACTGCACTCTGGTCATCATC 0: 1
1: 0
2: 1
3: 12
4: 159
Right 1031832618 7:126646072-126646094 TCATCCCTCCACATGCCCAGGGG 0: 1
1: 1
2: 1
3: 44
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031832614 Original CRISPR GATGATGACCAGAGTGCAGT GGG (reversed) Intronic
902682988 1:18056858-18056880 GATGATGACAAGAGTTCAGTTGG - Intergenic
904436772 1:30504202-30504224 GGTCATGACCAGAATGCTGTAGG + Intergenic
904750759 1:32740544-32740566 CAGGATTACTAGAGTGCAGTGGG - Intergenic
906189350 1:43885789-43885811 GGGGATGAACAAAGTGCAGTGGG + Intronic
907517638 1:55002744-55002766 GGTGATAATGAGAGTGCAGTGGG + Intronic
909342893 1:74551473-74551495 GATGATAGCCGGACTGCAGTGGG - Intergenic
914196380 1:145450147-145450169 ACGGATGACCAGAGAGCAGTCGG - Intergenic
915769067 1:158399230-158399252 GATGATGACAAAAGTGTAGCAGG + Exonic
915785433 1:158606650-158606672 GATGATGCCCAAAGTGTAGCAGG - Exonic
915798736 1:158765933-158765955 GATGAGAACCACAGTGAAGTGGG + Exonic
915847229 1:159279227-159279249 GATGATAACCACAGTGAGGTGGG + Intergenic
915850222 1:159313907-159313929 GATGATGACCACTGTGAGGTGGG + Exonic
915853320 1:159351818-159351840 GATAATGACCACAGTGAGGTGGG - Intergenic
917851941 1:179072006-179072028 GATGAGGATCAGAGAGCACTGGG - Exonic
919543761 1:198885179-198885201 ATTGATGAACAGAGAGCAGTGGG - Intergenic
921410418 1:214830453-214830475 GATGATGACCAGAACTCAGGTGG - Intergenic
923862185 1:237902763-237902785 GACTAGGACCAGAGAGCAGTGGG + Intergenic
924066347 1:240226356-240226378 AATGAAGACCAGAAGGCAGTAGG + Intronic
1065874368 10:29984052-29984074 GATGATGAGCAAAATGCTGTTGG + Intergenic
1067025136 10:42837608-42837630 GAGGATGACCTGAGTTCAGTAGG + Intergenic
1068636495 10:59353721-59353743 GAACATGACCAGGGTGCAGTTGG + Intronic
1070700381 10:78597734-78597756 GATGAAGACAAGAGAGCTGTTGG + Intergenic
1072951538 10:99850739-99850761 GATGGTGATCACTGTGCAGTGGG - Exonic
1074430654 10:113391283-113391305 GATAAGGACCAGAGGGTAGTTGG + Intergenic
1075713205 10:124541790-124541812 GTTGGAGACCAGAGTGGAGTGGG + Intronic
1079399006 11:20090796-20090818 GATGTGGACCAGTGTTCAGTAGG + Intronic
1079888149 11:26015633-26015655 GATCAGGACCAGAGTGCCTTGGG + Intergenic
1083854381 11:65385465-65385487 GATCAGGAACAGAGGGCAGTGGG - Intergenic
1085429478 11:76435054-76435076 GACAAAGAGCAGAGTGCAGTGGG + Intergenic
1085533638 11:77205698-77205720 GATGAGGACCACATAGCAGTTGG + Intronic
1091392337 12:133259-133281 GATGATGTCCAGAGTGTACGGGG + Intronic
1096876152 12:54631930-54631952 GATGATGTCCTGGGTGGAGTGGG - Intronic
1097326729 12:58285659-58285681 GAAGAGGACCAGAGTGCATATGG - Intergenic
1097482306 12:60144304-60144326 GGTGCTGATCAGAGTCCAGTGGG + Intergenic
1101392531 12:104315075-104315097 GGGGATGATTAGAGTGCAGTGGG - Intronic
1101721224 12:107352360-107352382 GATGGAGGCTAGAGTGCAGTGGG + Intronic
1108750753 13:53445927-53445949 GAAGATGGCCAGATTGCAGCAGG + Intergenic
1109646164 13:65260366-65260388 AATGAGGATCAGAATGCAGTCGG - Intergenic
1111379973 13:87436899-87436921 CATGAGGACCAGAAAGCAGTGGG + Intergenic
1111639649 13:90951383-90951405 GATGATGCCCAGAGAGAAATGGG - Intergenic
1118616184 14:67575932-67575954 GTGGATCACCAGGGTGCAGTGGG - Exonic
1118779924 14:69001080-69001102 GAGGATCACCTGAGTCCAGTGGG - Intergenic
1121419186 14:93800448-93800470 GATGTTGACCAAAGTTCAGCAGG + Intergenic
1121421534 14:93819044-93819066 GATGAGGACCAGAGTGATGCTGG - Intergenic
1122555290 14:102575765-102575787 GATAATGACCAGAATGCTGGCGG + Intergenic
1122940628 14:104979457-104979479 GGTGAGGATCAGAGTGCAGAGGG + Intergenic
1123425759 15:20169072-20169094 GAGGATGACCTGAATTCAGTAGG + Intergenic
1123534987 15:21175596-21175618 GAGGATGACCTGAATTCAGTAGG + Intergenic
1131151433 15:90049714-90049736 GAGGAGAACCAGAGGGCAGTGGG - Intronic
1135985518 16:27181013-27181035 GATTGAGACCAGAGGGCAGTGGG + Intergenic
1136858490 16:33680446-33680468 GAGGATGACCTGAATTCAGTAGG - Intergenic
1137321559 16:47388521-47388543 AATGAAGACCAGAAGGCAGTGGG + Intronic
1140281192 16:73556702-73556724 GGTGATGTCTAGAGTGGAGTGGG + Intergenic
1203120055 16_KI270728v1_random:1528921-1528943 GAGGATGACCTGAATTCAGTAGG - Intergenic
1144114045 17:12068251-12068273 GATGACATCCAAAGTGCAGTGGG + Intronic
1146295021 17:31642690-31642712 GAGGATGACCAGAGGTCACTTGG - Intergenic
1147132659 17:38418401-38418423 GATGCAGAACAGAGGGCAGTGGG + Intergenic
1147484667 17:40801153-40801175 GATGATGATCAGATTGATGTGGG + Intergenic
1148069666 17:44900877-44900899 CATGATGTCCAGAGTGCTTTGGG + Intronic
1149012016 17:51866582-51866604 AATGATGTCCAGGGTGCAGAAGG - Intronic
1151718246 17:75842471-75842493 GGTGATGACCTGCGTGCGGTGGG + Exonic
1151850125 17:76685085-76685107 GATGATGACCAAAGAGGAGCTGG - Exonic
1154944293 18:21146650-21146672 GATGATGATTAGAGTTCACTAGG - Intergenic
1157714891 18:49877645-49877667 GATGGTGACCAGAGTGCCCAGGG - Intronic
1158422362 18:57306504-57306526 CATGATGCTCAGAGTACAGTGGG - Intergenic
1158719496 18:59911432-59911454 GAGGATGGCCAGAGTCCAGTAGG + Intergenic
1160060343 18:75524145-75524167 GTAGATGAACAGAGTGCAGTAGG - Intergenic
1161974817 19:7602654-7602676 GGAGATGCCCAGGGTGCAGTGGG + Intronic
1162279293 19:9682250-9682272 GATGATTACCTGAGCTCAGTAGG - Intergenic
1162909283 19:13840699-13840721 GATGTTGAGCGGAGGGCAGTGGG - Intergenic
1163309822 19:16507198-16507220 TCTGATGTCAAGAGTGCAGTAGG + Intronic
1165979445 19:39707247-39707269 CAGGATGACCAAAGTGCAGTCGG - Exonic
925823293 2:7822179-7822201 GATTCTGAACAGGGTGCAGTTGG - Intergenic
925868125 2:8246579-8246601 GAGGGAGACCAGAGTGCAGTGGG - Intergenic
927192118 2:20524048-20524070 GATTATGCCCAGTGTGCAGAAGG - Intergenic
927321357 2:21749599-21749621 GAAGATGACCAGAGGCCACTTGG - Intergenic
928206266 2:29286163-29286185 GATCATGACCAGGGTTCAGCAGG - Intronic
928790603 2:34947781-34947803 GATGCAGACCAGAGGGCTGTGGG + Intergenic
930799704 2:55430138-55430160 GATGATCACCTGAGTCCAGGAGG + Intergenic
935544107 2:104382765-104382787 GATGGTGACCAGAGGTGAGTGGG + Intergenic
936251946 2:110874076-110874098 GAGGATGCCCAGAGGGCAGGTGG + Intronic
938092077 2:128440771-128440793 GCTGATGGCCAGGGAGCAGTGGG + Intergenic
940895138 2:159074193-159074215 TCTGGTGACCACAGTGCAGTGGG + Intronic
941104807 2:161340840-161340862 GATGATGACCAAAGAGGAGCTGG - Intronic
941264272 2:163340500-163340522 TATGATGAACAGACTGCAGAGGG + Intergenic
945306016 2:208259539-208259561 GATGATGTCCAGGAGGCAGTTGG + Intronic
945751173 2:213785134-213785156 GATGGTTACCTGAGAGCAGTAGG - Intronic
948993276 2:241565161-241565183 GATGCTGACCACAGGGGAGTGGG - Intronic
1170269402 20:14507360-14507382 GGTGATCACCAGAGACCAGTGGG + Intronic
1170432144 20:16285725-16285747 GAGGATCACCTGAGTCCAGTAGG + Intronic
1172037379 20:32019372-32019394 CAGGATGACCAGGTTGCAGTAGG - Exonic
1172495249 20:35377556-35377578 GATGATGAGAATAGAGCAGTGGG + Intronic
1173441048 20:43076682-43076704 GATAAGGACCAGAGGACAGTGGG - Intronic
1175533034 20:59687267-59687289 GATGATGATCATAGTGGTGTTGG + Intronic
1184938481 22:47742070-47742092 AGTGATGACCAGAGTCCAGTGGG - Intergenic
951355887 3:21666161-21666183 GATGATGTTCTGTGTGCAGTTGG - Intronic
951978278 3:28538770-28538792 GTTGAAGACCATAGTGCAGGAGG - Intergenic
955370848 3:58350475-58350497 TTTGATGAACAGAGTGCAGCTGG - Intronic
957428947 3:80076653-80076675 GAAAAGGACCAAAGTGCAGTTGG - Intergenic
958642225 3:96819518-96819540 GTTGATGAACAGTGTGAAGTGGG - Intronic
960417419 3:117401507-117401529 GATGAAGACCAGAGTGGGTTTGG - Intergenic
961633877 3:128321021-128321043 GCTGATGACCTGAGTGGAGGTGG + Intronic
961854731 3:129858458-129858480 GAGGATGACTAGAGTCCAGGAGG - Intronic
967215661 3:187207935-187207957 GGTCATGACCAGAGTGCTGATGG - Intergenic
968091527 3:195901160-195901182 GATGGTGAGCAGGGTCCAGTGGG - Intronic
969056095 4:4403801-4403823 AATGCTGACCAGAGTGCAGAAGG + Intronic
979682999 4:123481879-123481901 GATTAGGACCAGCGTGCATTGGG + Intergenic
981428017 4:144626286-144626308 GATGAAAATCAGAATGCAGTGGG + Intergenic
982027442 4:151264837-151264859 GATGCTGACCAGAGCTGAGTTGG + Intronic
984132014 4:175889433-175889455 GAGGATGACTTGAGTTCAGTAGG + Intronic
989205708 5:38807177-38807199 GATGATGACCAGAGGGTTGGGGG - Intergenic
992378825 5:76217081-76217103 GATGAGGCCCAGTGTGCTGTGGG - Intronic
995323512 5:110864218-110864240 GTTGATCACCAGAGTGAAGGTGG - Intergenic
995333205 5:110968788-110968810 GAGGATGAACAGAATGCTGTTGG + Intergenic
1006338680 6:33433823-33433845 GATGAAGAGTAGAGAGCAGTGGG - Intronic
1011790843 6:90896560-90896582 GAAGATGACCAGAGTTCAGCAGG + Intergenic
1014318946 6:119901814-119901836 GAATATGACAAAAGTGCAGTTGG + Intergenic
1016267033 6:142244787-142244809 GAACATGACCAGAGTTTAGTGGG + Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017553645 6:155539581-155539603 GAGTTTGACCACAGTGCAGTGGG + Intergenic
1018793921 6:167171543-167171565 CTGGATGACCAGAGTGCATTCGG + Intronic
1018822411 6:167383537-167383559 CTGGATGACCAGAGTGCATTCGG - Intronic
1021651823 7:22840156-22840178 GATGAGCACCACAGTGCGGTGGG + Intergenic
1024035857 7:45506793-45506815 GATGATGACCAGGGCTGAGTCGG - Intergenic
1025270307 7:57505775-57505797 GAAGATGGCCAGAGTGCAAGAGG + Intergenic
1028196741 7:87915723-87915745 GATGATCACCTGAGACCAGTAGG - Intergenic
1028540129 7:91934067-91934089 TATGAGGACCAGAATGCAATGGG + Intergenic
1031832614 7:126646054-126646076 GATGATGACCAGAGTGCAGTGGG - Intronic
1033271383 7:139935936-139935958 GATGATGACCACATCGCAGCAGG + Intronic
1035732012 8:1860137-1860159 GATGATGACCGGGCTGGAGTAGG - Exonic
1036003659 8:4637455-4637477 GATGATGATCCAGGTGCAGTTGG + Exonic
1036746797 8:11415554-11415576 GATGAGGCCGAGAGTGCAGTGGG + Intronic
1037522049 8:19689344-19689366 GCTGTTGACCAGAGCTCAGTTGG - Intronic
1038331721 8:26614303-26614325 GATGGGGGCCAGTGTGCAGTGGG + Intronic
1038436879 8:27542530-27542552 GAAAATGACCAAACTGCAGTTGG + Intronic
1038659672 8:29486319-29486341 GATGCAGACCAGAGTGGAGAAGG + Intergenic
1038822768 8:30968030-30968052 GGTGAAGACCAGAGTGCCCTTGG + Intergenic
1039875737 8:41583984-41584006 GAGGATCACCTGAGTCCAGTCGG - Intronic
1040709375 8:50169906-50169928 CATCAAGACTAGAGTGCAGTGGG - Intronic
1045018820 8:98023579-98023601 GAGGATCACCTGAGTGCAGGAGG + Intronic
1045314067 8:101027970-101027992 AATGATGACCAGCGTTCAGAGGG + Intergenic
1046619015 8:116508048-116508070 GAAGATGCCCAGAAGGCAGTTGG + Intergenic
1047486600 8:125336527-125336549 GATGAGGATCAGAGTGGATTTGG + Intronic
1047851631 8:128863570-128863592 GCAAATGACCAGAGTGGAGTCGG - Intergenic
1047889606 8:129293383-129293405 TATGAAGGTCAGAGTGCAGTAGG + Intergenic
1049754149 8:144301327-144301349 GAGGATCACCTGAGTGCAGGAGG + Intronic
1051818833 9:21141231-21141253 GATGAAGTCCAGTGTGGAGTTGG + Exonic
1051821774 9:21178850-21178872 GATGAAGTCCAGTGTGGAGTTGG + Intergenic
1051843113 9:21420552-21420574 GATGAAGTCCAGTGTGGAGTTGG - Intronic
1053145922 9:35712036-35712058 GATAATGCCCTGAGGGCAGTTGG - Exonic
1055158212 9:73091225-73091247 TATGATGACCAAAGTTCATTAGG - Intergenic
1055554254 9:77459556-77459578 GATGAGGACCTGAGAGCAGTGGG - Intronic
1055759260 9:79589338-79589360 GATGATAAGCAGAGTGGGGTTGG + Intronic
1056561323 9:87732466-87732488 GGTGATGACCAGCATGTAGTGGG - Intergenic
1056666317 9:88583472-88583494 GATGCTGACCAGAGACCAGCGGG - Intronic
1057775874 9:98008961-98008983 GATGATGACTGTAGTGCAGTAGG - Intronic
1058528767 9:105885684-105885706 GATGGTGATTAGAGTGCAGGAGG - Intergenic
1058568528 9:106313646-106313668 AATGATTTCCAGAGTGCAGGTGG + Intergenic
1061490564 9:130941695-130941717 GCTGATGACCACAGAGCACTGGG + Intergenic
1062675840 9:137743218-137743240 GCTGATGACCTGCGGGCAGTGGG + Intronic
1062698352 9:137886688-137886710 ACGGATGACCAGAGAGCAGTCGG + Intronic
1203774517 EBV:65320-65342 GATGTTGGCCAGATTGCAGGTGG - Intergenic
1188341663 X:29009546-29009568 GTTGATGATCAGATTGCTGTAGG + Intronic
1191669608 X:63737032-63737054 GATGATGTCTATAGAGCAGTGGG - Intronic
1193120241 X:77815647-77815669 AATGATGACTTAAGTGCAGTAGG - Intergenic
1194099769 X:89689315-89689337 GAGGATCACCTGAGTCCAGTTGG + Intergenic
1194123005 X:89982680-89982702 GATGAAGAGCAGAAGGCAGTGGG + Intergenic
1194233225 X:91349400-91349422 GGAGAGCACCAGAGTGCAGTGGG - Intergenic
1196205613 X:112935993-112936015 CAAGATGACCAGAGTGCTGGAGG + Intergenic
1199776789 X:151018995-151019017 GAGGATGACCCGAGTCCAGGAGG + Intergenic
1200452772 Y:3350683-3350705 GAGGATCACCTGAGTCCAGTTGG + Intergenic
1200475864 Y:3640116-3640138 GATGAAGAGCAGAAGGCAGTGGG + Intergenic
1201117963 Y:10848995-10849017 GGAGAGGATCAGAGTGCAGTTGG - Intergenic