ID: 1031832672

View in Genome Browser
Species Human (GRCh38)
Location 7:126646481-126646503
Sequence GTTTCAATGCTGAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031832672_1031832677 22 Left 1031832672 7:126646481-126646503 CCTCCCTCTCTCAGCATTGAAAC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1031832677 7:126646526-126646548 TGTGTCCATGTTGCCAAACCAGG No data
1031832672_1031832675 -9 Left 1031832672 7:126646481-126646503 CCTCCCTCTCTCAGCATTGAAAC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1031832675 7:126646495-126646517 CATTGAAACTTCCATTTCAAAGG 0: 1
1: 1
2: 3
3: 42
4: 522
1031832672_1031832679 27 Left 1031832672 7:126646481-126646503 CCTCCCTCTCTCAGCATTGAAAC 0: 1
1: 0
2: 1
3: 19
4: 151
Right 1031832679 7:126646531-126646553 CCATGTTGCCAAACCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031832672 Original CRISPR GTTTCAATGCTGAGAGAGGG AGG (reversed) Intronic
902682330 1:18052119-18052141 ATTTAAATGCTGAGAGGAGGTGG - Intergenic
902971731 1:20058202-20058224 TGTTCATTACTGAGAGAGGGTGG + Intronic
903975112 1:27144567-27144589 GTTTGACTGCTCAGAGAGGAGGG - Intronic
904719263 1:32494525-32494547 CTTGCAATGCTTAGACAGGGAGG + Exonic
905014873 1:34770924-34770946 GCTTAAATGCTGAGAGATGCAGG - Intronic
905363036 1:37433481-37433503 GCCTCAAGGCTGAGAGAAGGTGG - Intergenic
906049158 1:42856472-42856494 GTGGCAATCCAGAGAGAGGGTGG - Intergenic
907325800 1:53638027-53638049 GTTATAATCCTGAGAGAGGGAGG + Intronic
907702954 1:56807018-56807040 GTTGCAATGCTGAGTGAGTGTGG - Intronic
908532823 1:65049798-65049820 CTTGCAATGCTAAGAGAAGGAGG - Intergenic
912624179 1:111194251-111194273 CTTGCAAGGCTGAGGGAGGGTGG - Intronic
914460994 1:147885038-147885060 GGTTCAAAGCTGAGAGCTGGTGG - Intergenic
916719345 1:167472587-167472609 GTTTCATAGCTGGGTGAGGGAGG + Intronic
919611074 1:199746320-199746342 GTGTCCATGATGAGAGAGGCAGG + Intergenic
922423567 1:225475002-225475024 ATTTCACAGCTGAGAGACGGAGG - Intergenic
1064042289 10:11977869-11977891 GTTTCTATGTTTAGAGAGGTTGG - Intronic
1067690959 10:48502021-48502043 TTTTCATTGCTGAGAGAGTCAGG + Intronic
1070428978 10:76317090-76317112 GCTCCAATGCAGAGAGAGTGTGG + Intronic
1072223971 10:93350871-93350893 GTGTATATGCTGAGAGATGGGGG - Intronic
1072519874 10:96221932-96221954 GATTCACAGCTGAGAGAGAGGGG + Intronic
1073473853 10:103740292-103740314 GTTTTAAAGCTTAGAGAGTGTGG + Intronic
1075649404 10:124117742-124117764 GTCTCAAAGCTGAGTGAGGCTGG - Intergenic
1075932925 10:126314377-126314399 GTTTCAATGCAGACAGAGTAGGG + Intronic
1076092039 10:127694748-127694770 GCTGCAAGGCTGAGAGATGGAGG - Intergenic
1078800522 11:14640104-14640126 GATTAAATGCTGGTAGAGGGGGG + Intronic
1080431676 11:32205331-32205353 GTTTCAAAGATGGGAGAGAGTGG + Intergenic
1081737101 11:45411699-45411721 GAGTTAATGCTGAGTGAGGGAGG - Intergenic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1083000090 11:59283531-59283553 GTTTCCTTGCTGAGTGTGGGAGG - Intergenic
1083018058 11:59476809-59476831 ATTTCGCTGCTGAGAGAGGCAGG - Intergenic
1083275017 11:61591993-61592015 ATTGCAATGTTGAGACAGGGTGG + Intergenic
1083592141 11:63902097-63902119 GTTTGAGTGTTGGGAGAGGGCGG + Intronic
1084646636 11:70462973-70462995 GATTCAATGCAGGGAGAAGGTGG + Intergenic
1088899376 11:114103635-114103657 GTTTAGATGCTGACACAGGGTGG - Intronic
1089218252 11:116849063-116849085 GTTTCAAGGCTGGGACTGGGAGG + Intronic
1089413565 11:118267444-118267466 TTTTCAAAGATGAGAGAGGGAGG + Intergenic
1089615764 11:119693845-119693867 TTTTTAATGCTGGGAAAGGGTGG + Intronic
1091371599 11:135064921-135064943 GTTTCCAACCTCAGAGAGGGAGG - Intergenic
1091722507 12:2823712-2823734 GTTTCAGTGCCGACAGTGGGGGG - Intronic
1092290546 12:7157472-7157494 GTATCACTGCAGAGAGAGCGCGG - Exonic
1096485375 12:51976818-51976840 GTTGCAAAGCTTAGAGAGGCAGG - Intronic
1097035180 12:56119152-56119174 GTATCAATTCTGGGAGAGTGGGG + Intronic
1097361084 12:58658624-58658646 GCTCCAATGATGAGAGAGGGAGG + Intronic
1102594014 12:113978560-113978582 GTTTCACTGCCAAGAGAAGGAGG - Intergenic
1103178712 12:118888810-118888832 GTTTTCCTTCTGAGAGAGGGAGG + Intergenic
1107095777 13:36533547-36533569 ATCTCTATGCTGAGAGAGGAAGG + Intergenic
1109110260 13:58308867-58308889 GGTTGAAAGTTGAGAGAGGGAGG + Intergenic
1110475123 13:75904884-75904906 GTTCCCATGTCGAGAGAGGGAGG - Intergenic
1111487153 13:88918979-88919001 GTTTCAATGCTGACTTAAGGTGG - Intergenic
1113264161 13:108598625-108598647 GTTTCAATGGTGAAATAGGCAGG + Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1121418062 14:93792871-93792893 GGTTCAATGATGGGAGATGGTGG + Intergenic
1121437809 14:93930448-93930470 GCTCCACGGCTGAGAGAGGGTGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1125024209 15:35014091-35014113 ATTTCGATGCTGAAAGAGGGAGG + Intergenic
1125177545 15:36842085-36842107 GTTTCCATGTTAACAGAGGGAGG - Intergenic
1125381323 15:39090558-39090580 ATTTCAAGGATGAGATAGGGTGG - Intergenic
1128719233 15:69934017-69934039 GATTCAATTGTGACAGAGGGTGG + Intergenic
1130579083 15:85118576-85118598 GTTTAAATCCTGAGGGAGGTGGG - Intronic
1132854829 16:2040065-2040087 GGGTCAGTGCTGACAGAGGGCGG + Intronic
1135229024 16:20687497-20687519 TCTTCAAGACTGAGAGAGGGGGG + Intronic
1135911036 16:26560879-26560901 GGAACATTGCTGAGAGAGGGTGG + Intergenic
1139280024 16:65762609-65762631 CTTCCAATGCTGGGAGAGGATGG + Intergenic
1139332881 16:66207521-66207543 GCTTCCATGTTGAGAGACGGTGG - Intergenic
1139953396 16:70682395-70682417 GTTTCAAGGCTGAGTGGGGGTGG - Intronic
1145933672 17:28702898-28702920 GAGTCAATGCTGGGAGAGTGGGG + Intergenic
1147482142 17:40776226-40776248 ATTTCAAGGCTGGGAGTGGGAGG - Intergenic
1147862110 17:43529791-43529813 GTTTCATTGTTGCAAGAGGGTGG - Intronic
1147932896 17:43994232-43994254 GTTCCCAGGCAGAGAGAGGGGGG - Intronic
1149620469 17:58041073-58041095 GTTTAAAAGAAGAGAGAGGGGGG - Intergenic
1150617920 17:66786255-66786277 GTTACCAGGCTGAGAGAGGAAGG - Intronic
1151000593 17:70370819-70370841 GTTTCAATCCAGAAAGAAGGAGG + Intergenic
1151426960 17:74037234-74037256 GTTTTAATGCTGAAAGAGAAAGG - Intergenic
1152172018 17:78757580-78757602 CTGCCAATGCTGAGAGAGGCAGG + Intronic
1153248279 18:3095165-3095187 GTTTCAAGGTGGAGAGAAGGTGG + Intronic
1153774047 18:8437342-8437364 GATTCCCTGCTGGGAGAGGGTGG - Intergenic
1156628345 18:38937349-38937371 GTTTCCAGGCTGAGACTGGGAGG - Intergenic
1156671837 18:39479947-39479969 GTTTCAATACAGAGACAAGGTGG - Intergenic
1157790773 18:50529073-50529095 GATTGAATGCTGAGAGCGGAAGG - Intergenic
1161943217 19:7418778-7418800 GATTCAAGGGGGAGAGAGGGAGG + Intronic
1164074387 19:21800797-21800819 GTTGCAATGCTGGGACAGGTTGG - Intergenic
1165326633 19:35117915-35117937 GCAAAAATGCTGAGAGAGGGTGG - Intronic
1165883910 19:39063498-39063520 GTTTTAATGCTGAGGATGGGCGG + Intergenic
1166547825 19:43644499-43644521 GTTTCCATGCTGAGTTAGAGTGG + Intergenic
925295379 2:2772987-2773009 GTTTCATTGCTGAGACACGGTGG - Intergenic
929693383 2:44093198-44093220 GTTTTATTGCTGAAACAGGGAGG + Intergenic
931430001 2:62201731-62201753 GTTATAGTGGTGAGAGAGGGTGG - Intronic
932740586 2:74287829-74287851 GTTTCTAGGCTGAGAGAAAGAGG - Intronic
932969853 2:76527645-76527667 GCTTCAATGCGGGGGGAGGGGGG - Intergenic
933587912 2:84200229-84200251 GTTCCACTGCTGAGAGAAGGTGG + Intergenic
933848659 2:86348295-86348317 GATGCAATGCTGAGAGACCGAGG + Intergenic
936886961 2:117322049-117322071 CTATCAATGCTGAGAGTGAGAGG + Intergenic
941252660 2:163185780-163185802 GTGTCTATGCTGTGAGAAGGGGG - Intergenic
942406841 2:175665230-175665252 TTCTCAATGCTGAGAGGAGGAGG - Intergenic
942876906 2:180811340-180811362 CTTTTAAGGCTGAGAGAGGGAGG + Intergenic
943568231 2:189542193-189542215 GTCTCAGTGCAGAGAGAGGCAGG - Intergenic
943643209 2:190381529-190381551 TTTTTAATGCTCAAAGAGGGGGG - Intergenic
945348086 2:208743599-208743621 GTTTTATTGGTGAGAGAGGAGGG - Intronic
946733762 2:222733983-222734005 CTTTCATTGCTGAGAGGGGGTGG + Intergenic
947581098 2:231319091-231319113 GCTTCTATCCTGAGAGAGGAGGG + Intronic
948044989 2:234936616-234936638 ATTTCAATGCAGAGCGAGGGCGG + Intergenic
1169117032 20:3072399-3072421 GTTTCAGCGCTGGGAGAAGGTGG - Exonic
1173782274 20:45765938-45765960 GTCTCAATCTTGAGAGAAGGGGG + Intronic
1176173881 20:63708566-63708588 TCGTCCATGCTGAGAGAGGGAGG - Exonic
1178527691 21:33346085-33346107 ATTTTAATGCTTAGAGATGGGGG - Intronic
1179568088 21:42261541-42261563 GTTTCAGTGGAGAGAGGGGGTGG - Intronic
1179823398 21:43950561-43950583 GTCCGAATGCTGAGAGAGGGCGG - Intronic
1181000632 22:19986428-19986450 ACCTCAATGCTGAGAGGGGGAGG + Intronic
1181953499 22:26571618-26571640 GTTGCTATGCTGAGAGGGGCCGG - Intronic
1182814116 22:33143466-33143488 GCTTCAATGCCCAGAGAGAGAGG + Intergenic
1182819440 22:33202400-33202422 GTTTCATGCCTGAGAGAGGAAGG - Intronic
956780153 3:72597168-72597190 GTTTGATTGCAGAGAGAGAGAGG - Intergenic
959600621 3:108180098-108180120 GTTTCAATTCTGTGATAGGTAGG - Intronic
960154580 3:114285758-114285780 CTATCAAGGCTGAGAGAGGTAGG - Intronic
963559593 3:146846734-146846756 GTTTCAGAGGTGAGAGAGGTTGG - Intergenic
970059718 4:12018822-12018844 ATTTTAATACTGAGAGAGAGAGG + Intergenic
971162308 4:24145927-24145949 ATTTCAATGTTGGGAGAGGCAGG + Intergenic
971180969 4:24328254-24328276 GTTTTAATGCTGATTGGGGGGGG - Intergenic
978215198 4:106192569-106192591 GTTTCAATTTTGAGGGAAGGGGG + Intronic
982849299 4:160292374-160292396 ATCTGAATGCAGAGAGAGGGAGG - Intergenic
983647339 4:170005069-170005091 GTTTCTAGGCTGAGGCAGGGAGG - Intronic
986761776 5:10886436-10886458 ATTTCAATGCTGAGAGGGCATGG - Intergenic
987554033 5:19422231-19422253 GTATAAATGGTGAGAAAGGGAGG + Intergenic
987791239 5:22571037-22571059 CTTTGAAGGCTGAGAGAAGGAGG - Intronic
989682928 5:44050795-44050817 CTTTGAATGATGAGAGATGGTGG + Intergenic
990822235 5:59854959-59854981 GTTTCAAAGATGAGAAAGGAGGG + Intronic
994677807 5:102847015-102847037 CTTTCAAGGCTGGGAGAGTGTGG + Intronic
995538983 5:113165801-113165823 GCTTCATTGCTGAGGGAGGTGGG + Intronic
999651339 5:153770455-153770477 GCTTCATTCCTGAGATAGGGAGG - Intronic
1003230936 6:4253229-4253251 GGTTGAATGTTGAGAGAGGGTGG - Intergenic
1003246011 6:4382812-4382834 ATTTCACTGCAGAGACAGGGAGG + Intergenic
1004415763 6:15422777-15422799 CTTAAAATTCTGAGAGAGGGAGG - Intronic
1005915888 6:30351214-30351236 GTTTCAAAGCAGAGTGAGGCAGG - Intergenic
1007630495 6:43270512-43270534 GTTTCAATGCTCAGTGATCGGGG + Intronic
1008545291 6:52577694-52577716 GCTCCAATGCGGGGAGAGGGTGG + Intergenic
1011593248 6:88991380-88991402 ATTTTAATGCTGAAAGAGGTTGG + Intergenic
1011644811 6:89447428-89447450 GTGTAAAGGCTGAGAGAGGTGGG + Intronic
1013493565 6:110674959-110674981 GTGTGAAGGCTGAGAGAGGTGGG + Intronic
1013983167 6:116157720-116157742 GTTGAAATGGTGAGAGTGGGTGG + Intronic
1015550025 6:134402589-134402611 GATTCATTGCTGAGAGTGGGTGG - Intergenic
1021296245 7:18910026-18910048 TGTCCAATGCTGAGAGAGTGGGG + Intronic
1023551562 7:41375322-41375344 GTTTCAAGGCTGAAGGAGAGGGG + Intergenic
1024290492 7:47800368-47800390 GATTCAGTGCAGAGTGAGGGGGG + Intronic
1025215723 7:57054405-57054427 GTTTCAGTACTGAGACAAGGAGG - Intergenic
1025572714 7:62596820-62596842 GTTTCAACTCTGAGAGATGAAGG + Intergenic
1026220200 7:68389357-68389379 GTTTCAATGATGTGAGAAGGAGG - Intergenic
1027035511 7:74922438-74922460 GTTTTAATGATGAGAGAGGCTGG + Intergenic
1028415404 7:90574942-90574964 GTTTCAGAGCAGAGACAGGGAGG + Intronic
1029248239 7:99218006-99218028 GTTTCAATGCTGAGAAAGAGGGG + Intergenic
1029394547 7:100298699-100298721 GTTTTAATGATGAGAGAGGCTGG - Intergenic
1031503155 7:122546812-122546834 GTTTTAATGATGAGACAGGCAGG - Intronic
1031832672 7:126646481-126646503 GTTTCAATGCTGAGAGAGGGAGG - Intronic
1032463447 7:132128456-132128478 CTTTCTATGCTGAGAGCTGGTGG - Exonic
1034215838 7:149404970-149404992 CTGTCACTGCTGACAGAGGGCGG + Intergenic
1037580052 8:20239746-20239768 GTGGCAGAGCTGAGAGAGGGGGG + Intergenic
1038400163 8:27278498-27278520 GCTTTGATGCTGAGAGAGGCTGG - Intergenic
1039150436 8:34498867-34498889 GTTTGAATATTAAGAGAGGGAGG + Intergenic
1041056408 8:53990819-53990841 GTTTAAATGCTTAGAAAGGAAGG - Intronic
1045696402 8:104813389-104813411 GTTTCAAAGGAGAGATAGGGCGG + Intronic
1047601295 8:126428501-126428523 TTTTCATTGCTGAGATGGGGAGG - Intergenic
1049581466 8:143413050-143413072 GTGTCATTGCTAAGAGAAGGAGG - Intergenic
1050305648 9:4303031-4303053 GTTTCATTGCTGTGAGACAGTGG - Intronic
1052636473 9:31112491-31112513 GTGTCAATGCTGACAGAGTTGGG + Intergenic
1057330283 9:94107754-94107776 GTTTCTATTTTGAGAGAAGGAGG - Intronic
1058186989 9:101866759-101866781 GGTTTAATGCTGACAAAGGGAGG + Intergenic
1187268125 X:17755966-17755988 GTTTCTATGCCTACAGAGGGAGG - Intergenic
1187321114 X:18238317-18238339 GTTTCTATGCCTACAGAGGGAGG + Intergenic
1189589976 X:42500460-42500482 ATTTCAAGACTGAGTGAGGGCGG - Intergenic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1197879243 X:131147518-131147540 TTTTTAATGATGAGAGAGGAGGG - Intergenic
1198327472 X:135587558-135587580 GTTTCTTAGCTGAGAGAGGAGGG - Intergenic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic