ID: 1031832849

View in Genome Browser
Species Human (GRCh38)
Location 7:126648608-126648630
Sequence AATTAGCCAGATTTGCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031832849_1031832852 15 Left 1031832849 7:126648608-126648630 CCAAAAGGCAAATCTGGCTAATT 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1031832852 7:126648646-126648668 TGCATTTATGCTTTTGGATCAGG 0: 1
1: 0
2: 1
3: 14
4: 223
1031832849_1031832853 16 Left 1031832849 7:126648608-126648630 CCAAAAGGCAAATCTGGCTAATT 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1031832853 7:126648647-126648669 GCATTTATGCTTTTGGATCAGGG No data
1031832849_1031832850 -9 Left 1031832849 7:126648608-126648630 CCAAAAGGCAAATCTGGCTAATT 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1031832850 7:126648622-126648644 TGGCTAATTTCTCAGATGACTGG 0: 1
1: 0
2: 1
3: 6
4: 131
1031832849_1031832851 9 Left 1031832849 7:126648608-126648630 CCAAAAGGCAAATCTGGCTAATT 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1031832851 7:126648640-126648662 ACTGGATGCATTTATGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031832849 Original CRISPR AATTAGCCAGATTTGCCTTT TGG (reversed) Intronic
901884763 1:12215147-12215169 ATATGGCCAGATTTGTCTTTTGG + Intergenic
906659159 1:47570435-47570457 AAATGGCCAGATTTCCCTTGAGG - Intergenic
909186050 1:72487388-72487410 AAATTTCTAGATTTGCCTTTTGG + Intergenic
909261655 1:73497212-73497234 AATTAACCAGATTTACAGTTGGG - Intergenic
909431019 1:75588004-75588026 AAATGACCAGATTTGCCTTCTGG - Intronic
909887061 1:80955300-80955322 ACTTAGCAATATTTGCCATTAGG + Intergenic
912594285 1:110858723-110858745 CATATGCCAGATTTGCCTCTAGG + Intergenic
914048662 1:144113570-144113592 AATTAGCCAGATGTGGCGGTGGG + Intergenic
914130522 1:144851878-144851900 AATTAGCCAGATGTGGCGGTGGG - Intergenic
915488459 1:156238469-156238491 AATGAGACAGATTTTCCTATGGG + Intronic
916664240 1:166951067-166951089 AAATTGCCAGAGTTTCCTTTAGG + Intronic
919962688 1:202487754-202487776 AATTAGCCAGATGTGCTGGTGGG - Intronic
920937297 1:210447546-210447568 AATTGTCAGGATTTGCCTTTTGG - Intronic
921563805 1:216691651-216691673 ACTTGGCCAGATTTGTCTTCAGG - Intronic
921756968 1:218868782-218868804 AATTAGCCAGATGTGGTTGTAGG + Intergenic
922448669 1:225719022-225719044 AAGTGGCCAGAGTTCCCTTTGGG - Intergenic
923081468 1:230660251-230660273 AATGAGCCATATTTGCATTTGGG + Intronic
923300612 1:232637252-232637274 AATTTGATAGATTTGGCTTTAGG - Intergenic
923577202 1:235170169-235170191 AGTAAGCCAGATTTGCCCCTGGG - Intronic
924714842 1:246563743-246563765 TATTATACAGAATTGCCTTTAGG + Intronic
1062891339 10:1062935-1062957 AATTAGCCAGATGTGCTGTTGGG + Intronic
1063038553 10:2314167-2314189 AATTAGCCAGATTTGGTGGTAGG + Intergenic
1063804368 10:9621175-9621197 AAGAGGCCAGATTTTCCTTTTGG + Intergenic
1064890812 10:20170782-20170804 AAATAGCCAGATGTGCCTAGTGG + Intronic
1064962149 10:20977117-20977139 ATTTAGGGAGATTTGACTTTGGG - Intronic
1067422733 10:46170888-46170910 ACTTAGCCAGACTTGCATTAAGG + Intergenic
1068518775 10:58056385-58056407 AATTAGCCAGGTTTGGTTGTAGG - Intergenic
1071745134 10:88409251-88409273 AATTAGCCCTATTTACCATTTGG + Intronic
1071773736 10:88760887-88760909 AATACGCAAAATTTGCCTTTGGG + Intergenic
1079311642 11:19371924-19371946 AATTAGCCAGATGTGGTTCTGGG - Intronic
1081443431 11:43105836-43105858 AATGGGCCAGATTTGCCCATGGG + Intergenic
1082072168 11:47947907-47947929 AATTAGCCAGACTTGGTGTTGGG + Intergenic
1082109472 11:48258478-48258500 TCTTTGCAAGATTTGCCTTTGGG - Intergenic
1085142051 11:74154758-74154780 GATGAGCCAGATTTGGCTTGGGG + Intronic
1085559500 11:77457815-77457837 AATAAGACAGGTTTTCCTTTTGG + Intronic
1086296599 11:85374486-85374508 AATTAGCCAGGTGTGGCTGTAGG - Intronic
1089033745 11:115362313-115362335 AGTTAACCAGATTGGCCATTTGG + Intronic
1089222381 11:116884616-116884638 AAATAGCCAGATGTCACTTTGGG - Intronic
1089398571 11:118151696-118151718 TATTGGTCAGATTTGGCTTTTGG - Intronic
1089715867 11:120358591-120358613 AAATAGCCACATTTGTCTTGTGG - Intronic
1091762842 12:3098438-3098460 AAACTGCCAAATTTGCCTTTAGG + Intronic
1092015450 12:5154950-5154972 CATTAATCACATTTGCCTTTTGG - Intergenic
1093665481 12:21807826-21807848 AATTAGCTAAATGTGACTTTGGG - Intronic
1093868579 12:24258208-24258230 ACTAAGCCATATTTGGCTTTGGG + Intergenic
1094150802 12:27281013-27281035 AATTATCTTGAGTTGCCTTTAGG + Intronic
1095404846 12:41856539-41856561 CATGGGCCAGATTTCCCTTTTGG + Intergenic
1095822683 12:46496177-46496199 AATTAGCCAGGTGTGCTTGTGGG + Intergenic
1096702140 12:53392327-53392349 AATTAGCCAGGTGTGGCTGTGGG - Intronic
1096764212 12:53869867-53869889 AATGAGCTAGAATTGCCATTAGG - Intergenic
1097038615 12:56140686-56140708 ACATATCCAGATTTGCATTTTGG + Intronic
1097456639 12:59806393-59806415 AATTAGCCAGATGTGGTTGTGGG + Intergenic
1097558636 12:61172529-61172551 ACTTTGCCAGATATACCTTTGGG - Intergenic
1097666709 12:62485850-62485872 AATTAGCCAGATGTGGTGTTGGG - Intronic
1098763659 12:74457124-74457146 AATAAGGCAAGTTTGCCTTTAGG + Intergenic
1099035235 12:77579157-77579179 AAAAACCCAGATTTGGCTTTTGG - Intergenic
1099459840 12:82908843-82908865 AAAGAGCCAAATTTGCTTTTGGG + Intronic
1100013067 12:89976847-89976869 AAGTGGGCAGATTTGCTTTTTGG + Intergenic
1102883077 12:116500930-116500952 AATTAGCCAGATGTGGTGTTGGG + Intergenic
1105994770 13:25659835-25659857 AATTTGGCAGCTGTGCCTTTAGG + Intronic
1107606193 13:42059616-42059638 AATTGGCCAGGTTGGCTTTTAGG + Intronic
1108407497 13:50120198-50120220 AATTAGAGGGATTAGCCTTTAGG + Intronic
1109901338 13:68776257-68776279 AATTATCAGGATTTGCCTTTTGG + Intergenic
1109932743 13:69236559-69236581 AATGTCCCAAATTTGCCTTTAGG - Intergenic
1110354446 13:74550972-74550994 AATTAGGAAAATTTGTCTTTTGG + Intergenic
1112159390 13:96852111-96852133 AATTAACCATCTTTGCCATTGGG + Intergenic
1114345238 14:21787888-21787910 AATTAGCCAGGTGTGCCAGTGGG + Intergenic
1114927965 14:27428503-27428525 AATTAGCTAGGTTTTGCTTTAGG + Intergenic
1115654945 14:35434395-35434417 AATTAGCCAGGTATGCCGGTGGG - Intergenic
1120328651 14:83059594-83059616 AATTAGCTATTTTTGTCTTTTGG + Intergenic
1121239988 14:92422442-92422464 GATTATCCAGATTTGAGTTTTGG + Intronic
1125095668 15:35848256-35848278 AAGTAGCCAGTTTTGCTTTCAGG - Intergenic
1126312397 15:47332726-47332748 TATCTGCCAGATTAGCCTTTAGG + Intronic
1130518827 15:84646603-84646625 AAAAAGCCAGAATTGCTTTTTGG - Intronic
1132969806 16:2681457-2681479 AATTAGCCAGATGTGGTTGTGGG - Intergenic
1133489053 16:6249374-6249396 AATTAGCCAGACATGGTTTTGGG + Intronic
1133942933 16:10325510-10325532 AATTAGCCAGGTGTGGCTCTGGG + Intergenic
1134282696 16:12831846-12831868 AATTAGCCAGATGTGGTTGTGGG - Intergenic
1135812972 16:25606511-25606533 AATTAGCCAGGTGTGCTTGTGGG + Intergenic
1136090375 16:27915327-27915349 AATTTGCCAGACTTTCATTTTGG + Intronic
1136343690 16:29662193-29662215 AATTAGCAAGCTTTGACTCTCGG - Intergenic
1143417702 17:6761603-6761625 CATTGGCCAGTTTTGCCCTTGGG - Intronic
1143566295 17:7723116-7723138 AATTAGCCAGATGTGCTGGTGGG - Intronic
1143698764 17:8641226-8641248 AATTAGCCAGGTTTGGTGTTGGG + Intergenic
1145803109 17:27703917-27703939 ATTTATTCAGATTTGGCTTTAGG + Intergenic
1146152762 17:30490249-30490271 ATTTATTCAGATTTGGCTTTAGG + Intronic
1146644931 17:34571070-34571092 AATTCCCCAGATTTACATTTAGG - Intergenic
1149797571 17:59534748-59534770 AATTAGACAGATTGTCCTTTAGG + Intergenic
1150356037 17:64485497-64485519 AATTAAACAGAAATGCCTTTGGG + Intronic
1151400545 17:73853084-73853106 AATTAGCCAGTTTAACATTTGGG + Intergenic
1153810614 18:8748757-8748779 TATTAGCCAGTTCTGTCTTTCGG + Intronic
1153838092 18:8982244-8982266 AATTAGCCAGGTTTGCTGGTGGG - Intergenic
1154507499 18:15057227-15057249 AAAGAGACACATTTGCCTTTGGG - Intergenic
1156785313 18:40905789-40905811 AATTAGCCAGATGTGCTGGTGGG - Intergenic
1157012705 18:43670753-43670775 AATTAGCCAGGTTTGGTTGTGGG - Intergenic
1158950193 18:62487391-62487413 AATTAGCCAGGTGTGGCCTTCGG - Intergenic
1159367092 18:67482168-67482190 AATGTGACAGATTTGCATTTTGG - Intergenic
1159462167 18:68735617-68735639 TCATTGCCAGATTTGCCTTTGGG - Intronic
1164307816 19:24020427-24020449 AATTAGCCAGATGTGGTTGTGGG - Intergenic
1167511284 19:49896580-49896602 AATTAGCCAGGTTTGGTTATGGG - Intronic
1168438377 19:56341019-56341041 AAGTAGGCAGATTTGCCCTGAGG - Intronic
1202688115 1_KI270712v1_random:66473-66495 AATTAGCCAGATGTGGCGGTGGG + Intergenic
926655832 2:15404659-15404681 AATTAGCCAGATGTGATTGTGGG - Intronic
927002842 2:18816807-18816829 CAAAAGCCAGATTTGCCTATAGG - Intergenic
928595009 2:32851730-32851752 AATTAGCCAGAACTTCCATTTGG + Intergenic
928722367 2:34134484-34134506 AATGAGAAAGATTTTCCTTTTGG + Intergenic
928931316 2:36627855-36627877 AATAAGGCAAATGTGCCTTTTGG + Intronic
929500805 2:42490034-42490056 CATTAGCCAGTTTTGTGTTTAGG - Intronic
931017736 2:58005153-58005175 AATTAGCCAGGTCAGCCTGTAGG + Intronic
931858737 2:66331599-66331621 AATTATCCAGTTTTCCTTTTCGG - Intergenic
932012183 2:67989529-67989551 AATTAGAGAAATTTTCCTTTTGG - Intergenic
933674931 2:85046479-85046501 AATTAGCCAGATTTGGTGGTGGG + Intronic
933958239 2:87389121-87389143 AATTAGCCAGATGTGGCGGTGGG - Intergenic
934242364 2:90281038-90281060 AATTAGCCAGATGTGGCGGTGGG - Intergenic
936891834 2:117379633-117379655 AGTTTGCAAGATTGGCCTTTAGG - Intergenic
937194702 2:120142748-120142770 GGTTGGCCAGATTTGCCCTTTGG + Intronic
938136165 2:128758587-128758609 AATTAGCCAGGTGTGGCTATAGG - Intergenic
939144686 2:138397875-138397897 AATAACTCAGATTTGCTTTTTGG - Intergenic
939190985 2:138916560-138916582 AACTAGACAGATTTGCCTCCAGG - Intergenic
939365570 2:141226054-141226076 AATTAGGTAGGTTTGCATTTGGG - Intronic
939897595 2:147810703-147810725 ACTTAGTGAGATTTGCCTTTCGG - Intergenic
940028211 2:149231224-149231246 AATTTGGCAGCTTTTCCTTTTGG - Intergenic
941887567 2:170544390-170544412 AAGTAGACAGAAATGCCTTTGGG + Intronic
941904467 2:170707524-170707546 AATTAGCCAGATGTGCTGGTGGG - Intergenic
942046948 2:172105043-172105065 AATTAGCCAGGTTTGCTGGTGGG + Intergenic
943046914 2:182870618-182870640 AATTGGCCAAATTTGAATTTTGG - Intergenic
943413697 2:187571738-187571760 AAATAACTAGATTTGGCTTTGGG - Intergenic
943678258 2:190739004-190739026 ATTGAGCCAGACTTGCATTTAGG - Intergenic
944068057 2:195640040-195640062 AATTTCTCAGATTTGCCTTTTGG + Intronic
944894202 2:204147389-204147411 AATTAGCCAGGTGTGACTGTGGG - Intergenic
946097755 2:217290387-217290409 CATTAGCCAGATTTACCTTTGGG + Intronic
946734189 2:222738211-222738233 CATTAGTCTGATTTGCCGTTAGG - Intergenic
946966739 2:225043788-225043810 AATTAGCCAGAGATGCTGTTTGG + Intergenic
948108210 2:235432447-235432469 AATTAGCCAGATGTGGCGGTGGG + Intergenic
1170290408 20:14762779-14762801 AATTAGCCAGATGTGGCTGTGGG + Intronic
1170360439 20:15540338-15540360 ACATGGCCAGATTTGCCATTTGG + Intronic
1170745414 20:19094429-19094451 CATTAGCTGGGTTTGCCTTTAGG - Intergenic
1172129902 20:32648587-32648609 AATTAGCCAGATTTGGCAGCAGG - Intergenic
1173801275 20:45896044-45896066 AATTAGCCAGGTGTGCTGTTGGG + Intronic
1178855524 21:36247026-36247048 AATTAGCCAGATGTGGCGGTAGG - Intronic
1183082589 22:35466044-35466066 AATTAGCCAGGCATGACTTTGGG - Intergenic
1184019725 22:41812935-41812957 AAGCAGCAAGATGTGCCTTTGGG + Intronic
1185288267 22:50011865-50011887 AGTTAGCAAGATGTGCCTTTAGG - Intronic
949199692 3:1360704-1360726 AATTAGCTTGATTTGAGTTTGGG - Intronic
952664570 3:35888671-35888693 AAATAGCCATATTTGCCTAGTGG + Intergenic
953271213 3:41447135-41447157 AATTAGCTAGACTTTGCTTTTGG + Intronic
953512896 3:43560983-43561005 AATTCTCCAAATTTGCCCTTTGG + Intronic
958048205 3:88311945-88311967 AATTAGGCAGACTTGGCTTGGGG + Intergenic
959573193 3:107907543-107907565 AATTAGCCAAAATTGCCTTGAGG - Intergenic
961068751 3:123900315-123900337 AATTAGCCAGTTTTTCCAGTGGG - Intronic
963313667 3:143735216-143735238 CATTAGCAAGATTTTCATTTAGG - Intronic
963365889 3:144333627-144333649 AATTAGACACATTATCCTTTAGG + Intergenic
964321169 3:155498632-155498654 AATTTGGCATATTTCCCTTTAGG - Intronic
964453285 3:156833639-156833661 AATAAGCCAGATGTCTCTTTTGG + Intronic
964680009 3:159328095-159328117 CATTAGCCACATGTGCCTATTGG + Intronic
964803654 3:160582587-160582609 TATTTGACAGATTTGTCTTTTGG - Intergenic
965030372 3:163357797-163357819 AATTAGCCAGATGTGGTTGTGGG + Intergenic
965214237 3:165840483-165840505 AATTAGCCAGATTTGGTGGTGGG - Intergenic
965780592 3:172281797-172281819 AATTCTGCTGATTTGCCTTTAGG - Intronic
965848798 3:172996275-172996297 AACTGGCCATATTTGCCATTTGG - Intronic
966088554 3:176101846-176101868 AAATAGCCAGAGTAACCTTTTGG - Intergenic
966690468 3:182736587-182736609 AATTAGCCAGATATGGCGGTGGG + Intergenic
966917470 3:184593045-184593067 AATTGGCCAGATTTGGCCTGGGG + Intronic
972265630 4:37456057-37456079 CATTAGGCAGATTTTCTTTTTGG + Intronic
972688666 4:41375038-41375060 AAGTACCCAGATTTTCCTCTAGG - Intronic
972999450 4:44927845-44927867 AAGCAGCAAGATTTTCCTTTAGG - Intergenic
973797334 4:54441261-54441283 AATTAGCCAGATTTCCCCATTGG + Intergenic
975318090 4:72978382-72978404 AATTATCCTGATTTTCCTCTGGG + Intergenic
976021681 4:80636792-80636814 AATTAGTCAACTTTGCCATTTGG - Intronic
976519891 4:86014609-86014631 CTTTAGCCAGATTTCCCTTATGG - Intergenic
976633820 4:87267147-87267169 AGTTAGCCAGAATTCCCTTCAGG - Intergenic
977463256 4:97352602-97352624 ATTTAGCCATATTTACATTTAGG - Intronic
978065033 4:104387024-104387046 AATTATCAATATTTTCCTTTAGG + Intergenic
979885169 4:126018170-126018192 AATAAGCCTTATTTGCCTATTGG + Intergenic
980260869 4:130445479-130445501 CATTAGCAATACTTGCCTTTAGG + Intergenic
980342573 4:131569296-131569318 AATAAGCCAGTTTTACCTCTAGG - Intergenic
981243362 4:142505656-142505678 AATTAGCCAGATTTGGGTCCTGG + Intronic
981478965 4:145216709-145216731 AATTAGCTACAGTTGCCTTTAGG + Intergenic
984471397 4:180179659-180179681 CACTAGCCAGATCTACCTTTGGG - Intergenic
987485370 5:18519473-18519495 TAATAGCCATATTTCCCTTTGGG + Intergenic
987813706 5:22872973-22872995 AATTATTCAGATATGCATTTAGG + Intergenic
987952358 5:24691625-24691647 CATCAGCCAGATTTGCCCTGTGG - Intergenic
989708816 5:44371600-44371622 AAGTAGCCTGTTTTTCCTTTGGG - Intronic
990036601 5:51329175-51329197 AGTTAGCTAGCTTTGCTTTTTGG + Intergenic
991594614 5:68289531-68289553 AATGAGCCACATTTACCTTGGGG + Intronic
993527592 5:88985361-88985383 AATTTCCAAGATTTGGCTTTCGG - Intergenic
993828343 5:92721865-92721887 AGTAAGTCAGATTTACCTTTTGG - Intergenic
995314241 5:110749661-110749683 AATTAGGGAAATTTGCTTTTGGG + Intronic
995339980 5:111047632-111047654 AATAAGCCTGATTTAACTTTTGG + Intergenic
995514324 5:112939118-112939140 AATTAGCCAGATGTGGTTGTGGG - Intergenic
996139243 5:119885611-119885633 AATAAGGCAGAGTTGCCTTTAGG + Intergenic
998055377 5:139071813-139071835 AATTAGCCAGATTTGATGGTGGG - Intronic
1000938046 5:167326972-167326994 AATTTGCCGGGTTTTCCTTTAGG - Intronic
1004087395 6:12464103-12464125 AATGAGCCAGTTGTTCCTTTTGG - Intergenic
1005914524 6:30341057-30341079 AATTAGCCAGATGTGGTGTTGGG + Intronic
1007445175 6:41899822-41899844 AATTAGCCAGATATGGCAGTGGG + Intergenic
1008053457 6:46923073-46923095 AATTAGCCAGATGTGCTGGTAGG - Intronic
1009968848 6:70605064-70605086 AATTAGCCAGATGTGGCAGTGGG + Intergenic
1010622526 6:78093809-78093831 AATTATCCAGATTTGAAGTTTGG + Intergenic
1016339809 6:143050232-143050254 AATTTGCCAGATGTCCCTTTAGG - Intergenic
1017524194 6:155228593-155228615 CATTAGACAGATTAGCCTTAAGG + Intronic
1018581927 6:165315305-165315327 AATTAGCCAGGTATGCCGGTGGG - Intergenic
1019087363 6:169491204-169491226 AAATAGCCATATTTTCTTTTTGG - Intronic
1019295406 7:271383-271405 AACTGGACAGATTTGCCTATGGG + Intergenic
1021015596 7:15527369-15527391 AACTAGCCACAATTTCCTTTGGG + Intronic
1021105657 7:16636703-16636725 CATTGGCCACATTTTCCTTTTGG + Intronic
1024480239 7:49855187-49855209 AAAAAGAAAGATTTGCCTTTTGG - Intronic
1025301811 7:57824201-57824223 AATTAGCCAGATGTGGTGTTGGG + Intergenic
1028053656 7:86217146-86217168 CATGAGCAAAATTTGCCTTTAGG + Intergenic
1028478767 7:91281300-91281322 AATTAGCAAAATTTGCTATTTGG - Intergenic
1031832849 7:126648608-126648630 AATTAGCCAGATTTGCCTTTTGG - Intronic
1033878836 7:145856753-145856775 AATGAGCCACATTTTCCCTTTGG + Intergenic
1034034693 7:147806747-147806769 AATATGCAATATTTGCCTTTTGG - Intronic
1039370379 8:36978308-36978330 AATTGGCCAGGTTAGCCTCTGGG - Intergenic
1041224822 8:55687742-55687764 AATTAGCCAGGTGTGGTTTTGGG - Intergenic
1041907977 8:63054429-63054451 AAATAGTCAGAGTTGTCTTTTGG + Intronic
1042067792 8:64897993-64898015 AATTTGCCACATATGACTTTTGG + Intergenic
1043310710 8:78856277-78856299 AATTATCTGGATTTGCCTATGGG - Intergenic
1045753675 8:105516072-105516094 AATTAGCCAGATTTGGTTGTGGG - Intronic
1046949512 8:120006373-120006395 AATTAGCCAGATATGGTGTTGGG + Intronic
1047124455 8:121944939-121944961 AATTAGCCTGGGTTGCCCTTGGG - Intergenic
1047868524 8:129056491-129056513 AAATATCCACATTTGGCTTTTGG - Intergenic
1048470002 8:134697064-134697086 AATTAGCCAGATGTGGCGGTGGG - Intronic
1048634093 8:136276904-136276926 AACTAGCCAGTTTTGAGTTTTGG - Intergenic
1048823007 8:138396908-138396930 AATGAGCCACATTTGTCTTATGG - Intronic
1050664842 9:7924014-7924036 AATGAGGTAGATTTTCCTTTGGG + Intergenic
1050989184 9:12125638-12125660 AATTAGTCAAATTTTTCTTTGGG - Intergenic
1052298225 9:26923126-26923148 AATTCACCATATTTGGCTTTTGG - Intronic
1052623952 9:30950673-30950695 AAGTAGCCAAATTTGCCCTGAGG - Intergenic
1054815723 9:69473262-69473284 AATTAGACAGATTTGGCTGTTGG - Intronic
1057535014 9:95892972-95892994 AAACAGTCTGATTTGCCTTTTGG + Intronic
1061341931 9:129989420-129989442 ATTTAGCCAGCTTTGCTTTATGG - Intronic
1186594173 X:10962768-10962790 AAACAGCTAGATTTGCCTTCAGG + Intergenic
1188808450 X:34621289-34621311 GAATAAGCAGATTTGCCTTTAGG + Intergenic
1197815845 X:130497628-130497650 AACTAGCCAGAATTGTCTTCTGG + Intergenic
1199571798 X:149273900-149273922 ATTTACCCTGAGTTGCCTTTAGG + Intergenic
1200425645 Y:3017735-3017757 AATTAGCCAGGTTTGCTGGTGGG - Intergenic