ID: 1031832853

View in Genome Browser
Species Human (GRCh38)
Location 7:126648647-126648669
Sequence GCATTTATGCTTTTGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031832849_1031832853 16 Left 1031832849 7:126648608-126648630 CCAAAAGGCAAATCTGGCTAATT 0: 1
1: 0
2: 1
3: 15
4: 219
Right 1031832853 7:126648647-126648669 GCATTTATGCTTTTGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031832853 Original CRISPR GCATTTATGCTTTTGGATCA GGG Intronic
No off target data available for this crispr