ID: 1031832996

View in Genome Browser
Species Human (GRCh38)
Location 7:126650025-126650047
Sequence GATAGCTCTTGTCCCGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031832994_1031832996 5 Left 1031832994 7:126649997-126650019 CCTGCAGATAACTACTCTCCTTT 0: 2
1: 5
2: 11
3: 20
4: 248
Right 1031832996 7:126650025-126650047 GATAGCTCTTGTCCCGTTACTGG No data
1031832993_1031832996 11 Left 1031832993 7:126649991-126650013 CCATCTCCTGCAGATAACTACTC 0: 2
1: 183
2: 194
3: 110
4: 259
Right 1031832996 7:126650025-126650047 GATAGCTCTTGTCCCGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031832996 Original CRISPR GATAGCTCTTGTCCCGTTAC TGG Intronic
No off target data available for this crispr