ID: 1031836323

View in Genome Browser
Species Human (GRCh38)
Location 7:126685332-126685354
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031836314_1031836323 7 Left 1031836314 7:126685302-126685324 CCAGAGAGGGGACTCGAGGCGGA 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1031836323 7:126685332-126685354 CTGGGGTGGTACCATGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr