ID: 1031836361

View in Genome Browser
Species Human (GRCh38)
Location 7:126685484-126685506
Sequence AGGGGTCAGAGGGGCCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 489}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031836361_1031836367 -10 Left 1031836361 7:126685484-126685506 CCAGGAAGGCCCCTCTGACCCCT 0: 1
1: 0
2: 7
3: 48
4: 489
Right 1031836367 7:126685497-126685519 TCTGACCCCTGCAGGCTTGGAGG No data
1031836361_1031836371 10 Left 1031836361 7:126685484-126685506 CCAGGAAGGCCCCTCTGACCCCT 0: 1
1: 0
2: 7
3: 48
4: 489
Right 1031836371 7:126685517-126685539 AGGTGCCTGCTTCCACTGCCTGG 0: 2
1: 14
2: 120
3: 245
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031836361 Original CRISPR AGGGGTCAGAGGGGCCTTCC TGG (reversed) Intronic
900103626 1:973143-973165 AGGGGCCAAAGGGCTCTTCCTGG + Intronic
900149435 1:1171677-1171699 AGAGGGCAGAGGGGCCTCCTGGG + Intergenic
900185399 1:1330986-1331008 AGGGGGCAAAGGGGCCTCCAGGG - Intergenic
900370215 1:2328910-2328932 CGGGTGCAGAGGGGCCTCCCTGG - Intronic
900507423 1:3036638-3036660 AGGGCTCAGAGGAGCCTCCGAGG - Intergenic
901034971 1:6331037-6331059 AGGGGTCAGATGGGGGCTCCTGG - Intronic
901050154 1:6421923-6421945 AGGGGTGAGAGAAGCCCTCCTGG + Intronic
901297153 1:8169501-8169523 ATGGGTCAGAAGGGGCTCCCTGG + Intergenic
901689592 1:10964082-10964104 AGGTGGCAGAGGGACCTCCCAGG - Intronic
901857249 1:12052467-12052489 AGTGGTCAGTGAGGGCTTCCTGG - Intergenic
901921711 1:12541633-12541655 AGGGGAGGAAGGGGCCTTCCCGG + Intergenic
902373501 1:16019270-16019292 AGCAGTCAGAGAGGCCTCCCTGG - Intronic
903665686 1:25006192-25006214 AGCAGTCACAGGGACCTTCCTGG - Intergenic
903834164 1:26191904-26191926 AGGGGTCAGAGCTGGCTTCCTGG + Intronic
904316748 1:29670783-29670805 GGGGGTTAGAGGGGCCTTCTAGG - Intergenic
904625575 1:31800081-31800103 AGGGGTCAGAGAGGCCACCAGGG + Exonic
904858415 1:33517244-33517266 AGTGGTCAGAGGGGCCCTGCTGG + Intronic
905704089 1:40041000-40041022 ATCGGGCAGAGGGGCCTCCCCGG - Intronic
906728209 1:48059321-48059343 AGAGGACAGAGGGGCCCACCTGG - Intergenic
906772826 1:48500538-48500560 TGGTGTCAGAGGGGCCTGTCAGG + Intergenic
907034266 1:51202236-51202258 AACTTTCAGAGGGGCCTTCCTGG + Intergenic
907560521 1:55383400-55383422 AGGGGTCTGGGGAGGCTTCCTGG - Intergenic
911373731 1:97025021-97025043 CGGGTTCAGAGGTGCCATCCAGG - Intergenic
912569100 1:110608424-110608446 AGGGCCCAGTGGGGACTTCCTGG - Intronic
912831236 1:112955951-112955973 TGGGGTCGGAGGGGACCTCCGGG - Exonic
913050023 1:115109479-115109501 AAGGGGCAGAGGAGCCCTCCAGG + Intergenic
914045286 1:144086250-144086272 AGGGTTCAGAGGAACCTCCCTGG - Intergenic
914132824 1:144874436-144874458 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
915554402 1:156653319-156653341 AGGGGTGAGAAGGGACTCCCAGG - Intronic
915670331 1:157483481-157483503 AGAGGGCAAAGGGGCTTTCCTGG + Intergenic
916514601 1:165504100-165504122 AGGTATCAGAAGGGGCTTCCTGG - Intergenic
919710848 1:200726564-200726586 AGGGGTCAGAAAAGACTTCCCGG - Intergenic
919833245 1:201556606-201556628 AGGGAACTGGGGGGCCTTCCAGG + Intergenic
919839413 1:201598169-201598191 GAAGGTCAGAGAGGCCTTCCTGG + Intergenic
920255922 1:204654269-204654291 AGGGGTACGAGGAGCCTTCTGGG + Intronic
920647939 1:207816920-207816942 AGGGCACACAGGGTCCTTCCAGG + Intergenic
920689121 1:208132274-208132296 AGGGTTCAGAGGCGGCTTTCTGG - Intronic
1064416446 10:15154208-15154230 AGGGATGAGTGGGGCCCTCCAGG + Intronic
1064920803 10:20515767-20515789 AGGTGTCAGAGCTGCCTACCTGG - Intergenic
1065814877 10:29474216-29474238 AGGGATCTGAGGGGCCCTCTTGG + Intronic
1065976466 10:30846791-30846813 TGGGGGGAAAGGGGCCTTCCTGG - Intronic
1066291996 10:34022739-34022761 AGGGGACAGAGAGGTCTTCCTGG + Intergenic
1067288605 10:44925229-44925251 AGCGGTCAGAGGGGCATTTGAGG - Intronic
1068154170 10:53175049-53175071 AGTGGTGAGAGGGGTCATCCTGG - Intergenic
1069249181 10:66246232-66246254 AGAGGGCAGGGGGGCCTTCCTGG + Intronic
1069919683 10:71808874-71808896 AGGGGTCAAAATGGCATTCCAGG - Intronic
1069926713 10:71855632-71855654 AGGGGTCAAGGGAGGCTTCCAGG - Intergenic
1069932387 10:71891505-71891527 GGGGGTCAGAGAGAGCTTCCTGG + Intergenic
1070251124 10:74773878-74773900 AGGTGAGAGAGGGGGCTTCCAGG + Intergenic
1070531823 10:77343501-77343523 AGGGGGATGAGGTGCCTTCCTGG + Intronic
1070661619 10:78310550-78310572 AGGAGTCAGAGGGGACTGTCTGG + Intergenic
1070670282 10:78372822-78372844 AGAGATCAGAGAGGGCTTCCTGG + Intergenic
1070778931 10:79126429-79126451 AGGGGTCAGGGAGAGCTTCCTGG + Intronic
1071874428 10:89829407-89829429 AGGGGAAAGAAGGACCTTCCGGG + Intergenic
1071879322 10:89877842-89877864 AGGGGTTAAAGGGACTTTCCGGG + Intergenic
1073124584 10:101141467-101141489 CGGGGTGGGAGGGGCCTCCCTGG - Intergenic
1074198375 10:111208848-111208870 AGGGGTCAGAGGGCCCTCTTTGG - Intergenic
1075293668 10:121253311-121253333 AGGGATCTGAGAGGGCTTCCTGG - Intergenic
1075666623 10:124235448-124235470 TGGGGTTAGGGTGGCCTTCCTGG - Intergenic
1075713654 10:124543642-124543664 AGGGGTCCGTGGGGCCTGTCTGG + Intronic
1076049150 10:127318869-127318891 AGGGGCCAGAGGGGCCTGAAAGG + Intronic
1076061768 10:127418763-127418785 GTGGGTCAGTGGGGGCTTCCTGG - Intronic
1076430938 10:130401873-130401895 ATGGGTCAGCAGGGGCTTCCTGG + Intergenic
1077003222 11:335804-335826 AAGGGACAGAGTGACCTTCCAGG - Intergenic
1077126500 11:941065-941087 TGGGGGCCGAGGGGCCTGCCTGG + Intronic
1077145016 11:1040843-1040865 TGGGGTCAGAGGGGTCTGCAGGG - Intergenic
1077394050 11:2312539-2312561 AGGAGTCAGATGGACTTTCCAGG - Intronic
1077476895 11:2794744-2794766 GGGGGCCAGAGGGGTCCTCCAGG - Intronic
1078360431 11:10663561-10663583 AGAGGTCAGGGAAGCCTTCCTGG - Intronic
1079140938 11:17809114-17809136 AGGGATCAGAAGAGACTTCCTGG + Intronic
1079189430 11:18265442-18265464 AGGGGTGGAAGGAGCCTTCCAGG + Intergenic
1079366469 11:19814362-19814384 AGAGGGCAGTGGGCCCTTCCCGG - Intronic
1079509915 11:21198834-21198856 AAGGGTCAGAAGGGACTTTCTGG - Intronic
1079626994 11:22627847-22627869 AGTGTTCAGAGGAGCCTTCAAGG + Intronic
1080749441 11:35139004-35139026 CGGGGGCAGAGGGGCCCGCCCGG + Intronic
1081164047 11:39786356-39786378 AGGGGAAAGGGGGGCCTTCCTGG + Intergenic
1082063390 11:47879482-47879504 AGGGATCAGAGGGGGCGTCTTGG + Intergenic
1082750157 11:57006271-57006293 TGGGGTCAGTGGGGCCTTCCTGG + Intergenic
1082952348 11:58830920-58830942 GGGAGGCAGAGGGGTCTTCCTGG - Intergenic
1083610770 11:64003144-64003166 AGGAGGCAGAGGGGCCTTAGGGG - Intronic
1083695787 11:64441354-64441376 AGGGGCATGAGGGGCCTCCCCGG - Intergenic
1083770612 11:64864869-64864891 AGGGGGGAGTGGGGCCTTGCTGG - Intronic
1083945813 11:65921980-65922002 AGGGGAGAGAGGGGTCATCCGGG + Intergenic
1084719513 11:70895342-70895364 AGGGGTCAGGGGGGTGCTCCTGG - Intronic
1084930873 11:72554647-72554669 AGGGGCCAGAAGGGACTCCCAGG - Intergenic
1084944978 11:72633484-72633506 AGGGGTCCTAAGGGGCTTCCTGG + Intronic
1085533194 11:77203562-77203584 AGGGGGCAGAGAGGACTTCCTGG + Intronic
1085721402 11:78915248-78915270 AGTGGTCAGAGAAGGCTTCCTGG - Intronic
1087904609 11:103681137-103681159 AAGGATCAGAGGAGGCTTCCAGG + Intergenic
1088989616 11:114940856-114940878 CGGGGTCACGGGGGCCTTCAGGG + Intergenic
1089566326 11:119373540-119373562 AGTTGTCAGAGGGCCCTGCCAGG + Intronic
1089770080 11:120796542-120796564 GGGGGTCAGAGAGGGCTTCCTGG + Intronic
1092118388 12:6025840-6025862 TGGGGACAGAGGGACATTCCAGG + Intronic
1095981955 12:47979063-47979085 AGGGGTCAGAGGGGCAGGGCTGG - Intronic
1096138220 12:49220537-49220559 AGGTGTCAGAGAAACCTTCCTGG + Intronic
1097299094 12:57998551-57998573 TGAGGGCAGGGGGGCCTTCCTGG + Intergenic
1098963667 12:76764099-76764121 AGGGGACAGAGGGGGCGTCACGG + Exonic
1101439617 12:104693689-104693711 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1102253806 12:111405176-111405198 AGCGGTCGGAGAGGGCTTCCTGG + Intergenic
1102572484 12:113835539-113835561 CGGGGTCAGTGGGGGCTGCCGGG + Intronic
1102725543 12:115061147-115061169 GCAGGTCAGAGGGGCCTTCTCGG + Intergenic
1103061220 12:117860264-117860286 AGGGGACACAGGGGCCCCCCAGG + Intronic
1103272161 12:119682226-119682248 TGGGGCCACAGGGGACTTCCAGG + Intergenic
1103952299 12:124557881-124557903 AGGAGTCAGGGGGCCTTTCCTGG - Intronic
1104450013 12:128861346-128861368 ACGGGTCAGAAGGCCTTTCCTGG - Intronic
1105041771 12:132966766-132966788 CGAGGTCAGGGGGGTCTTCCTGG - Intergenic
1105616742 13:22025623-22025645 AGGGGAACAAGGGGCCTTCCTGG + Intergenic
1105895579 13:24714907-24714929 AGAGGTCAGAGGGGCCTAGCAGG + Intergenic
1105961529 13:25345682-25345704 AGGGGTCATACAAGCCTTCCAGG - Intronic
1107140930 13:36998388-36998410 AGATGGCAGAGTGGCCTTCCTGG + Intronic
1108228756 13:48317301-48317323 AGGGGTCCGAGGGCCCCGCCTGG - Intronic
1108238721 13:48438078-48438100 AGGGTTCAGATGGGACTTTCAGG - Intronic
1108826172 13:54415399-54415421 GGGGGTCAGAGGGGGGTTTCGGG - Intergenic
1109944979 13:69421022-69421044 AGGGGCAGGAGGGGCCTTCCTGG + Intergenic
1110827338 13:79987999-79988021 AGGTGAAAGATGGGCCTTCCAGG - Intergenic
1111237714 13:85431033-85431055 TGTGGGGAGAGGGGCCTTCCTGG - Intergenic
1111243647 13:85507915-85507937 CAGGGGCAGAGGGGCTTTCCGGG - Intergenic
1112753177 13:102602503-102602525 AGGGGTCATAAAGGCCTCCCAGG - Intronic
1113804366 13:113104728-113104750 AGGGGTCAGACAGGCCTGCTGGG + Intergenic
1113900934 13:113797518-113797540 AGGGGACAGAGGCTCCTTCCTGG - Intronic
1113916002 13:113874598-113874620 AGGTGTGTGAGGGGCCCTCCAGG + Intergenic
1113916013 13:113874638-113874660 AGGTGTGTGAGGGGCCCTCCAGG + Intergenic
1117438922 14:55742510-55742532 AGGGCTCAGAGGGATTTTCCAGG + Intergenic
1117587537 14:57225867-57225889 AGGGGTGAGAAGGTGCTTCCAGG + Intronic
1117982858 14:61358929-61358951 AAGGGTCAGAGAAGGCTTCCTGG - Intronic
1118154545 14:63226013-63226035 AGGGGTCAAAGGGGTATTCCAGG - Intronic
1118904570 14:70014323-70014345 AGGAGTCAGAGCAGGCTTCCTGG + Intronic
1119552100 14:75522530-75522552 AGGGGTCAGAGGTGGCTACAGGG + Exonic
1119904097 14:78285924-78285946 AGGAGCCAGGGGGGTCTTCCTGG - Intronic
1121927136 14:97937981-97938003 AGGGGTCAAGGGTGGCTTCCAGG + Intronic
1122039093 14:98969784-98969806 AGGAGTCAGAGTGGACATCCTGG - Intergenic
1122227954 14:100290682-100290704 GGAGGTCAGAGAGGGCTTCCTGG - Intergenic
1122418553 14:101561540-101561562 AGGGGTCCCAGGGGGCTTCGGGG + Exonic
1122717711 14:103705567-103705589 AGGGGTCAGATGTGCTTTCCTGG - Intronic
1122823643 14:104359348-104359370 AGGGGACAGAGTGGGTTTCCAGG - Intergenic
1122827517 14:104377415-104377437 AGGGGACACAGGGGCCTGCGGGG - Intergenic
1122942683 14:104989420-104989442 AGTGGGCACAGGGGCCTTCTGGG + Intronic
1202935704 14_KI270725v1_random:85837-85859 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
1123888254 15:24748987-24749009 AGGGGTAAGGGGAGCCTGCCTGG - Intergenic
1124343279 15:28903649-28903671 GAGAGTCAGAGGGGCCTTCCTGG + Intronic
1124356978 15:29002940-29002962 AGGGGGAAGACGGGCGTTCCAGG + Intronic
1124886852 15:33695258-33695280 AGGGGTAAGCAGTGCCTTCCCGG + Intronic
1125521135 15:40348393-40348415 GGGAGGCAGGGGGGCCTTCCTGG + Intergenic
1126773238 15:52078167-52078189 AGAGGTCAGGGAGGGCTTCCTGG - Intergenic
1127325013 15:57886392-57886414 AGGGCTCAGTGGGACCTTTCAGG - Intergenic
1127541678 15:59945161-59945183 AGGTCTCAGAGGGCCTTTCCAGG - Intergenic
1127796770 15:62445096-62445118 AGGGGTCAGGGAGGCCTTACTGG + Intronic
1128231038 15:66035482-66035504 AGGGGGAAGAAGGGCCTCCCAGG - Intronic
1128875549 15:71198404-71198426 AGGGGACAGAGCTGCCTGCCAGG - Intronic
1129177174 15:73848401-73848423 GGGAGTCAGGGAGGCCTTCCTGG - Intergenic
1129610031 15:77045660-77045682 AGAGGTCAGGGGTGACTTCCTGG - Exonic
1130779623 15:87021853-87021875 AGGGGTCTGTGGGTCCTTTCAGG - Intronic
1130919053 15:88328883-88328905 GGTGGTCAGAGTGGCCTTGCTGG + Intergenic
1131067669 15:89444463-89444485 AGGGGTCAGAGGGGAGGGCCTGG + Intergenic
1131116693 15:89800288-89800310 AGAGGTCAGGGAGGGCTTCCCGG - Intronic
1131316031 15:91338504-91338526 AGAGGTCAGAGAAGGCTTCCTGG + Intergenic
1132118985 15:99160074-99160096 GGGAGAGAGAGGGGCCTTCCAGG - Intronic
1132877575 16:2147195-2147217 AGGGTTCTGAGAGGGCTTCCGGG + Intronic
1132951548 16:2565107-2565129 AGGGGCCAGAGGGGCAGTCGGGG + Intronic
1132962802 16:2635063-2635085 AGGGGCCAGAGGGGCAGTCGGGG - Intergenic
1133264477 16:4575142-4575164 AGGGGGCAGAGGGGCTCTGCTGG - Intronic
1133304046 16:4799000-4799022 AAGGGCCAGAGAGGGCTTCCTGG + Intronic
1133323709 16:4930756-4930778 AGGGGTGGGAGGGGCATTCTGGG + Intronic
1133813801 16:9181216-9181238 AGAGGTCAGAGAGGGCTTCCTGG + Intergenic
1135184294 16:20301571-20301593 AGGGGCAAGAGGGGGCTTCTGGG + Intergenic
1135829255 16:25759061-25759083 GGGAAACAGAGGGGCCTTCCAGG + Intronic
1136026110 16:27470018-27470040 AGGGGTCAGCAGTGCCTTCTGGG - Intronic
1136071940 16:27792592-27792614 GGATGTCAGAGGGGGCTTCCTGG - Intronic
1136360462 16:29776091-29776113 AGAGGTCAGAGGGCCAGTCCAGG + Intergenic
1136517758 16:30778095-30778117 GGTGGTCAGAGAGGCCTCCCTGG + Intergenic
1136669008 16:31839388-31839410 TGGGGTCATGGGGGCCTTCTTGG - Intergenic
1136998359 16:35207270-35207292 AGGGGTCCAAGGGGCGCTCCTGG + Intergenic
1137724988 16:50651003-50651025 GGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1138103256 16:54271459-54271481 AGGGGTCATTGGGGCCATCTTGG - Intergenic
1138516785 16:57540546-57540568 AGGAGGCAGAGAAGCCTTCCTGG + Intergenic
1138516791 16:57540575-57540597 AGGAGGCAGAGAAGCCTTCCTGG + Intergenic
1139177020 16:64700964-64700986 AGGAGCCAGAGGGGCCGTTCAGG - Intergenic
1140017033 16:71197650-71197672 ACGGGTGAGAGGGGTCTTCTGGG - Intronic
1140774206 16:78235364-78235386 AGGGGTCAGATGAGCCGGCCTGG - Intronic
1141229239 16:82149232-82149254 TGGGGTAAGAGGAGCATTCCTGG + Intronic
1141656309 16:85418491-85418513 AGCAGTCAGAGAGGGCTTCCTGG - Intergenic
1141666174 16:85466448-85466470 TGGCCTCAGAGGGGCCCTCCTGG + Intergenic
1141877951 16:86839045-86839067 AGGGGTGAGAGGAATCTTCCAGG + Intergenic
1142142850 16:88480222-88480244 AAGAGTCAGAGGTGCCATCCAGG - Intronic
1142230627 16:88898587-88898609 TGGGGTCACAGGGGCCTTCTGGG - Intronic
1142508552 17:380824-380846 AGGGATGAGGGGGGGCTTCCGGG - Intronic
1142869203 17:2809498-2809520 AGGGGTGAGGGGGGCCTCCGGGG - Intronic
1143105172 17:4526172-4526194 TGGGGTCAGGGAGGGCTTCCTGG + Intronic
1143713822 17:8753236-8753258 AGGGCAGAGAGGGGGCTTCCTGG - Intronic
1143780208 17:9225373-9225395 AGGGCTCAGAGGAGCCCTGCGGG + Intronic
1144519168 17:15942943-15942965 AAGGGTTAGAGGAGGCTTCCTGG - Intergenic
1144668899 17:17120384-17120406 AGAGGCCAGAGTGACCTTCCTGG - Intronic
1145251000 17:21297051-21297073 AGGGGTCCCAGGGTCCATCCTGG - Intronic
1147218953 17:38917061-38917083 ACAGGTCACAGAGGCCTTCCTGG - Intronic
1147401114 17:40180544-40180566 AGCGGTCAGAGGGGGCTGCTTGG - Intronic
1147446304 17:40477242-40477264 TGGGGTCAGAGGGTCCTTGGAGG + Exonic
1147591883 17:41689099-41689121 GTGGGGCAGCGGGGCCTTCCGGG + Intronic
1147726223 17:42567503-42567525 GGGTGACAGAGGCGCCTTCCCGG + Intronic
1148386390 17:47237878-47237900 AGGGGGTAGAGGGACCTTCCTGG + Intergenic
1148677725 17:49454927-49454949 AGAGGTCAGGGAGGACTTCCTGG - Intronic
1148697137 17:49567457-49567479 AGGGGTCAGAAGTGCTTTCCAGG + Intergenic
1148805626 17:50262460-50262482 AGGGATCTGAGTGGGCTTCCTGG + Intergenic
1149412936 17:56427621-56427643 AGGGGACAGAGGCGCCAACCAGG + Intronic
1149661769 17:58337906-58337928 GGGGGGCAGAGGGGCCTAACTGG + Intergenic
1150227653 17:63532527-63532549 TGGAGTCGGAGGGGGCTTCCTGG + Intronic
1150336420 17:64333847-64333869 CTGAGTCAGAGGGGCCTGCCTGG + Intronic
1150347014 17:64412085-64412107 AGGGGTTACGGGGGCCTTCTGGG - Intronic
1150462078 17:65361599-65361621 AGGGGCCAGTGGGCCCTTCGAGG + Intergenic
1151316453 17:73325415-73325437 AGGTCCCAGAGGGGCCGTCCTGG + Intergenic
1151670467 17:75569217-75569239 AGGGGTCAAAGGAGCCCACCTGG - Exonic
1152148015 17:78580841-78580863 AGGGGCAAGAAGGGCATTCCTGG + Intergenic
1152278873 17:79373509-79373531 ATGGGTCAGAGGGGCCAGACGGG + Intronic
1152609496 17:81308626-81308648 AGGGGTCAGAGCTGCATCCCTGG - Intergenic
1152746493 17:82042465-82042487 AGGGAGCACAGGGGGCTTCCTGG + Intergenic
1152798056 17:82317596-82317618 AGAGCTCAGAGAGGGCTTCCTGG + Exonic
1152916019 17:83036375-83036397 AGGGGCCTGAGGGGGCTTCTGGG + Intronic
1153139471 18:1954894-1954916 AGGGGTGAGTGGGGCCTTCCTGG + Intergenic
1153671246 18:7414577-7414599 AGAGTTCAGTGAGGCCTTCCTGG - Intergenic
1153948652 18:10038649-10038671 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1156490349 18:37492257-37492279 TTGGGGCAGAGGGGCCTTCAGGG - Intronic
1157381851 18:47225795-47225817 AGGGGTGAGAGTGGTCTGCCAGG + Intronic
1157491550 18:48127296-48127318 AGGGCTCAGGGGAGCCTTCAGGG - Intronic
1160697972 19:493733-493755 AGGGGTCTCAGGGTCCTCCCCGG + Intronic
1160791808 19:926726-926748 ACGGGTCAGGGGGCTCTTCCTGG - Intronic
1160953756 19:1680024-1680046 TGGGGTCAGGGAGGGCTTCCTGG + Intergenic
1160955076 19:1687521-1687543 AGGGGTCAGAGAGGGCTTCCTGG + Intergenic
1161042485 19:2117402-2117424 AGGTGGCCGAGTGGCCTTCCGGG - Intronic
1161481155 19:4511316-4511338 AGTGGCCAAAGGGGCCGTCCAGG - Exonic
1161605903 19:5214810-5214832 AGCGGTCAGAGTGAACTTCCAGG - Intronic
1162369850 19:10271908-10271930 AGGGGTCAGAGGGTCTTTCATGG + Intronic
1162478637 19:10915504-10915526 AGGAGCCAGAGGTTCCTTCCAGG + Intronic
1162533357 19:11248571-11248593 AGGGGTCAGGGAGGACTTCCTGG - Intronic
1162733822 19:12734686-12734708 CGGGGCCGGAGCGGCCTTCCCGG - Exonic
1162925445 19:13928571-13928593 AGTGGTCAGGGAGGGCTTCCTGG - Intronic
1163468480 19:17483517-17483539 AGTAGCCAGAGGGGCCTTCTAGG + Intronic
1163500096 19:17671171-17671193 AGAAGTCAGAGAGGGCTTCCTGG + Intronic
1163557204 19:17999581-17999603 AGGGGTCAGAGAGACCCTTCAGG + Exonic
1164157229 19:22604034-22604056 AGTGGCCAGAGGTGGCTTCCAGG + Intergenic
1164479878 19:28603048-28603070 AGGGTTCAGAGGAGCCTGGCTGG - Intergenic
1164683169 19:30149521-30149543 AGGGGTCAGGGAAGGCTTCCTGG + Intergenic
1164850372 19:31478262-31478284 AGGGGACAGAGAAGGCTTCCAGG - Intergenic
1165273734 19:34731830-34731852 AGGGGTCAGCGGGAGCTTCAAGG - Intergenic
1165739125 19:38195299-38195321 AGGGCTTAGAGGAGCCTTCCAGG - Intronic
1166219809 19:41357136-41357158 GGAGGTCAGAGAGGGCTTCCTGG - Intronic
1166293660 19:41878692-41878714 AGAGGTGAGAAGGGCCTCCCAGG + Intronic
1166376067 19:42327705-42327727 AGGGAGCAGAAGGGCATTCCAGG + Intronic
1166663089 19:44660008-44660030 GGGGGTCAGGGAGGGCTTCCTGG - Intronic
1166720088 19:44991527-44991549 TGGGGTCAGAGAGGACTTCAGGG + Intronic
1166784422 19:45359140-45359162 GGGGGTCAGGGAGGGCTTCCTGG + Intronic
1166942907 19:46377623-46377645 AGGGGTCAAAGGGAGCTTTCTGG - Intronic
1167096235 19:47376326-47376348 AGGAGTCAGGGAGGGCTTCCTGG + Intronic
1167429977 19:49448579-49448601 AGGGGTCAGGGAAGGCTTCCTGG - Intronic
1167466502 19:49653259-49653281 AGGGGGCGGAGGAGACTTCCTGG + Exonic
1167622973 19:50568957-50568979 AGGGGACAGAGGGGCCTGGAGGG + Intergenic
1167634498 19:50646650-50646672 ATGAGTCAGAGAGGGCTTCCTGG + Intronic
1168272405 19:55257577-55257599 AGTGGGAAGAAGGGCCTTCCGGG - Intronic
1202684844 1_KI270712v1_random:39654-39676 AGGGTTCAGAGGAACCTCCCTGG - Intergenic
925196746 2:1931927-1931949 AGGGGGGACAGGTGCCTTCCTGG - Intronic
926114568 2:10204284-10204306 TGGGATCAGAGGAGCCTTCTTGG + Intronic
926238530 2:11067942-11067964 AGGGGCCAGAGGGACCTGCAGGG - Intergenic
926370527 2:12174343-12174365 AGGGGCCCGAGGGACCATCCAGG - Intergenic
927142132 2:20137710-20137732 GGGGGTCAGAAGGGACATCCTGG - Intergenic
927613656 2:24566895-24566917 AGGGGCATGGGGGGCCTTCCTGG + Intronic
927843162 2:26457836-26457858 AGGGGTCAGAGGGGCGGGACTGG + Exonic
927879272 2:26679356-26679378 TGGGGTCATGGGGGACTTCCTGG + Intergenic
928398295 2:30959954-30959976 AGGGCTCAGAAGGGTCCTCCTGG - Intronic
929692180 2:44084174-44084196 AGGAGTAAGAGGTGGCTTCCAGG + Intergenic
933069743 2:77842342-77842364 AGTTGTCAGAGGAGCCTGCCAGG - Intergenic
934168496 2:89319447-89319469 AGAGTTCAGAGGAGCCTCCCTGG + Intergenic
934198791 2:89863135-89863157 AGAGTTCAGAGGAGCCTCCCTGG - Intergenic
934246875 2:90315192-90315214 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
934262451 2:91487411-91487433 AGGGTTCAGAGGAACCTCCCTGG - Intergenic
934305500 2:91818400-91818422 AGGGTTCAGAGGAACCTCCCTGG - Intergenic
934327756 2:92034348-92034370 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
934466142 2:94264878-94264900 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
935202805 2:100872816-100872838 AGGGATCAGGGAGGACTTCCTGG - Intronic
935322719 2:101904746-101904768 AGAGGCAGGAGGGGCCTTCCTGG - Intergenic
935638788 2:105271105-105271127 AGGGGTCAGAGGCAGCCTCCCGG - Intronic
936370845 2:111901015-111901037 GGGGGGCAGAGGGGATTTCCTGG - Intronic
937292399 2:120789510-120789532 GGAGGTCAGAGGAGGCTTCCTGG - Intronic
937863324 2:126730260-126730282 AGTGGGCAGAGGTGCATTCCAGG + Intergenic
937907853 2:127061075-127061097 GGGGGTAAGTGGGGCCGTCCTGG - Intronic
939041270 2:137191693-137191715 AGGGGTCAGAGAGAGCTTCTTGG - Intronic
940017692 2:149123988-149124010 AGGAGCCCGGGGGGCCTTCCTGG - Intronic
940396369 2:153196517-153196539 TGGGGGCAAAGGGCCCTTCCTGG + Intergenic
941440486 2:165529060-165529082 TGAGGGCAGGGGGGCCTTCCTGG - Intronic
941998787 2:171626494-171626516 TGGGGTCAGGGGGCACTTCCTGG - Intergenic
943458795 2:188143339-188143361 AGAGGTCAGAAGGGCCTTATAGG - Intergenic
945195984 2:207238089-207238111 TGGGGTCTGAGGGGCCTTCAAGG + Intergenic
946197551 2:218044096-218044118 AAGGGTCAGGGAGGCCTTCTGGG + Intronic
947586700 2:231360970-231360992 GGGCCTCAGAGGAGCCTTCCAGG - Intronic
947614394 2:231545864-231545886 AGGGGCCAGAAGGGTGTTCCTGG - Intergenic
948363765 2:237441217-237441239 AAGGGTCACAGGGCCCTTCCTGG + Intergenic
948485552 2:238278743-238278765 AGAGGGCAGAGGGGCCTGGCAGG + Intronic
948665499 2:239532217-239532239 AGGGGTCAGAAGGGCCTCTGGGG + Intergenic
948759014 2:240179055-240179077 TGGGGTCAGAGGGTCCCTCCAGG + Intergenic
1168807341 20:679777-679799 GGGGGACAGAAGGCCCTTCCTGG - Intergenic
1168820266 20:768375-768397 AAGGGGCAGAGGGGCTCTCCTGG + Exonic
1169075218 20:2755979-2756001 GGGGGCCAGAGGGACCTCCCTGG - Intronic
1170749080 20:19129383-19129405 AGGGGTCACAGGGGCTGGCCTGG + Intergenic
1171992412 20:31706939-31706961 AGGAGTGAGTGGGGCCATCCTGG + Intronic
1172094808 20:32455483-32455505 GGGGGCCAGAGGTGCCTTCCTGG - Intronic
1172184235 20:33021364-33021386 GGGGGCCAGAGGGGCCCTGCTGG - Intronic
1172509266 20:35488839-35488861 AGGGGGGAGAAGGGCTTTCCAGG + Intronic
1172871543 20:38138606-38138628 AGTGGTCAGAGAGGGCTTCCTGG - Intronic
1173164627 20:40678486-40678508 AGTGGTCAGAAAAGCCTTCCTGG - Intergenic
1173207696 20:41007514-41007536 CAGGGGCAGGGGGGCCTTCCTGG + Intergenic
1173539240 20:43838833-43838855 AGTGATCAGAGAGGCCTTCCTGG + Intergenic
1174575426 20:51533673-51533695 AGGACTCAGTGGTGCCTTCCAGG + Intronic
1174773093 20:53319542-53319564 ACTGCTCAGAGGGGGCTTCCTGG - Intronic
1175064273 20:56272208-56272230 AGGGGGCAGGGGGGCCTCCCTGG - Intergenic
1175401090 20:58700315-58700337 GGGGGCCACAGGGGCCATCCTGG + Intronic
1175743547 20:61437156-61437178 AGGGCTCAGAGGTGCCCTGCTGG + Intronic
1175960001 20:62631200-62631222 TGGGGACAGGGGGGCCTTCCCGG + Intergenic
1179151171 21:38809526-38809548 AGGGAAGAGAGGGGGCTTCCTGG + Intronic
1179886354 21:44315853-44315875 ACAGGGCAGAGGGGCCTGCCCGG - Intronic
1179921469 21:44509871-44509893 AGGGATCAGGGTGGGCTTCCTGG - Intronic
1179988854 21:44935395-44935417 AGGGGTCAGAGCATCCTTGCAGG + Intronic
1179990850 21:44947649-44947671 GGGGGTCAGATGTGGCTTCCTGG - Intronic
1180008342 21:45033542-45033564 AGGGATCTGAGGGGCCACCCAGG - Intergenic
1180104382 21:45608360-45608382 AGGGGCAGGAGGGGACTTCCTGG - Intergenic
1180280052 22:10685513-10685535 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
1180569819 22:16704253-16704275 TGGGGACAGAGGGACATTCCAGG + Intergenic
1180587271 22:16904045-16904067 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
1180763104 22:18223700-18223722 AGGGGTCCGAGGGCCCCGCCCGG + Intergenic
1180772541 22:18400847-18400869 AGGGGTCCGAGGGCCCCGCCCGG - Intergenic
1180803921 22:18650463-18650485 AGGGGTCCGAGGGCCCCGCCCGG - Intergenic
1180806842 22:18718986-18719008 AGGGGTCCGAGGGCCCCGCCCGG + Intergenic
1180998833 22:19978518-19978540 TGGGGTCAGCAGGGCCTCCCAGG + Intronic
1181164003 22:20973885-20973907 AGGCGTGAGGGGGACCTTCCAGG + Intronic
1181217797 22:21344796-21344818 AGGGGTCCGAGGGCCCCACCCGG + Intergenic
1181565044 22:23731127-23731149 AGGGGTCAGAGGGAACTCCCTGG - Intergenic
1181582431 22:23835618-23835640 AGGGGACAGCTGGGCCTTACTGG + Intronic
1181865571 22:25851934-25851956 AGGGGTCAGAAGGGTCATTCTGG - Intronic
1181946173 22:26519481-26519503 AGGGGTAAGAGGTGTCTTTCTGG + Intergenic
1181982452 22:26774947-26774969 AGGGTTCAGAGGGGCCTGACTGG + Intergenic
1182287267 22:29255753-29255775 GGGGGTCAGGGAGGTCTTCCTGG + Intronic
1182557447 22:31136888-31136910 AGGGTTCAAAGGGGCCTCACCGG + Exonic
1182777599 22:32842331-32842353 AGAGGCCTGAGGGGCCTGCCTGG - Intronic
1183505905 22:38208748-38208770 AGGGATCAGGGAGGGCTTCCTGG + Intronic
1184059974 22:42075458-42075480 AGGGGTCAGGGAAGGCTTCCCGG + Intronic
1184158891 22:42686449-42686471 AGGGATCAGGGGAGCCTTACAGG - Intergenic
1184410923 22:44325928-44325950 AGGGGTCAGGGAGGGCTTCCTGG - Intergenic
1184418089 22:44363726-44363748 AGGGGCCAGAGCGGGATTCCCGG - Intergenic
1184560991 22:45262875-45262897 TGAGGGCAGGGGGGCCTTCCAGG + Intergenic
1184654473 22:45934236-45934258 TGGGGGCAGAAGGACCTTCCAGG - Intronic
1184695754 22:46138229-46138251 AGTGATCAGGGAGGCCTTCCTGG + Intergenic
1184788050 22:46681228-46681250 AGGAGGCGGAGGGGCCTCCCAGG + Intergenic
1184797167 22:46738908-46738930 TGGGGTCAAGGAGGCCTTCCTGG - Intergenic
1184821764 22:46914924-46914946 AGGGGTCAGGGGAGGCCTCCAGG + Intronic
1184845072 22:47077765-47077787 AGGGGTCAGAGAAGGCTTTCTGG + Intronic
1184872488 22:47249718-47249740 AGAGGGCAGAGAGGGCTTCCTGG + Intergenic
1185011804 22:48318768-48318790 TGGGGCCAGAGAGGCCTTCTTGG - Intergenic
1185126596 22:49014662-49014684 GGGGGCCAGACGGGCCTTCCTGG - Intergenic
1185250506 22:49799321-49799343 AGGGGACAGAGGGGACCGCCAGG + Intronic
1185364670 22:50431985-50432007 AGGGGTCAGGGGGCAATTCCAGG + Intronic
1185372208 22:50466167-50466189 TGGGGTCAACGCGGCCTTCCAGG - Exonic
1203234379 22_KI270731v1_random:141835-141857 AGGGGTCCGAGGGCCCCGCCCGG - Intergenic
949495711 3:4629796-4629818 AGTGGTCAGGGAGGGCTTCCTGG + Intronic
950459118 3:13110710-13110732 TGGGGACACAGGGGCTTTCCAGG + Intergenic
950545527 3:13635952-13635974 AGTGGTCAGGGAGGCCATCCTGG + Intronic
950939195 3:16876395-16876417 AGGGGTCAGAAGGTCATTCCAGG - Intronic
951520423 3:23606130-23606152 TGGGGTCAGGGAAGCCTTCCTGG + Intergenic
952162774 3:30710906-30710928 AAAGTTGAGAGGGGCCTTCCTGG + Intergenic
952956313 3:38560043-38560065 AGGGGGCAGTGGGGCCATGCTGG - Intronic
953044222 3:39280982-39281004 AGGGGCCAGAGGGGCCTTGAAGG - Intronic
953289741 3:41649448-41649470 AGGGGGTACAGGGGCTTTCCAGG - Intronic
954099433 3:48357989-48358011 TGAGGGCAGGGGGGCCTTCCTGG + Intergenic
954150261 3:48653842-48653864 ATGGGGCAGAGGGGCCTGCAGGG - Intronic
955789827 3:62577117-62577139 TGAGGCCAGAGGGGTCTTCCAGG - Intronic
956922987 3:73950724-73950746 AGCGGTCAGAGAGGGCTTCTGGG + Intergenic
957040864 3:75334406-75334428 TGGAGGCAGAGTGGCCTTCCTGG + Intergenic
959037379 3:101383516-101383538 CGGGGGCATGGGGGCCTTCCTGG - Intronic
959904359 3:111694122-111694144 AGGGATCAGAGGGGGCTGCAGGG - Intronic
960057986 3:113289614-113289636 GGGGGTCACCGGGGCCTTCGTGG - Exonic
961045656 3:123705987-123706009 TGGAGGCAGAGTGGCCTTCCTGG + Intronic
961214109 3:125146602-125146624 AGAGGACAAAGGGGGCTTCCTGG + Intronic
961509607 3:127392816-127392838 GAGGGTCAAAGGTGCCTTCCAGG - Intergenic
961519472 3:127458538-127458560 GGGGGTCAGAGAAGGCTTCCCGG - Intergenic
961657721 3:128452582-128452604 TGGGGAGAGAGGGGCCATCCAGG + Intergenic
961830754 3:129621892-129621914 GGAGGTCAGAGAGGGCTTCCTGG + Intergenic
961896964 3:130175873-130175895 CGGGATCAGAGTGGCCTCCCAGG + Intergenic
962201525 3:133404339-133404361 AGGTGTCAGAAGGGGCTCCCAGG - Intronic
962626312 3:137229112-137229134 AGGGGTCAGGGAGGGCTTCCTGG + Intergenic
962646823 3:137448484-137448506 AGGGGTCAGGGAAGCCTTCAAGG - Intergenic
964021839 3:152022199-152022221 TGGAGTCAGAGGTGCCGTCCAGG - Intergenic
964074458 3:152676326-152676348 AGGAGTCTGAGGGGTCCTCCAGG - Intergenic
964318197 3:155466019-155466041 TGGGCCCAGAGGTGCCTTCCAGG - Intronic
966165066 3:177007945-177007967 AGGGCTAAGAGGGTACTTCCCGG - Intergenic
966730193 3:183144518-183144540 AGGGGTGGGAGGGGCCTTCTAGG + Intronic
966794273 3:183698422-183698444 AGGGGTCAGAGAGGCTTTGGGGG + Intronic
967851205 3:194083911-194083933 AGGGCTCAGAGGAGACTTGCTGG - Intergenic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
968446712 4:655792-655814 AGGGGTCAGAGGGGCTGGTCTGG - Intronic
968480360 4:830457-830479 AGGGGCTTCAGGGGCCTTCCCGG + Intergenic
968506098 4:972154-972176 AGGGGGCAAAAGGGCCCTCCTGG - Intronic
968591987 4:1463965-1463987 AGGGGCCTGAGGGGCCCTCCGGG - Intergenic
968660128 4:1795408-1795430 AGGGGTGGGCGGGGCGTTCCAGG - Intronic
968765178 4:2464579-2464601 AGAGCTCAGAGGGGCTTTCTAGG - Intronic
968904853 4:3446421-3446443 AGGGGTCAGAGAGGGTTACCGGG - Intronic
969172429 4:5375078-5375100 AGGGGTGGGAGGGGACTTACAGG - Intronic
969172746 4:5376978-5377000 AGGGCTCAGAGGGGACTTTCTGG - Intronic
969477742 4:7431088-7431110 AGGGGTCAGAGGGCCCCTATGGG + Intronic
969483425 4:7458812-7458834 AGGGGTCAGGGGAGTCTTCTTGG + Intronic
969500889 4:7552318-7552340 AGGGGACAGAGACACCTTCCTGG - Intronic
969521860 4:7682748-7682770 AGGGGTGAAAGGAGTCTTCCTGG + Exonic
969578298 4:8049045-8049067 AGTGGTCACAGGCGGCTTCCTGG - Intronic
970221039 4:13811313-13811335 AAGGCTCAGAAGGGGCTTCCAGG - Intergenic
970364452 4:15344048-15344070 ATTGGTGAGAAGGGCCTTCCAGG + Intronic
973584070 4:52373726-52373748 AGGGGGCAGAAGGGAATTCCAGG + Intergenic
975358221 4:73433296-73433318 AGGGGTCAGATAAGGCTTCCTGG - Intronic
975913565 4:79297488-79297510 AGGGGACAGGGGGGCCTTCCTGG - Intronic
981361672 4:143852895-143852917 AGGGGTGAAAGTGGGCTTCCTGG + Intergenic
982761505 4:159289806-159289828 AGGGGTGAGAGTGTTCTTCCCGG + Intronic
985520012 5:369985-370007 AGGGGTCAGAGGTGCCCTCCTGG + Intronic
985672766 5:1214739-1214761 AGGGGTCAGGGTGGCCCTCCAGG + Intronic
987419665 5:17704198-17704220 AGGGATCAGATGGGACTTCATGG + Intergenic
988225208 5:28404478-28404500 CGGGGGTAGAGGGGTCTTCCCGG - Intergenic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
991347716 5:65687624-65687646 AGGCCTCTGAGGGACCTTCCTGG - Intronic
991669774 5:69036452-69036474 ATGGGTGAGAGGGGCCATTCAGG + Intergenic
992136974 5:73755891-73755913 AGGGGTCAGAAAGGACCTCCTGG - Intronic
992184569 5:74231758-74231780 GGGGATCAGAGGAGGCTTCCTGG + Intergenic
993886135 5:93417924-93417946 AGGTGTCAGAGGGGGCCACCTGG + Intergenic
993888050 5:93439789-93439811 GAGAGTCAGAGGAGCCTTCCTGG - Intergenic
998352794 5:141512229-141512251 AGAGGTCAGAGGGGCCTCTGTGG + Exonic
998846397 5:146314559-146314581 AAGGGACAGAGGGGACTTCTTGG - Intronic
999133069 5:149299394-149299416 AGGGGTCAGAGGGCAGGTCCGGG - Intronic
1000129166 5:158278555-158278577 AGAGGTCTGAGGGGGCTTCTTGG + Intergenic
1001525084 5:172423188-172423210 AGAGGTCAGAGGTGCCTGGCTGG + Intronic
1001960980 5:175880283-175880305 AGGGGTCAGGGGGGCCCCTCAGG + Exonic
1002382180 5:178838941-178838963 GGGGCTCAGAGGGGCCTGGCTGG + Intergenic
1002648543 5:180674324-180674346 GGGGCTCAGAGGGGCCTGGCTGG - Intergenic
1002719331 5:181248163-181248185 AGGGATGTGATGGGCCTTCCAGG - Intergenic
1003129895 6:3386625-3386647 AGAGCTCAGAACGGCCTTCCAGG + Intronic
1005522294 6:26611894-26611916 AGGGGTCAGAGGTGGCTTGGTGG + Intergenic
1006115775 6:31775523-31775545 AGGGGTGGGAGGGGACTTTCGGG - Intronic
1006133516 6:31882556-31882578 AGGGGTCAGAGGAGGCTGGCTGG + Intronic
1006297679 6:33177242-33177264 AGAAGTCACAGGGGCCTCCCAGG + Intronic
1006581102 6:35078477-35078499 GGGGGTCAGGTGGGCCTTTCAGG - Intronic
1006750738 6:36375311-36375333 AGCGGGCAGCAGGGCCTTCCAGG - Intronic
1006791060 6:36701595-36701617 GGGTGTCAGAGAGGGCTTCCTGG - Intronic
1006931403 6:37690921-37690943 AGGATTGAGAGGGGCATTCCAGG - Intronic
1006963798 6:37961387-37961409 AGGGGCCAGAGGTGCTATCCTGG - Intronic
1007421280 6:41721102-41721124 AGTGGTCAGAGAGGGATTCCTGG - Intronic
1007649854 6:43412693-43412715 AGGGAGGAGGGGGGCCTTCCAGG - Intergenic
1007754553 6:44090455-44090477 AGTGGGCAGAGGGGACTGCCAGG + Intergenic
1007964887 6:45995108-45995130 AGTGGCCAAAGGGGCCTGCCTGG - Intronic
1008290151 6:49705330-49705352 AGGGGTGAGATTGGCCTTGCTGG - Intronic
1009610248 6:65931442-65931464 TGGAGGCAGAGGGGCCTTCCTGG + Intergenic
1011204696 6:84879076-84879098 AGGGGCCAGGAGGGCATTCCAGG - Intergenic
1011530217 6:88312826-88312848 CCAGGTCAGGGGGGCCTTCCTGG + Intergenic
1011854677 6:91674921-91674943 AAGGCTCAGAGGGGCTGTCCTGG - Intergenic
1012411316 6:98961096-98961118 AAGGGTCTGAAGGGCCTACCTGG - Intergenic
1013086887 6:106864460-106864482 AGGGGACAGGGGGGCCTTCCTGG + Intergenic
1015736351 6:136404033-136404055 AGGGGTCAGAGGAGGCTTTAGGG - Intronic
1016432936 6:144007376-144007398 AGGGGTTAGAGGAGGATTCCTGG + Intronic
1017090412 6:150754127-150754149 AAGGGTCAGAGGAGGATTCCTGG + Intronic
1017145373 6:151229971-151229993 GGGGGTGAGGGGGGCCTGCCTGG - Intergenic
1017305287 6:152911238-152911260 AGTGGTGAGAGTGGCCATCCTGG + Intergenic
1017727998 6:157288861-157288883 CAGGCTCAGAGTGGCCTTCCAGG - Intergenic
1017813083 6:157998138-157998160 AGGGGAGCGAGGGGTCTTCCTGG + Intronic
1018726317 6:166615781-166615803 AGGGGACAGAGCGCCCATCCTGG - Intronic
1019155230 6:170034101-170034123 AGGGGCCAGTGGGGCCCCCCAGG - Intergenic
1019170393 6:170130356-170130378 AGGAGTCAGAAGGGCATCCCCGG + Intergenic
1019592278 7:1841663-1841685 AGGGGCCAGTCCGGCCTTCCCGG + Intronic
1019921210 7:4164299-4164321 TGGAGTCAGAGGGGCCTCTCAGG - Intronic
1021097163 7:16547543-16547565 AGGCATAAGAGGGGCCTTCCTGG - Intronic
1021313029 7:19116492-19116514 CGGGGTCAGACCGGCCTTCCGGG + Intronic
1022105563 7:27193910-27193932 TGGGTTCAGAGGCGCCCTCCTGG - Intronic
1022471029 7:30682064-30682086 AGGGCTCAGAGGGGCCCGCAGGG + Intronic
1023700127 7:42883928-42883950 TGGGGGCAGGGAGGCCTTCCTGG + Intergenic
1023994521 7:45151182-45151204 AGGGGTCTCCGGGCCCTTCCTGG - Intergenic
1025728593 7:64090191-64090213 AGGGGTCAGAGGGAACTCCCTGG + Intronic
1026606207 7:71818198-71818220 GTGGGTCAGAGGGGGCTTTCTGG + Intronic
1027378362 7:77576951-77576973 TGGGGTCAGCCAGGCCTTCCAGG - Intronic
1027780017 7:82508367-82508389 AGGGGGCAAGGGGGCCTTCCTGG + Intergenic
1028378983 7:90176885-90176907 AGGGGGCAGAGGGGCTTCCTGGG + Intronic
1028596025 7:92547024-92547046 GGGGGGAAGGGGGGCCTTCCCGG - Intergenic
1029560408 7:101299531-101299553 AGGGGAGGGCGGGGCCTTCCCGG + Intergenic
1029561819 7:101308214-101308236 AGGGGAGGGCGGGGCCTTCCCGG + Intergenic
1029728525 7:102424516-102424538 AGGTGTCAGGAGGGGCTTCCTGG + Intronic
1031836361 7:126685484-126685506 AGGGGTCAGAGGGGCCTTCCTGG - Intronic
1031964510 7:128018024-128018046 AGGAGACAGAGGGGTCTCCCGGG - Intronic
1031971784 7:128069934-128069956 AGGGATCAGGGAAGCCTTCCCGG + Intronic
1032266479 7:130373611-130373633 AGTGGTCAGAGGGGCCATGGAGG - Intergenic
1033763024 7:144457265-144457287 GGAGGGCAGAGGTGCCTTCCTGG + Intronic
1034520632 7:151616704-151616726 AGGAGCCAGAGGAGCCTTCACGG + Intronic
1035687397 8:1535524-1535546 AGCGGTCAGATGGGCATGCCTGG + Intronic
1036396277 8:8374001-8374023 AAGGCTCAGAGTGGCGTTCCTGG + Intronic
1036907530 8:12720015-12720037 TGGGGCCAGGGGGGGCTTCCAGG - Intergenic
1037150151 8:15626609-15626631 AGGGGTAAGGGGGGCCTTCCTGG - Intronic
1037711579 8:21359497-21359519 AGGAGTCAGAGGAGCCACCCAGG - Intergenic
1037898229 8:22672431-22672453 ACGGGTCAGACAGGCGTTCCTGG - Intergenic
1038016593 8:23521086-23521108 AGGGGTCAGAGAAGACTTCATGG + Intergenic
1038931805 8:32202214-32202236 AGAGGTTAGAGGGCCCTTCAAGG + Intronic
1039388016 8:37153427-37153449 TGGGGTCAAAGGGGCTTTACTGG - Intergenic
1040303247 8:46199026-46199048 AGGGATAAGAGAGGCCTTCTTGG - Intergenic
1040303599 8:46200775-46200797 TGGGGTGAGAGAGGCCTTCTTGG - Intergenic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1041960710 8:63612260-63612282 AGGAGTCAAAGAAGCCTTCCTGG + Intergenic
1042196893 8:66238542-66238564 AGGGGCAGGAGGTGCCTTCCTGG + Intergenic
1043539352 8:81242182-81242204 AGGGGTCAGGGAGGGCTCCCTGG + Intergenic
1043605081 8:81990503-81990525 AGGTGTCAGTGGGCCCTTACTGG + Intergenic
1044730336 8:95224085-95224107 ATGGTTCAGAGTGACCTTCCCGG + Intergenic
1044868560 8:96596389-96596411 AAGGCCCAGAGGGGACTTCCTGG + Intronic
1045258530 8:100550909-100550931 AGGCGTCAGAGGGCCCCTCAAGG - Intronic
1048219393 8:132527487-132527509 TGGGGACAGAGGTGCCTGCCTGG - Intergenic
1049191362 8:141289675-141289697 AGGGGCCAGAGGGACCTTCAGGG + Intronic
1049196749 8:141320064-141320086 AGGGGGCAGGAGGGCATTCCAGG + Intergenic
1049360793 8:142211745-142211767 AGGGCTCAGTGTGGCATTCCAGG + Intergenic
1051609620 9:18948525-18948547 CAGGGGCAGAGGGGCCTTCTGGG + Intronic
1052641140 9:31166810-31166832 AAGGGGAAGAGGGTCCTTCCTGG + Intergenic
1053470567 9:38343375-38343397 AGGGGTCAGAAAGGACATCCTGG - Intergenic
1054439800 9:65250353-65250375 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
1054490607 9:65771586-65771608 AGGGTTCAGAGGAACCTCCCTGG - Intergenic
1055550114 9:77425465-77425487 ACGGCTCAAAGGGGCCTCCCTGG - Intronic
1059473591 9:114525868-114525890 TGGGGTGAGAGGGGCCATGCTGG - Intergenic
1059506870 9:114807186-114807208 AGGGGGTTGAGGGGGCTTCCTGG + Intergenic
1059954049 9:119497325-119497347 AGGGGCCACAGGGGCCTTGCAGG + Intronic
1060154730 9:121311588-121311610 AGGGGCAAAAGGGGCCTTCTAGG - Intronic
1060262978 9:122092479-122092501 AGGGGTCTGGGGGGCCCTCTTGG + Intronic
1060800041 9:126538229-126538251 AGAGATCAGAGGTGGCTTCCTGG - Intergenic
1060873178 9:127059163-127059185 AGGGGGCAAAGGGCACTTCCTGG - Intronic
1061782567 9:133004520-133004542 AGGGGACACAGGGCCCTGCCAGG + Intergenic
1061854125 9:133432534-133432556 AGGGGCCACCAGGGCCTTCCAGG - Intronic
1062060483 9:134492848-134492870 GGAGGTCAGAGAGGGCTTCCTGG + Intergenic
1062153524 9:135033638-135033660 TGTGGGCAGGGGGGCCTTCCCGG - Intergenic
1062191612 9:135250749-135250771 ATGGCTCAGAGGAGCCTGCCTGG + Intergenic
1062232167 9:135487692-135487714 AGGGGTCCGAGGGCCCCGCCCGG + Exonic
1062702537 9:137914880-137914902 AGGTGCTAGAGGGGCCTTCTTGG + Intronic
1203585717 Un_KI270747v1:1720-1742 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
1186534256 X:10330348-10330370 AGGAGCCAGAGGGCCCTCCCCGG + Intergenic
1188030238 X:25255471-25255493 AGGGGGCTGAGGGGGCTTCTGGG + Intergenic
1189188009 X:39070520-39070542 AGGGGGTGGAGGGGGCTTCCAGG + Intergenic
1190373777 X:49768163-49768185 AGGAGTCAGAGAGGTCTTCTTGG + Intergenic
1191108066 X:56784416-56784438 AGGGGTGGGAGGGGTATTCCAGG + Intergenic
1192141424 X:68649994-68650016 AGGGGACAGAGGTGCCTCTCGGG - Intronic
1192343330 X:70281546-70281568 AGGGGGCCGAGGAGCCTACCTGG + Intronic
1192808233 X:74528526-74528548 AGGCAACAGAGGAGCCTTCCAGG - Intronic
1194205130 X:91002910-91002932 AGGGATGAGGGGGTCCTTCCTGG + Intergenic
1194832915 X:98647234-98647256 AAGAGTCAGAGGGGGCTTCTTGG + Intergenic
1200550949 Y:4578031-4578053 AGGGATGAGGGGGTCCTTCCTGG + Intergenic
1201193948 Y:11473588-11473610 AGGGTTCAGAGGAACCTCCCTGG + Intergenic
1201299186 Y:12491167-12491189 AGAGGTCAGGGGGCCCTGCCTGG - Intergenic