ID: 1031837127

View in Genome Browser
Species Human (GRCh38)
Location 7:126691410-126691432
Sequence CTCAGGCATCTCTGCACTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 7, 2: 56, 3: 153, 4: 640}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031837127_1031837129 -5 Left 1031837127 7:126691410-126691432 CCAAAAGTGCAGAGATGCCTGAG 0: 1
1: 7
2: 56
3: 153
4: 640
Right 1031837129 7:126691428-126691450 CTGAGTCCGCAGCCGCAGCTAGG 0: 1
1: 0
2: 6
3: 62
4: 283
1031837127_1031837135 16 Left 1031837127 7:126691410-126691432 CCAAAAGTGCAGAGATGCCTGAG 0: 1
1: 7
2: 56
3: 153
4: 640
Right 1031837135 7:126691449-126691471 GGTCGCTGCAGTGGTGCCTGGGG 0: 1
1: 0
2: 5
3: 47
4: 277
1031837127_1031837133 14 Left 1031837127 7:126691410-126691432 CCAAAAGTGCAGAGATGCCTGAG 0: 1
1: 7
2: 56
3: 153
4: 640
Right 1031837133 7:126691447-126691469 TAGGTCGCTGCAGTGGTGCCTGG No data
1031837127_1031837137 24 Left 1031837127 7:126691410-126691432 CCAAAAGTGCAGAGATGCCTGAG 0: 1
1: 7
2: 56
3: 153
4: 640
Right 1031837137 7:126691457-126691479 CAGTGGTGCCTGGGGGAGTGAGG 0: 1
1: 0
2: 2
3: 48
4: 626
1031837127_1031837132 7 Left 1031837127 7:126691410-126691432 CCAAAAGTGCAGAGATGCCTGAG 0: 1
1: 7
2: 56
3: 153
4: 640
Right 1031837132 7:126691440-126691462 CCGCAGCTAGGTCGCTGCAGTGG No data
1031837127_1031837134 15 Left 1031837127 7:126691410-126691432 CCAAAAGTGCAGAGATGCCTGAG 0: 1
1: 7
2: 56
3: 153
4: 640
Right 1031837134 7:126691448-126691470 AGGTCGCTGCAGTGGTGCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 198
1031837127_1031837136 17 Left 1031837127 7:126691410-126691432 CCAAAAGTGCAGAGATGCCTGAG 0: 1
1: 7
2: 56
3: 153
4: 640
Right 1031837136 7:126691450-126691472 GTCGCTGCAGTGGTGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031837127 Original CRISPR CTCAGGCATCTCTGCACTTT TGG (reversed) Intronic
900716123 1:4145509-4145531 GTCAGTCATCTCTGCACTCTGGG - Intergenic
900976696 1:6021255-6021277 CTCTGTAATCTCAGCACTTTGGG - Intronic
901403736 1:9032167-9032189 CTCAGGCATCCCCACACTCTTGG - Intergenic
901406955 1:9055654-9055676 CTCTGTCATCTCAGCACTTGGGG + Intronic
901936501 1:12630569-12630591 CCCAGGCATCCCCGCACTCTTGG + Intergenic
902913485 1:19619943-19619965 ATCAGGCATTTCTTTACTTTAGG + Intronic
903311966 1:22465720-22465742 CTCAGGCATCCCTGCACTCTTGG - Intronic
903337621 1:22635473-22635495 CCCAGGCATCCCTGCAATCTTGG - Intergenic
903738024 1:25542785-25542807 CACAGCCATCCCAGCACTTTGGG + Intergenic
903911775 1:26732224-26732246 CTCAGTCATCTCTTTTCTTTGGG - Intronic
904146770 1:28399050-28399072 ATCTGTAATCTCTGCACTTTGGG + Intronic
904365797 1:30010303-30010325 CTTAGGCATCCCTGCACTCTTGG - Intergenic
904443690 1:30550718-30550740 CCCAGGCATCTCTGGATTCTTGG + Intergenic
904460935 1:30679502-30679524 CCCTGGCATCCCTGCACTCTTGG + Intergenic
904551678 1:31324482-31324504 CCCAGGCATCCCTGCACTCTTGG + Intronic
905534289 1:38708021-38708043 CTCACGCCTCCCAGCACTTTGGG + Intergenic
906082478 1:43102300-43102322 CTCAGGCATCCCCGTACTCTTGG - Intergenic
906132557 1:43469238-43469260 CCCAGGCATCTCTGTGCTCTTGG - Intergenic
906448366 1:45922673-45922695 CCCAGGCATCTCTGAACTCTCGG - Intronic
906475422 1:46166480-46166502 CTCACGCCTCCCAGCACTTTGGG - Intronic
906985834 1:50682238-50682260 ATCAGTAATCTCTGCACTTTGGG + Intronic
907194307 1:52674128-52674150 CTCTGTAATCTCAGCACTTTGGG - Intergenic
907369740 1:53993017-53993039 CCCAGGCATCCCTGCACTTTGGG - Intergenic
907761715 1:57367961-57367983 CCCAGGCATCCCTGCCCTCTTGG + Intronic
908226690 1:62062754-62062776 GCCTGTCATCTCTGCACTTTGGG - Intronic
908967786 1:69787201-69787223 CTTGGGCAGCTCTGCACTTGTGG + Intronic
909238401 1:73181200-73181222 CTCAGGCATCCCTGCACTCTTGG - Intergenic
909245012 1:73270130-73270152 CTCAGGCAGCTCTGCCCTTGTGG - Intergenic
909645999 1:77918416-77918438 CTCTGTAATCTCAGCACTTTGGG + Intronic
909651834 1:77983845-77983867 CTCAAGTGTGTCTGCACTTTAGG - Intronic
910219383 1:84875157-84875179 GTCTGTCATCTCAGCACTTTGGG - Intronic
910301980 1:85715985-85716007 CTCAGGCTACCCAGCACTTTGGG - Intergenic
910422320 1:87079771-87079793 CTCAGGCCTGTGAGCACTTTGGG + Intronic
910655018 1:89610243-89610265 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
910893317 1:92040718-92040740 ATCAGTAATCTCAGCACTTTGGG - Intronic
911520934 1:98929693-98929715 ATCAGCCATGGCTGCACTTTAGG - Intronic
912008515 1:104932586-104932608 CCCAGGCATCCCTGTACTCTTGG + Intergenic
912044434 1:105437032-105437054 CTCAGTCTCCTCTGGACTTTGGG + Intergenic
912132434 1:106619509-106619531 CCCAGGCATCTCTGCACTCTTGG + Intergenic
912232387 1:107810235-107810257 CTCAGGCATTACTGCTCTTATGG + Intronic
913420960 1:118668555-118668577 CTCAGGGATCCCAGCACTTTGGG + Intergenic
914392834 1:147237279-147237301 CCTGGGCATCTCTGCACTCTTGG - Intronic
915306995 1:154985983-154986005 CTCATGCCTCCCAGCACTTTGGG - Intronic
915558138 1:156671111-156671133 ACCAGGCCTCTCTGCTCTTTGGG + Exonic
915571088 1:156745356-156745378 CTCAGGCATCTCGTCAATCTGGG + Exonic
915751215 1:158212782-158212804 CCCAGGCATCTCTGCACTCTTGG + Intergenic
916699174 1:167273187-167273209 CTGAGGCATCTCTGCCCCTGTGG + Intronic
917492015 1:175505779-175505801 CTGAGCCATCCCAGCACTTTGGG + Intronic
917916914 1:179711061-179711083 CTCAGTCTTCCCAGCACTTTGGG + Intergenic
918067294 1:181109960-181109982 CTCAGCCATCTCTGAACCATAGG + Intergenic
918510930 1:185313696-185313718 CTCTGGGATGTCTGGACTTTTGG - Intronic
918983809 1:191596759-191596781 CATGGGCATCTCTGCACTCTTGG - Intergenic
919239152 1:194889413-194889435 CTCAGTCCCCTCTGGACTTTGGG + Intergenic
919308714 1:195878193-195878215 CTTAGGCATCTCTGCCCCTGCGG + Intergenic
919453894 1:197801052-197801074 CCCAGGAATCTCTGCACTCTTGG + Intergenic
919727507 1:200893823-200893845 CTCTGTCATCCCTGCACTTGGGG + Intronic
920525366 1:206662191-206662213 CTCACTAATCCCTGCACTTTGGG - Intronic
920791850 1:209100513-209100535 CTCATTCATCTCTGTGCTTTTGG + Intergenic
921047307 1:211486587-211486609 ATCTGTCATCTCAGCACTTTGGG + Intronic
921208906 1:212875504-212875526 CTCAGGTATCTGTGGAGTTTTGG + Intronic
922034670 1:221836452-221836474 CTCATGCTGCCCTGCACTTTTGG + Intergenic
922132694 1:222795303-222795325 CTCAGCCACTTCTGGACTTTGGG + Intergenic
922141741 1:222894408-222894430 CTCAGTCCCCTCTGGACTTTGGG - Intronic
922141790 1:222894620-222894642 CCCAGGCATCTCTGCACTCTTGG - Intronic
922745520 1:228041199-228041221 CTCTTGCATCTCAGAACTTTTGG - Intronic
923237356 1:232047101-232047123 CTCAGGCATGACTGCACCATTGG + Intergenic
923328101 1:232898452-232898474 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
923877734 1:238067699-238067721 CTCAGGCATCTGTTTCCTTTAGG - Intergenic
924679833 1:246220470-246220492 TCCAGACATCCCTGCACTTTGGG + Intronic
924902131 1:248412155-248412177 CTCAGGCACCTCCGCCCTTATGG - Intergenic
1062770131 10:92510-92532 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1062771552 10:105168-105190 CCCAGGCATGTCTGCACTCTCGG - Intergenic
1063939798 10:11116303-11116325 CTCAGGCATCTCTGGTGATTAGG - Intronic
1064217192 10:13410177-13410199 TTCAGGCTTCTCTCCTCTTTAGG + Intergenic
1064411112 10:15104961-15104983 GTCTGTCATCTCAGCACTTTGGG - Intronic
1064430243 10:15264523-15264545 ATCGGGCATCTCAGCACTTTGGG + Intronic
1064631769 10:17321834-17321856 CTCATGCTTGTCAGCACTTTGGG + Intronic
1064830956 10:19465791-19465813 CTCAGTTATCGCAGCACTTTGGG - Intronic
1065678722 10:28207430-28207452 CTCACTCCTCTCAGCACTTTGGG + Intronic
1065713312 10:28538320-28538342 CGCCGGAATCTCAGCACTTTGGG + Intronic
1065850195 10:29781446-29781468 ATCAGTCATCCCAGCACTTTAGG + Intergenic
1065923197 10:30411486-30411508 CTCAGGAATCTCTGCAGTCAGGG - Intergenic
1066188801 10:33036892-33036914 CCCAGGTATCCCTGCACTCTCGG + Intergenic
1066277768 10:33885898-33885920 CTCATGCCTCCCAGCACTTTGGG + Intergenic
1066378478 10:34881154-34881176 CTCTGGAATCCCAGCACTTTGGG + Intergenic
1066403057 10:35093397-35093419 CTCATGCCTCCCAGCACTTTGGG + Intergenic
1067234244 10:44435066-44435088 CCCAGGGACCTCTGCTCTTTGGG + Intergenic
1067273742 10:44815879-44815901 GTCAGTAATCCCTGCACTTTGGG - Intergenic
1067421956 10:46159598-46159620 GTCAGGCATCTCTACACTCTTGG - Intergenic
1067507263 10:46865687-46865709 GTCAGGCATCTCTACACTCTTGG - Intergenic
1068213526 10:53952794-53952816 CTCAGCCCACTCTGGACTTTGGG - Intronic
1068348362 10:55813357-55813379 GTCAGACATCTCTACACTCTTGG + Intergenic
1068672790 10:59741055-59741077 CTCTGTAATCTCAGCACTTTGGG - Intergenic
1069121706 10:64576541-64576563 CCCAGACATCTCTGAACTCTTGG + Intergenic
1069249189 10:66246259-66246281 CTTAGACATCCCTGCACTCTTGG - Intronic
1069576058 10:69529173-69529195 CTCAGGCATCACTGTACTCTTGG - Intergenic
1069592911 10:69652868-69652890 CTCAGCCCTCTCTGGACTTTGGG + Intergenic
1070096317 10:73340875-73340897 CCCAGGCATCTCTGCACTCTTGG - Intronic
1070201238 10:74207984-74208006 CTCAGCCCCCTCTGGACTTTAGG - Intronic
1070310112 10:75266806-75266828 CTCACGCCTCCCAGCACTTTGGG + Intergenic
1070859439 10:79638734-79638756 GTCAGGCATCTCTACACTCTTGG - Intergenic
1071536406 10:86435521-86435543 CTCAGAGAACTCTGCATTTTAGG - Exonic
1071819528 10:89265247-89265269 CCTAGGCATCCCTGCAGTTTGGG - Intronic
1071886148 10:89952274-89952296 CTCAGGTATCCCTGTACTTTTGG - Intergenic
1072031764 10:91528503-91528525 CTCATGCCTCTCTTCACCTTGGG + Intergenic
1072120140 10:92398851-92398873 CTGAGGAATCTCTGCATTTGAGG + Intergenic
1072335659 10:94395759-94395781 CTCAGGCATCCCTCCACTCTTGG - Intergenic
1072382562 10:94890390-94890412 GTCTGTAATCTCTGCACTTTGGG - Intergenic
1072753213 10:97999261-97999283 CCTAGGCATCCCTGCACTCTTGG + Intronic
1073158540 10:101369341-101369363 CTCATGCCTCTCAGCACTTTGGG - Intronic
1073260846 10:102188973-102188995 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1073404351 10:103284254-103284276 CTAGGGCATCCCAGCACTTTGGG - Intronic
1073670310 10:105580095-105580117 CCCAGGCATCCCTGCATTCTTGG - Intergenic
1073845021 10:107544924-107544946 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1074318664 10:112381027-112381049 CCCTGTAATCTCTGCACTTTGGG - Intronic
1074991643 10:118713318-118713340 CTCAGGCATCCCTGCATTCTTGG - Intronic
1075150541 10:119925799-119925821 CCCAGTAATCTCAGCACTTTGGG - Intronic
1075359831 10:121821201-121821223 ATCAGGAATCTCAGCACTTTGGG - Intronic
1075710668 10:124528898-124528920 GTCAGGGATCTCTGCTCTGTTGG + Intronic
1076655258 10:132019539-132019561 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1076689809 10:132217159-132217181 CTTAGGCAGCTCTGCCCTTGTGG - Intronic
1078303222 11:10156053-10156075 CCCGGGCATCCCTGCACTCTCGG + Intronic
1078315238 11:10289065-10289087 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1078451217 11:11442471-11442493 ATCTGGCATCTTTGAACTTTGGG - Intronic
1078612643 11:12834874-12834896 CTCTGTAATCTCAGCACTTTGGG - Intronic
1078772126 11:14360624-14360646 CCCAGCCATCCCAGCACTTTGGG - Intronic
1078836489 11:15035253-15035275 CTCAGGCATCCCTGCACTCTTGG - Intronic
1079184173 11:18221408-18221430 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1079349620 11:19681429-19681451 CCCAGGTCTCTCTGCAATTTGGG + Intronic
1079368089 11:19826934-19826956 CTCACCCATCTCTGCACTCCTGG - Intronic
1079472393 11:20790510-20790532 CCCACGCATCCCTGCACTCTTGG - Intronic
1079666708 11:23114819-23114841 GTCAGGTATCTCAGCACTTTAGG + Intergenic
1080065175 11:28002571-28002593 CTCAGGCGGCTCTGCCCTTGTGG - Intergenic
1080264215 11:30384717-30384739 CTCATGCCTCCCAGCACTTTGGG - Intronic
1080673686 11:34405169-34405191 CTCAGGCATTGCTACTCTTTCGG - Intergenic
1080967112 11:37225294-37225316 CACAGGCGTCTCTGCACACTTGG - Intergenic
1081075891 11:38672991-38673013 GTCAGGCTTTTCTGAACTTTAGG - Intergenic
1081164056 11:39786382-39786404 CCCAGGCATCCCTGCACTCTCGG - Intergenic
1081237076 11:40659049-40659071 CCCAGGCATTGCTGCACTCTTGG + Intronic
1081636451 11:44725553-44725575 GTCTGTCATCTCAGCACTTTGGG + Intergenic
1081840566 11:46198238-46198260 ATAATGCATCTCTGCACTATTGG + Intergenic
1081947313 11:47008770-47008792 CTCATGCCTCCCAGCACTTTGGG + Intronic
1082750841 11:57015157-57015179 GTCTGTAATCTCTGCACTTTGGG + Intergenic
1082821995 11:57550306-57550328 CCCAGGAACCTCTGCACTCTGGG + Intergenic
1083066853 11:59932356-59932378 CTCAGGCATGCCTGCACTCTTGG - Intergenic
1083978485 11:66143897-66143919 CTCTGTAATCTCAGCACTTTGGG - Intronic
1084002489 11:66304409-66304431 ATCAGTCATCCCAGCACTTTGGG - Intergenic
1084703964 11:70805102-70805124 CACAGGCCTCTCTGCCCCTTTGG + Intronic
1084807263 11:71587639-71587661 CTCAGGCACCTAAGAACTTTTGG + Intronic
1085285787 11:75359705-75359727 CGCAGTCATCTCAGCAATTTGGG + Intergenic
1085680674 11:78571920-78571942 CACAGAAATCTCAGCACTTTGGG + Intronic
1086085214 11:82946155-82946177 CCCAGGCATCCCTGTGCTTTTGG - Intronic
1086249221 11:84794600-84794622 CCCAGGTATCTCTGCACTGTTGG + Intronic
1086508350 11:87528888-87528910 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1087211165 11:95447275-95447297 ACCTGGCATCTCTGCACTCTTGG - Intergenic
1087651393 11:100872650-100872672 CTCATTAATCTCAGCACTTTGGG - Intronic
1088288094 11:108207737-108207759 AGCAGGCATCCCTGCACTCTCGG - Intronic
1088310611 11:108456520-108456542 CTCTGTAATCTCAGCACTTTCGG + Intronic
1088487818 11:110357954-110357976 CTCCGTAATCTCAGCACTTTGGG + Intergenic
1090117032 11:123984514-123984536 CTCTGGGATCTCTGACCTTTAGG + Intergenic
1090137104 11:124209982-124210004 CCCAGGCATCTCTGCAGACTTGG - Intergenic
1090358605 11:126157444-126157466 CTCTGTAATCCCTGCACTTTGGG - Intergenic
1090514751 11:127412752-127412774 CCCAGGAATCCCTGCACTGTTGG - Intergenic
1090794874 11:130126237-130126259 CTCAGGTACCTCTGCTCTTCTGG - Intronic
1090937428 11:131356346-131356368 CTCTGTAATCTCAGCACTTTCGG + Intergenic
1091031004 11:132187678-132187700 TTGAGGCATCTCTGGGCTTTGGG + Intronic
1091352527 11:134908558-134908580 CTCAGGGATCTCTGCAGTTAAGG + Intergenic
1093281712 12:17203794-17203816 CCCAGGCATCCCTGCCCTCTTGG + Intergenic
1093290336 12:17311899-17311921 ATCTGTAATCTCTGCACTTTGGG - Intergenic
1093451551 12:19321630-19321652 CCCCCGTATCTCTGCACTTTGGG - Intronic
1094038963 12:26102916-26102938 GACAGACATCTCTGCATTTTGGG + Intergenic
1094144408 12:27214028-27214050 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1095042213 12:37455608-37455630 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1095145376 12:38720956-38720978 CTCAGGCATCCCTGTACCCTTGG + Intronic
1096238911 12:49948966-49948988 CACAGGAATCCCTGCTCTTTTGG + Intergenic
1097130052 12:56805076-56805098 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1097299099 12:57998578-57998600 TTCAGGCATTCCTGCACTCTTGG - Intergenic
1097441074 12:59609416-59609438 CTTTGGCATATCTGGACTTTAGG + Intronic
1097446582 12:59679104-59679126 TGCTGGCATCTCTGCACTCTTGG - Intronic
1098152410 12:67560538-67560560 CACAGGCATCTATGCATTTCTGG + Intergenic
1098290948 12:68956310-68956332 CCCTGGCATCCCTGCACTCTTGG - Intronic
1098508456 12:71282757-71282779 CCCAGACATCTCTGCAATCTCGG - Exonic
1098597935 12:72295046-72295068 CTCAAGCATCCCTGCACTTTTGG - Intronic
1099092167 12:78325902-78325924 CTCATGCCTCCCAGCACTTTGGG + Intergenic
1099105003 12:78486377-78486399 CTCGGGCAGCTCTGCACCTGTGG + Intergenic
1099295279 12:80821990-80822012 CTCAGCCCTCTGTGGACTTTGGG + Intronic
1099682273 12:85844148-85844170 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1099713828 12:86264903-86264925 CTCAGCCCTCTCTGGATTTTGGG + Intronic
1099738430 12:86600820-86600842 CTCCGGCATCCCTGTACTCTCGG + Intronic
1099854103 12:88142217-88142239 CTCAGGCAGAACTGCACTCTGGG - Intergenic
1099979225 12:89579555-89579577 CTCATGCCTCCCAGCACTTTGGG - Intergenic
1100401743 12:94236578-94236600 ATTAAGCATCTCTGGACTTTGGG + Intronic
1100472066 12:94902449-94902471 CTCTGTAATCTCAGCACTTTGGG + Intronic
1100610327 12:96186408-96186430 CACAGGCATGTCTTCCCTTTGGG - Intergenic
1100847795 12:98678634-98678656 CTCAGGCATCCCTGTACTCTTGG + Intronic
1102327092 12:111995482-111995504 GTCTGTAATCTCTGCACTTTGGG + Intronic
1102368076 12:112356695-112356717 CTCATGCCTCCCAGCACTTTGGG - Intronic
1102954045 12:117048120-117048142 CTCAGGCATCCCTGGCCTCTTGG - Intronic
1103591884 12:121997440-121997462 CTCCTGCATCCCTACACTTTGGG + Intronic
1103642838 12:122366045-122366067 CTCACGCCTCCCAGCACTTTGGG + Intronic
1103705654 12:122870405-122870427 CTGCGGCCTCTCTGCACTTGCGG - Intronic
1105372521 13:19814360-19814382 ACCAGGAATCTCAGCACTTTGGG + Intergenic
1105573023 13:21622201-21622223 CTCAGTCAACTCTTCATTTTTGG - Intergenic
1105775895 13:23659762-23659784 ATCTGTCATCTCAGCACTTTGGG - Intronic
1106308804 13:28535147-28535169 CCCAGGCATTCCTGCACTCTTGG + Intergenic
1106357814 13:29000931-29000953 AACAACCATCTCTGCACTTTGGG - Intronic
1106537528 13:30660397-30660419 CTCAGGCATCCCTGCACTTTTGG - Intronic
1106711433 13:32339053-32339075 TACAGGCCTCTCTGTACTTTAGG - Exonic
1108017065 13:46086823-46086845 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1108110208 13:47063434-47063456 CTCTGTAATCTCCGCACTTTGGG - Intergenic
1108415424 13:50193644-50193666 GTCTGTCATCTCAGCACTTTGGG - Intronic
1108542482 13:51456708-51456730 CTCAGTCCCCTCTGGACTTTGGG - Intergenic
1108844406 13:54660178-54660200 CTCAGCCCCCTCTGAACTTTGGG - Intergenic
1109030075 13:57179766-57179788 CTCAGGCATTCCTGCACTCTTGG - Intergenic
1109306964 13:60651582-60651604 CCCAGGCTTCTCTTCACTTAAGG - Intergenic
1109426130 13:62168027-62168049 CCCAGGCATCCCCGCACTCTTGG + Intergenic
1109470552 13:62799094-62799116 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1109525146 13:63566087-63566109 CCCAGCCATCTCTGAACTCTCGG + Intergenic
1109762261 13:66845287-66845309 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1109762300 13:66845488-66845510 CCCAGGCATCTCTTCACTCTTGG - Intronic
1109982202 13:69923875-69923897 CCCAGGCATCTCTGCACTCTTGG + Intronic
1110777894 13:79432084-79432106 CCTGGGCATCTCTGCACTCTCGG + Intergenic
1110939392 13:81330570-81330592 CTCAGGCATCACTGCACTCTTGG + Intergenic
1111091390 13:83452458-83452480 CTCAGGCATCCCTGCGCTCTTGG + Intergenic
1111253679 13:85639112-85639134 CCCAGGCATCTCTGCACTCTCGG - Intergenic
1111337293 13:86840424-86840446 CTCAGGCCCCTGTGGACTTTGGG - Intergenic
1111474248 13:88725135-88725157 CTCAGGCATCTCTGTGCTCTCGG + Intergenic
1112162141 13:96878959-96878981 ATCAGTAATCTCAGCACTTTGGG + Intergenic
1112172272 13:96986338-96986360 TTCATGCTTCTCTGCACTCTGGG - Exonic
1112701038 13:102008427-102008449 CTAAGGCATCTGTGTATTTTGGG + Intronic
1114280988 14:21192376-21192398 CTCAGACATCCCTGCACTCTTGG + Intergenic
1114481920 14:23041384-23041406 CTCATGCCTCCCAGCACTTTGGG - Intergenic
1115175190 14:30554223-30554245 CTCAGGCTTTTCTCAACTTTGGG - Intergenic
1116541660 14:46108376-46108398 CCCAGGCATCTCCACACTCTTGG - Intergenic
1116814790 14:49573665-49573687 CTCAAGCATGTCAGCACTGTTGG + Exonic
1116856648 14:49958498-49958520 CTCTGCAATCTCAGCACTTTGGG - Intergenic
1116940982 14:50790313-50790335 CTCATGCCTCCCAGCACTTTGGG - Intronic
1116961602 14:50973255-50973277 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1117225625 14:53655579-53655601 CTCAGGCATTTGAGCATTTTTGG + Intergenic
1117411194 14:55452765-55452787 GTCAGTAATCTCAGCACTTTAGG - Intronic
1117659126 14:57985982-57986004 CACAGACATCTCTGTATTTTAGG + Intergenic
1117930834 14:60838938-60838960 CTCAGCCCCCTCTGGACTTTGGG + Intronic
1118353923 14:64995869-64995891 ATCTGTAATCTCTGCACTTTGGG + Intronic
1118473208 14:66094079-66094101 CCCAGGCATCTCTGCACTCTCGG - Intergenic
1118522106 14:66596736-66596758 CCCGGGCATCTCTACACTCTTGG - Intronic
1118723061 14:68608028-68608050 CTCAGGCCTCTCAGAACCTTTGG - Intronic
1118947072 14:70398465-70398487 CTCAGCCCTCTCTGGACTTTGGG - Intronic
1119036067 14:71231359-71231381 CCCAGGCATCTGTGCACTCCTGG + Intergenic
1119479611 14:74951328-74951350 GGCAGGCTTCCCTGCACTTTGGG - Intronic
1120356497 14:83441204-83441226 CTCAGGCTTCTCTGTAAGTTTGG - Intergenic
1120650770 14:87130126-87130148 CTCATGCCTGTCTGCACTTTAGG - Intergenic
1121528100 14:94633435-94633457 CCCAGGCATCTCTGTGCTCTTGG - Intergenic
1121650570 14:95554867-95554889 CTGAGGAATCCCTGCACTTTGGG + Intergenic
1121695406 14:95908275-95908297 CTCAGGCCTCCCTGCACTCTTGG - Intergenic
1121824732 14:97000906-97000928 CTCAGGCATCCCTGCACTCCTGG - Intergenic
1121833917 14:97075164-97075186 CTCTGGCTTTTCTGCACTTTGGG + Intergenic
1122239098 14:100350134-100350156 CTCACGCATCCCAGCACTTTGGG + Intronic
1122490746 14:102114246-102114268 CCCAGCAATCTCAGCACTTTGGG - Intronic
1123216493 14:106813412-106813434 CTCAGGCGCCCCTGCACTCTTGG + Intergenic
1202940736 14_KI270725v1_random:143333-143355 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1123419366 15:20118907-20118929 GTCTGTCATCTCAGCACTTTGGG + Intergenic
1123528588 15:21125449-21125471 GTCTGTCATCTCAGCACTTTGGG + Intergenic
1125309028 15:38358259-38358281 GCCAGTCATCTCAGCACTTTGGG - Intergenic
1125377548 15:39047208-39047230 GCCTGTCATCTCTGCACTTTAGG + Intergenic
1125570885 15:40717076-40717098 CTCACGCCTCCCAGCACTTTGGG + Intronic
1125718009 15:41830648-41830670 CCCAGGCATGTCTGCACTTTTGG + Intronic
1126215123 15:46145983-46146005 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1126292728 15:47099914-47099936 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1126676624 15:51164238-51164260 CTCAGCCAGCTCTGGACTCTAGG - Intergenic
1127275693 15:57441626-57441648 GTCTGTCATCTCAGCACTTTGGG - Intronic
1127305044 15:57697237-57697259 ATCTGTCATCTCAGCACTTTGGG + Intronic
1127938731 15:63670940-63670962 ATCTGTAATCTCTGCACTTTGGG + Intronic
1128009187 15:64275296-64275318 CTCATGCCTCCCAGCACTTTGGG - Intronic
1128796008 15:70467119-70467141 CTCAAGCATCTTTGCACATGAGG - Intergenic
1128847772 15:70916886-70916908 CCCAGGCATCTCTGCACTCTTGG + Intronic
1129183454 15:73891573-73891595 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1129248871 15:74297171-74297193 CTCAGGCACCACAGCACTTATGG + Intronic
1129377825 15:75145297-75145319 CCCAGGCCTCTCTGCACTTTTGG - Intergenic
1130064064 15:80590476-80590498 CTCACTCATCCCAGCACTTTGGG + Intronic
1130107275 15:80938345-80938367 CTCACGCTTCCCAGCACTTTGGG + Intronic
1130739025 15:86578155-86578177 CTTGGGCAGCTCTGCACTTACGG - Intronic
1130869215 15:87956966-87956988 CTAAGACATCTCTGCACTGGGGG + Intronic
1131568358 15:93506605-93506627 CTCAGTCCCCTCTGGACTTTGGG - Intergenic
1131605748 15:93900946-93900968 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1131605798 15:93901153-93901175 CCCAGGCATCCCTGTGCTTTCGG - Intergenic
1131884955 15:96902707-96902729 CTCATGCCTCCCAGCACTTTGGG - Intergenic
1132305248 15:100807430-100807452 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1132971807 16:2692896-2692918 CTCAGGCATCCCTGCACTCTTGG - Intronic
1133207316 16:4241321-4241343 CTTTGACATCTCAGCACTTTGGG - Intronic
1134078510 16:11308868-11308890 CCCAGGCATCCCTGCACTCTTGG - Intronic
1134591103 16:15454052-15454074 CTCACACATCTCTGCTCTCTAGG + Intronic
1134842582 16:17413695-17413717 ATCTGTCATCTCAGCACTTTGGG - Intronic
1134902200 16:17948645-17948667 CTCAGGAATCCCAGCACTTTGGG + Intergenic
1135057251 16:19241369-19241391 CCCAGGCATCTATGCACTCTTGG - Intronic
1135219382 16:20600467-20600489 CTGAGGCATTTCTGCACTGAAGG - Intergenic
1136872909 16:33824668-33824690 CTCAGGCGTCCCTGCACTCTTGG - Intergenic
1137334425 16:47533743-47533765 CCCAGGCATCTCTATACTCTTGG - Intronic
1137343797 16:47636468-47636490 CCCAGGCATCACTGCACTCTTGG + Intronic
1138013842 16:53411886-53411908 CTCAGTAATCCCAGCACTTTGGG + Intergenic
1138394732 16:56695383-56695405 CTCAGGCATCCCTTCACTCCTGG + Intronic
1138404136 16:56775158-56775180 ATCTGTGATCTCTGCACTTTAGG - Intronic
1138878244 16:60979250-60979272 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1138925157 16:61581595-61581617 CTCAGCCCCCTCTGGACTTTAGG - Intergenic
1139191436 16:64867952-64867974 GTCTGGAATTTCTGCACTTTGGG + Intergenic
1139459982 16:67113959-67113981 CTCATGCCTCCCAGCACTTTGGG - Intronic
1139538218 16:67592765-67592787 GTCAGTAATCTCAGCACTTTGGG + Intronic
1139626864 16:68196769-68196791 CTCCTGTATCTCAGCACTTTGGG + Intronic
1140413117 16:74753420-74753442 CTCATGCCTCCCAGCACTTTGGG + Intronic
1140811144 16:78579356-78579378 CTCAGACATCTCTTCGCCTTTGG - Intronic
1140832857 16:78767392-78767414 CGCAGTCATCTCAGCGCTTTGGG - Intronic
1141006254 16:80355166-80355188 CTCACGCATCCCAGCACTTTTGG - Intergenic
1141028571 16:80569560-80569582 CTCAGGCATCCCCGCACTCCTGG + Intergenic
1141172525 16:81700414-81700436 CTCAGGCTTCTGGGGACTTTGGG - Intronic
1142175713 16:88644012-88644034 CCCAGGCATTTCTGCACATGGGG + Intronic
1203099261 16_KI270728v1_random:1291386-1291408 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1142859610 17:2753237-2753259 CGCTGTCATCTCAGCACTTTGGG - Intergenic
1142865468 17:2788555-2788577 CTCAGTAATCCCAGCACTTTGGG - Intronic
1143365757 17:6407499-6407521 CTCAGTAATCTCAGCACTTTGGG + Intronic
1143850985 17:9811853-9811875 CTCAGGCATCTTTGCACCCCCGG - Intronic
1144647154 17:16982921-16982943 CTCAGTAATCCCAGCACTTTGGG - Intergenic
1145217179 17:21061210-21061232 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1145239321 17:21230780-21230802 CCCAGGCATCTCTGATCTTAGGG + Intergenic
1145368534 17:22286882-22286904 CCCAGGCACCTCTGCACTCTTGG + Intergenic
1145750206 17:27349702-27349724 CTCGGGCCCCTCTGCACTTTTGG + Intergenic
1146049139 17:29535050-29535072 CTTAGGCCTCCCAGCACTTTGGG + Intronic
1146761443 17:35482583-35482605 TTCAGGCATCTCTGCACTCTTGG + Intronic
1147631039 17:41931799-41931821 CTCAGTAATCCCAGCACTTTGGG - Intronic
1148386395 17:47237905-47237927 ATCAGGCATTTCTGCACTCTTGG - Intergenic
1149169369 17:53791798-53791820 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1149330660 17:55577771-55577793 GTCGGGCATCTCTGCACTGTCGG - Intergenic
1149362592 17:55910960-55910982 CCCAGGCATCTCTGCACTCCTGG - Intergenic
1150201582 17:63362606-63362628 CTCAGTCCCCTCTGGACTTTGGG - Intronic
1150520929 17:65866104-65866126 CCCAGGCATCTCAGCACTCTCGG + Intronic
1150756188 17:67916328-67916350 CTCACGCCTCCCAGCACTTTGGG + Intronic
1150950873 17:69801378-69801400 CTCAAGCATTGCTGCACTCTTGG + Intergenic
1150952709 17:69821367-69821389 CCCAGGTATCTTTGCACTCTTGG + Intergenic
1151162409 17:72176473-72176495 CCCTGGCATCTCTGCACAGTTGG - Intergenic
1151273776 17:73017451-73017473 ATCTGGAATCTCAGCACTTTGGG + Intronic
1151395426 17:73819773-73819795 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1151895100 17:76974801-76974823 CTCAGGCATCTCTGCACTGCTGG + Intergenic
1151902089 17:77022995-77023017 CTTAGGCAGCTCTGCCCTTGTGG - Intergenic
1152346438 17:79755206-79755228 CTCACGCCTCCCAGCACTTTGGG + Intergenic
1152530240 17:80914406-80914428 CCCAGCCATCTCTGCTCTTGGGG + Intronic
1153139478 18:1954920-1954942 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1153178744 18:2408741-2408763 CTCAGGAAGCTCTGCACCTGTGG + Intergenic
1153237876 18:3005764-3005786 CTCAGCAATCCCAGCACTTTGGG + Intronic
1153428072 18:4987983-4988005 TTCAGGCATCCCTGCACTGTCGG - Intergenic
1153428888 18:4993443-4993465 CCCAAGCATCCCTGCACTCTTGG - Intergenic
1153608063 18:6854784-6854806 CCCGGGCATCTCTGTACTCTTGG + Intronic
1154507887 18:15060695-15060717 CTCAGGCATCCTTACACTCTTGG + Intergenic
1155341254 18:24816848-24816870 ATCTGTCATCTCAGCACTTTGGG - Intergenic
1157006526 18:43590075-43590097 CCCAGGCATCTTTGCACTCTTGG - Intergenic
1157810466 18:50691839-50691861 CTCTGCCGTCTCTGCAGTTTTGG - Intronic
1158139574 18:54242182-54242204 CCCAGGGATCTCTGCACTCTTGG - Intergenic
1158312334 18:56171535-56171557 CTCAGGCAACTTGGTACTTTGGG + Intergenic
1158787987 18:60739655-60739677 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1158800809 18:60906488-60906510 GTCTGTGATCTCTGCACTTTGGG + Intergenic
1159426185 18:68289829-68289851 ATCTGTAATCTCTGCACTTTGGG - Intergenic
1159704924 18:71674900-71674922 CTCAGTCTCCTCTGGACTTTGGG - Intergenic
1159767004 18:72502911-72502933 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1159774329 18:72585825-72585847 CTTGGCCATCTCTGGACTTTGGG - Intronic
1161261808 19:3341913-3341935 GTCTGTCATCTCAGCACTTTTGG + Intergenic
1161406342 19:4093429-4093451 ATCTGTAATCTCTGCACTTTGGG + Intronic
1161781706 19:6297488-6297510 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1162055791 19:8063180-8063202 CTCTGTCATCCCAGCACTTTGGG + Intronic
1162626775 19:11890717-11890739 ATCTGGAATCTCAGCACTTTGGG - Intronic
1162768571 19:12935314-12935336 CTCAGTAATCCCAGCACTTTGGG + Intergenic
1162991486 19:14305507-14305529 CTCACGCCTGTCAGCACTTTGGG - Intergenic
1163625166 19:18385366-18385388 GTCAGTAATCTCAGCACTTTGGG - Intronic
1164046141 19:21543790-21543812 CTCAGGCCTCCCAGCACTTTGGG + Intronic
1165371237 19:35407676-35407698 CTCATGCCTCCCAGCACTTTGGG - Intergenic
1166285747 19:41826893-41826915 CACTGTAATCTCTGCACTTTTGG - Intergenic
1166855254 19:45780055-45780077 CTCAGGCATCTCACCTCTATGGG - Exonic
1166898079 19:46036483-46036505 CTCAGGCATTCCTGCACTCTTGG + Intergenic
1167013950 19:46827460-46827482 GTCTGTCATCTCAGCACTTTGGG + Intergenic
1167325839 19:48824976-48824998 CTCACGCCTCCCAGCACTTTGGG + Intronic
1168142257 19:54396263-54396285 CTCACGCCTGTCAGCACTTTGGG + Intergenic
1168267998 19:55232655-55232677 CTCAGCCATCTCTGCCTTCTTGG - Intronic
1168665079 19:58198916-58198938 CTCACCCATCTCAGCACCTTGGG + Intronic
925048096 2:789766-789788 CCCAGGCATCTCTGCACTCTTGG + Intergenic
925515207 2:4674326-4674348 CCTGGGCATCTCTGCACTCTCGG + Intergenic
925922601 2:8647368-8647390 CTCAGGCATCTCTGCACTCTTGG + Intergenic
926161217 2:10490983-10491005 CTCAGCCAGCTCTGCACCTCTGG - Intergenic
926675804 2:15619019-15619041 CCCAGACATCTCTGCACTCGGGG - Intronic
927161514 2:20267283-20267305 CTCTGTAATCTCAGCACTTTTGG - Intronic
927401827 2:22720958-22720980 CTTAGGCAGCTCTGCCCTTGTGG + Intergenic
929092152 2:38229492-38229514 CTCACGCATCCCAGCACTTTGGG + Intergenic
930393490 2:50790373-50790395 CTCAGGCATTTCTAGATTTTGGG + Intronic
930728909 2:54709271-54709293 TCCAGGCATCTCCGCACTCTTGG + Intergenic
930946746 2:57084706-57084728 CCCAGGCATCTCTGCACTCTGGG - Intergenic
930957165 2:57217071-57217093 CCTGGGCATCTCTGCACTCTTGG + Intergenic
930957211 2:57217280-57217302 CTCAGGCTCCTCTGAACTCTGGG + Intergenic
931005912 2:57850023-57850045 CCTGGGCACCTCTGCACTTTTGG - Intergenic
931727769 2:65127991-65128013 CTCAGTAATCCCAGCACTTTGGG - Intronic
932115030 2:69038238-69038260 CTTAGCCATCTCTGCACCTTAGG + Intronic
932501699 2:72187994-72188016 CCCAGGCATCCCTTCACTCTTGG - Intronic
932644746 2:73488471-73488493 CCCAGGCACCACTGCACTTTCGG - Intronic
933046229 2:77540313-77540335 CTTGGGCATCTCTGCCTTTTTGG - Intronic
933070953 2:77857441-77857463 CTTGGGCATCTCTGCCCCTTTGG - Intergenic
933120974 2:78537759-78537781 CACTGTAATCTCTGCACTTTGGG + Intergenic
933801256 2:85961800-85961822 CCCAGGCATCACTGCACCCTTGG - Intergenic
934696630 2:96404932-96404954 CCTGGGCATCTCTGCACTCTTGG - Intergenic
934699771 2:96430221-96430243 CCTAGGCATCCCTGCACTCTTGG + Intergenic
935278012 2:101492406-101492428 CTCTTGCATCTGTGCACTTGTGG - Intergenic
935518814 2:104078532-104078554 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
935724117 2:106008047-106008069 CTCAGGCAGCTCTGCCCCTGTGG - Intergenic
935875283 2:107499513-107499535 CTCAGGCATACCTGATCTTTGGG - Intergenic
936478914 2:112867240-112867262 CGCTGGAATCTCAGCACTTTGGG - Intergenic
937164144 2:119795667-119795689 CCCAGGCATCTCTGCAATCTTGG - Intronic
938180754 2:129179624-129179646 TCCAGGCATCTTTGCACTCTTGG - Intergenic
938295989 2:130179910-130179932 GTCTGTAATCTCTGCACTTTGGG - Intronic
938950980 2:136254227-136254249 GACAGTCATCTCTGTACTTTTGG + Intergenic
939551223 2:143618346-143618368 CTCTGGCATCTCTTCCATTTGGG + Intronic
940632011 2:156252036-156252058 CTCTGTAATCTCAGCACTTTGGG + Intergenic
940935040 2:159483457-159483479 ATAAGGCATCCCAGCACTTTGGG - Intronic
941404715 2:165074441-165074463 CCCAGGCATCCCTGCACTCCTGG + Intergenic
942577455 2:177379494-177379516 CTCTGTAATCTCAGCACTTTGGG - Intronic
942585165 2:177466827-177466849 CCCAGGCATCTCTACACTCTTGG - Intronic
942868161 2:180700097-180700119 CCCAGGCATCTCTGCATTCTTGG - Intergenic
943191770 2:184686169-184686191 CCCAGGCATCCCTGCACTCTTGG - Intronic
943427091 2:187750360-187750382 CCTAGGCATCTCTGCACTCTCGG - Intergenic
943858316 2:192828000-192828022 CCCAGGTATCTTTGCACTATCGG + Intergenic
944383713 2:199141352-199141374 CTCAGGCATCCCTGCCCTCATGG + Intergenic
944483767 2:200182285-200182307 CTCAGGCATCCCTGCACTCTTGG + Intergenic
944724300 2:202454328-202454350 CCCAGTAATCTCAGCACTTTGGG - Intronic
945146908 2:206748011-206748033 CTGAAGCATCTCTTCCCTTTGGG - Intronic
945190737 2:207184913-207184935 CTCAGGGATCTCTGCACCACAGG + Intergenic
945325001 2:208471868-208471890 CTTGGGCAGCTCTGCCCTTTTGG - Intronic
945576491 2:211536513-211536535 CTCAGGCATCTCTGGACTCCAGG - Intronic
945717315 2:213374812-213374834 GTAATGCATCTCTGCATTTTTGG + Intronic
945770450 2:214035481-214035503 CTCAGCCCCCTCTGGACTTTGGG - Intronic
945887010 2:215386334-215386356 GTCAGTAATCTCAGCACTTTGGG - Intronic
946138975 2:217671943-217671965 CTCAGTTATCTCTGTACTTCTGG + Intronic
946335392 2:219032178-219032200 TTCTGGAATCTCAGCACTTTGGG - Intronic
947105204 2:226661727-226661749 CTAAGGGATCTCTGCATGTTAGG - Intergenic
947294520 2:228616059-228616081 CCCAGGCTTCTCTTTACTTTTGG - Intergenic
947407442 2:229794305-229794327 CTCAGAAATCCCAGCACTTTGGG + Intronic
948434432 2:237943705-237943727 CCCAGGCATCCGTGCACTCTTGG + Intergenic
948476173 2:238221297-238221319 CTCAGGCATCCCTGCACTCTTGG - Intergenic
948564688 2:238876450-238876472 CTCTGCCATCACTGCACCTTCGG - Intronic
948575519 2:238947134-238947156 CCTAGGCATCCCTGCACTCTTGG - Intergenic
948811240 2:240479494-240479516 TGCAGGCATTTCTGCACCTTTGG - Intronic
1168784337 20:524854-524876 CTCAGGGGTCCCTGCACTTTGGG + Intronic
1168811768 20:709493-709515 CTCGGGCTTCTCTGTACCTTAGG + Intergenic
1168983462 20:2027103-2027125 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1169309303 20:4521597-4521619 CTCAGCCCCCTCTGAACTTTGGG + Intergenic
1170043963 20:12066044-12066066 CCCAGGCATCCCTGCACTCCTGG - Intergenic
1171526965 20:25821253-25821275 GTCTGTCATCTCAGCACTTTGGG - Intronic
1171536646 20:25898680-25898702 CTCAGGCAACCCTGCACTCTTGG + Intergenic
1171549862 20:26034632-26034654 GTCTGTCATCTCAGCACTTTGGG + Intergenic
1171839585 20:30193945-30193967 CTCAGGCAACCCTGCACTCTTGG + Intergenic
1171968199 20:31546489-31546511 CTCACGCCTCCCAGCACTTTGGG + Intronic
1172346937 20:34209480-34209502 GCCAGGCATCTCTGCACTCTTGG + Intronic
1172872080 20:38142184-38142206 CCCAGGCACCTCAGCACTGTTGG + Exonic
1173138308 20:40459664-40459686 GGCAGCCCTCTCTGCACTTTGGG + Intergenic
1173207704 20:41007541-41007563 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1173294487 20:41744090-41744112 GTCTGTCATCTCAGCACTTTGGG - Intergenic
1173893788 20:46534310-46534332 CTCAGGCATCCATGCATTCTTGG + Intergenic
1174138758 20:48398448-48398470 CTCGGGCATCCCTGCACTCTTGG - Intergenic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1175960010 20:62631227-62631249 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1176104480 20:63379485-63379507 CCCAGGCATCTCTGCACTCTCGG + Intergenic
1176582419 21:8543609-8543631 CTCAGGCCTCCCTGCACTCTTGG - Intergenic
1176657651 21:9602294-9602316 CTCAGGCAGCTCTGCCCCTGTGG + Intergenic
1176790195 21:13311104-13311126 CTCAGGCATCCTTACACTCTTGG - Intergenic
1177396160 21:20538367-20538389 CTCAGGCATCCCTGTACTCTTGG - Intergenic
1177602122 21:23329137-23329159 GTCTGTAATCTCTGCACTTTGGG - Intergenic
1178937320 21:36874846-36874868 CCCAGGCATCCCTGCACTCTCGG + Intronic
1180179057 21:46109838-46109860 CCCAGGCATCGCTGCACTCTTGG - Intronic
1180265251 22:10520657-10520679 CTCAGGCCTCCCTGCACTCTTGG - Intergenic
1180973847 22:19833444-19833466 ATCTGTAATCTCTGCACTTTGGG + Intronic
1181123375 22:20687695-20687717 CTCACACATCCCAGCACTTTGGG - Intergenic
1181189795 22:21129948-21129970 CTCACGCATCCCAGCACTTTGGG + Intergenic
1181209409 22:21280557-21280579 CTCACGCATCCCAGCACTTTGGG - Intergenic
1181708061 22:24661075-24661097 CTCACGCATCCCAGCACTTTGGG + Intergenic
1181802277 22:25355422-25355444 GTCAGTCATCCCAGCACTTTGGG + Intronic
1181996404 22:26886196-26886218 GTCTGTCATCTCAGCACTTTGGG + Intergenic
1182208755 22:28655602-28655624 CTCACGCCTCCCAGCACTTTGGG + Intronic
1183707326 22:39482244-39482266 CTCTGGAATCTCTGCACTTTGGG - Intronic
1183763492 22:39847649-39847671 CTCATGCCTCTCAGCACTTTGGG - Intronic
1183821632 22:40350878-40350900 CTCAGCACTCTCAGCACTTTGGG - Intronic
1183972070 22:41485134-41485156 CTCACGGATCCCAGCACTTTGGG - Intronic
1184054487 22:42035289-42035311 CCCAGGCATCCTTGCACTCTTGG - Intronic
1184113948 22:42411281-42411303 CTCACACATCCCAGCACTTTGGG - Intronic
1184173797 22:42774740-42774762 TTCAGGCATCCCTCCACTCTTGG + Intergenic
1184311083 22:43643422-43643444 CTCTTGCATCTCTGGGCTTTGGG - Intronic
1184560999 22:45262902-45262924 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1184665630 22:45987481-45987503 CTCAGGAATTTCTGCACTCAGGG + Intergenic
1203217538 22_KI270731v1_random:14886-14908 CTCACGCATCCCAGCACTTTGGG + Intergenic
949585836 3:5435972-5435994 ATCTGTCATCTCAGCACTTTAGG - Intergenic
949914756 3:8950914-8950936 CTGAGGAATCTCTGAGCTTTAGG + Intronic
950972686 3:17204303-17204325 GTCATGCACATCTGCACTTTAGG + Intronic
951230220 3:20170137-20170159 CTCAGTAATCCCAGCACTTTGGG + Intronic
951264770 3:20552676-20552698 CTCAGCCTCCTCTGGACTTTGGG - Intergenic
951312658 3:21147882-21147904 CTCATGCCTCCCAGCACTTTGGG + Intergenic
951447555 3:22800452-22800474 CTCAGTCAACTCTGTCCTTTTGG - Intergenic
951508995 3:23480389-23480411 CCAAGGCATCCCTGCACTCTTGG - Intronic
952201764 3:31136592-31136614 CTCATGCATCTCTGGTCATTTGG + Intergenic
952375636 3:32765059-32765081 CTCATGCCTCCCAGCACTTTGGG + Intronic
952408483 3:33026349-33026371 CTCAGCCCCCTCTGGACTTTGGG + Intronic
953163680 3:40445246-40445268 CCCAGGCATCTCTGTGCTCTTGG + Intergenic
953676502 3:45006982-45007004 CTCATGCCTCCCAGCACTTTGGG - Intronic
953801940 3:46031255-46031277 TCCAGGCATCTCTGCACTGTCGG + Intergenic
953871118 3:46628538-46628560 CTCAGGCCACTCTGCACCATTGG + Intergenic
953910626 3:46891122-46891144 CTCTGGCCTCCCTGAACTTTAGG - Intronic
953950083 3:47182716-47182738 CTCTGTAATCTCAGCACTTTTGG - Intergenic
954099440 3:48358016-48358038 CTCAGGCATTCTTGCACTCTTGG - Intergenic
954123692 3:48516475-48516497 TTGAGGCTTCTCAGCACTTTTGG - Intergenic
954157039 3:48691272-48691294 CACGGGCATCTCTGCATTTGAGG - Intronic
954243764 3:49314590-49314612 CTCAGTCATCTCAGCACTGAGGG + Intronic
954497929 3:50982919-50982941 CCTGGGCATCTCTGCACTCTTGG + Intronic
954668221 3:52271832-52271854 ATCAGTCATCACAGCACTTTGGG + Intronic
955196609 3:56810282-56810304 CCCTGTCATCTCAGCACTTTGGG + Intronic
955303714 3:57809216-57809238 CCCAGGCATCCCTGCACTCTTGG + Intronic
955303759 3:57809426-57809448 CTCAGCCCACTCTGGACTTTGGG + Intronic
955545303 3:60022153-60022175 CTCAGGCCTCTCTGTGTTTTGGG - Intronic
957136377 3:76294217-76294239 TCCAGGCATCTCTGCACTCTGGG - Intronic
957426927 3:80051334-80051356 CCCAGGCATCTCTGCACTCTCGG + Intergenic
957459436 3:80497632-80497654 CTCAGACCCCTCTGGACTTTAGG - Intergenic
957486611 3:80870571-80870593 CCCAGGCATCTCTGCACTCTTGG + Intergenic
957730233 3:84125345-84125367 CCCAGGCATCTCTGCACTCTCGG + Intergenic
959037416 3:101383686-101383708 CTCAGCCCCCTCTGGACTTTGGG + Intronic
959484168 3:106908544-106908566 CCCAGGCATTCCTGCACTCTTGG + Intergenic
959863765 3:111243239-111243261 CCATGGCATCTCTGCACTCTTGG - Intronic
960247119 3:115411998-115412020 CTCTGTCATCCCAGCACTTTGGG - Intergenic
960333758 3:116392267-116392289 CTCAGGCATCTCTGCACTCTAGG + Intronic
960578681 3:119253872-119253894 GTCAGTAATCTCAGCACTTTGGG + Intergenic
960634343 3:119768534-119768556 CTCAGGCATCCCTGAACTCTTGG - Intergenic
961225380 3:125240232-125240254 GTCTGTCATCTCAGCACTTTGGG + Intronic
961493546 3:127274306-127274328 TTCAGGCATCCCTGAACTCTTGG + Intergenic
961525727 3:127496238-127496260 CCTAGGCATCTCTGCACTCTTGG + Intergenic
961943060 3:130656992-130657014 CCCAGGCATTTCTGCACTCTTGG - Intronic
963805093 3:149714536-149714558 CTCTGCCCTCTCTGGACTTTGGG + Intronic
965005574 3:163018899-163018921 CTCAGGCAGCCCTGCACTCTTGG + Intergenic
965051488 3:163655193-163655215 CCCAAGCATCCCTGCACTCTCGG - Intergenic
965087144 3:164113770-164113792 CTCAGGCATCACTGCATACTTGG + Intergenic
965117956 3:164515525-164515547 CCCGGGCATCCCTGCACTCTTGG - Intergenic
965261259 3:166489271-166489293 CCCAGGCATCCCTGCATTCTGGG + Intergenic
965272636 3:166638467-166638489 CCTAGGCATCTCTGCACTCTTGG + Intergenic
965289831 3:166865111-166865133 CCCAGGCATCTCTGCACTCTTGG + Intergenic
965715220 3:171595474-171595496 TTCAGGCATGTCTGGAGTTTAGG + Intergenic
965925105 3:173968958-173968980 CTCTGTAATCTCAGCACTTTGGG - Intronic
967649935 3:191973699-191973721 CTCAGGCATCCTTGAACTCTTGG - Intergenic
967796304 3:193602268-193602290 CTGAAGCTTCTCTGCACTGTGGG + Intronic
968221067 3:196940821-196940843 CTTAGGCATCCCAGCACTTTGGG + Intronic
968538769 4:1151579-1151601 CCCAGGCATCTCTGCACTCTAGG - Intergenic
968542186 4:1173202-1173224 CGCAGGCATCCCTGGCCTTTGGG + Intronic
968930063 4:3574020-3574042 GTCTGTCATCTCAGCACTTTGGG + Intergenic
969194086 4:5547041-5547063 CTCAGGAATCTCTGCACTCTTGG + Intronic
970357460 4:15269886-15269908 CTTAGGCAGCTCTGCACCTGTGG - Intergenic
970707600 4:18823246-18823268 CTTAGGCAGCTCTGCCCTTGTGG - Intergenic
970758079 4:19450612-19450634 CTTGGGCATCTCTGCCCTTGTGG + Intergenic
970948334 4:21722214-21722236 CTAAGCCAGCTCTGCATTTTGGG + Intronic
971043826 4:22782826-22782848 CTCACGCCTCCCAGCACTTTGGG - Intergenic
971714165 4:30153712-30153734 CTCAGCCCTCTCTGTACTTTGGG - Intergenic
972072496 4:35038725-35038747 CTCAGGCATTCCTGCAGTCTTGG + Intergenic
972158918 4:36198800-36198822 GCCAGGCATCTCTGCACTCTTGG - Intronic
972303718 4:37811462-37811484 CTCAGGTACCTCTAAACTTTGGG + Intergenic
972358367 4:38303609-38303631 CCCAGGCATCCCTGTACTCTTGG - Intergenic
972470195 4:39396564-39396586 ATCAGTAATCTCAGCACTTTGGG + Intergenic
972645737 4:40966513-40966535 CCCAGGCATCTCTGTACTCTTGG + Intronic
972931143 4:44072463-44072485 ACCAGGCATCCTTGCACTTTTGG - Intergenic
973027024 4:45284829-45284851 CTTGGGCATCCCTGCACTTATGG - Intergenic
974126115 4:57697769-57697791 ATCTGTCATCTCAGCACTTTGGG + Intergenic
974285202 4:59856112-59856134 ATCAGGCACCTCTGCACTCTTGG - Intergenic
974607608 4:64173656-64173678 CCCAGGCATCCCTGCACTCTTGG + Intergenic
974931500 4:68365789-68365811 CTTAGGCAGCTCTGCCCTTGTGG - Intergenic
975040961 4:69743889-69743911 CCCAGGCATTTCTGCAATCTAGG - Intronic
975138432 4:70896832-70896854 CTCACGCATCCCAGCATTTTAGG - Intergenic
975498262 4:75057756-75057778 CTCAGGCCCCTCTGGACTTTGGG + Intergenic
975597847 4:76066945-76066967 CTCAGGTATCCCTGCACTCTTGG - Intronic
976452799 4:85211131-85211153 CTCAGTAATCCCAGCACTTTGGG + Intergenic
976621512 4:87132951-87132973 CTGTGGCATCCCCGCACTTTGGG - Intronic
976734568 4:88296754-88296776 CCCAGGCATCCCTGCACTCTTGG - Intergenic
976805081 4:89037227-89037249 CTTGGGCATCTCTGCCCTTATGG - Intronic
977401195 4:96534747-96534769 GTCTGGAATCTCAGCACTTTGGG + Intergenic
977487411 4:97666011-97666033 CACAGACATCTCTGCACTCTTGG - Intronic
977807838 4:101323847-101323869 CTCATGCCTCCCAGCACTTTGGG + Intronic
978184088 4:105836608-105836630 CTCAGCCCCCTCTGGACTTTGGG - Intronic
978247081 4:106586406-106586428 CTCAGTAATCCCAGCACTTTGGG + Intergenic
978301106 4:107270346-107270368 CTCAACCCTCTCTGTACTTTGGG - Intronic
978492396 4:109323056-109323078 CTTAGGCAGCTCTGCCCTTGTGG + Intergenic
978663518 4:111155020-111155042 GCCAGGCGTCTCTGCACTCTTGG - Intergenic
979234337 4:118382971-118382993 CTCAAGGATCTCTGGACTCTAGG - Intergenic
979791122 4:124782311-124782333 CTCAGCCCCCTCTGCACCTTTGG - Intergenic
980180124 4:129392347-129392369 CCCAGGCCTCCCTGCACTCTTGG + Intergenic
980282223 4:130736815-130736837 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
980574460 4:134666789-134666811 ATTGGGCATCTCTGCACTCTTGG - Intergenic
980738180 4:136917799-136917821 CACAGGCATCCCTGCACTCTAGG + Intergenic
981518219 4:145633777-145633799 CTAAGCCATATCTGCATTTTGGG + Intronic
981914634 4:150020776-150020798 CTCAGGCCTCACAGCACTTTGGG + Intergenic
981945092 4:150332306-150332328 CTCAGGCATCTCTGGCCTCTGGG + Intronic
981986121 4:150858784-150858806 CTCATGCCTCCCAGCACTTTGGG - Intronic
982502880 4:156180007-156180029 CCCAGGCATCTCTACACCTGAGG + Intergenic
982854311 4:160362158-160362180 CTCAGGCAGCTCTGCCCCTGTGG + Intergenic
982957604 4:161792037-161792059 CCCAGGCATCCCTGCACCCTTGG + Intronic
983491791 4:168398098-168398120 CCCAGGCATCTCCACACTCTCGG + Intronic
983633799 4:169877561-169877583 CTCTGTAATCTCAGCACTTTGGG - Intergenic
984880956 4:184409632-184409654 CCCTGGAATCTCAGCACTTTGGG + Intronic
985228579 4:187789611-187789633 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
985417756 4:189753791-189753813 CTCAGGCAGCTCTGCCCCTGTGG - Intergenic
987480702 5:18453899-18453921 ATCAGGAATCCCAGCACTTTGGG + Intergenic
988346278 5:30041855-30041877 CCCAGGTATCCCTGCACTCTAGG + Intergenic
988394558 5:30680130-30680152 CTTGGGCAGCTCTGCACTTGTGG - Intergenic
988566016 5:32320565-32320587 CCCAGGCATCTCTGCACTTTTGG - Intergenic
988940306 5:36139098-36139120 CCCAGGCATCCCTGCACTTTCGG + Intronic
989339065 5:40354228-40354250 CCCAGCCATCTCTGCACTCCTGG + Intergenic
989520564 5:42396143-42396165 CTCGGACATCTCTGCACTCTTGG + Intergenic
989966930 5:50475551-50475573 CTCAGGCAGCTCTGCCCCTGTGG - Intergenic
991030727 5:62079690-62079712 CTTTGGCAGTTCTGCACTTTAGG - Intergenic
991486883 5:67146142-67146164 CTGAGACATCTTTGCATTTTTGG + Intronic
992029763 5:72709390-72709412 TCCAGGCATCCCTGCACTCTAGG - Intergenic
992569669 5:78042493-78042515 CTCTGTAATCTCAGCACTTTGGG - Intronic
993211349 5:84956405-84956427 CTCTGTAATCTCAGCACTTTGGG + Intergenic
993669977 5:90748266-90748288 CTGAGGCATCTCTGCCCAATAGG + Intronic
993932088 5:93953510-93953532 CTCAGGCAGCTCTGCACAAAGGG - Intronic
994020403 5:95016929-95016951 CTTAGGAATCTCTGAAGTTTTGG + Intronic
994517878 5:100793863-100793885 CCCGGGCATCCCTGCACTTTTGG + Intergenic
994692471 5:103035111-103035133 CCTAGACATCTCTGCACTGTTGG - Intergenic
994851103 5:105056819-105056841 CCCAGGCATCCCTGTGCTTTGGG + Intergenic
994851148 5:105056991-105057013 CCCAGCCATCCCTGCACTCTTGG + Intergenic
995244214 5:109918746-109918768 CTCAGGCAGCTCTGCCCCTGTGG - Intergenic
995745024 5:115394021-115394043 CTCAGGCATCCCTGCACTCTTGG - Intergenic
996520120 5:124416589-124416611 CTAAGGCATCTCTGCAGTGCTGG + Intergenic
997887096 5:137639753-137639775 CTCAAGCATCTGTGCATTTCAGG - Intronic
997929605 5:138061392-138061414 CTCATGCCTCCCAGCACTTTGGG + Intergenic
997956747 5:138284648-138284670 CTCAGTAATCCCAGCACTTTGGG - Intergenic
998420583 5:141981602-141981624 CTCTGTAATCTCAGCACTTTGGG + Intronic
998480587 5:142459481-142459503 CTCAGCCTCCTCTGGACTTTGGG - Intergenic
998480623 5:142459676-142459698 CCTGGGCATCTCTGCACTTTTGG - Intergenic
998519295 5:142785187-142785209 CTAAGGAATCCCGGCACTTTGGG - Intronic
999146137 5:149396494-149396516 CTCTGTCATTTCAGCACTTTAGG + Intronic
999222476 5:149991968-149991990 CTCACACATCCCAGCACTTTGGG - Intronic
1000426145 5:161093530-161093552 CTCAGGCATCCCTGCACCCTTGG + Intergenic
1001879518 5:175231197-175231219 CTCACGCCTCCCAGCACTTTGGG - Intergenic
1002072463 5:176688345-176688367 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1002223952 5:177704738-177704760 CTCATGCCTCTGAGCACTTTGGG + Intergenic
1002986105 6:2191488-2191510 CCCGGGCCTCTCTGCACTCTTGG + Intronic
1003293193 6:4799695-4799717 CTCTGTAATCTCAGCACTTTGGG - Intronic
1003878991 6:10463398-10463420 CTCACGCCTCCCAGCACTTTGGG + Intergenic
1004076803 6:12351279-12351301 CTTAGGCATCTCTGCCCCTGTGG + Intergenic
1004720948 6:18266639-18266661 CCCAGCCATCCCTGCACTCTTGG - Intergenic
1005513158 6:26530258-26530280 CTCTGTAATCTCAGCACTTTGGG - Intergenic
1005781834 6:29201159-29201181 CCCGGGCATCTCTGCACTCTTGG + Intergenic
1006796635 6:36736245-36736267 CCCAAGCTTCTCTGCACTTTGGG - Intergenic
1007071617 6:39042244-39042266 CTCAGACATCCCTGGACTTGTGG - Intergenic
1007322974 6:41040533-41040555 CTCTACCATCTCTGCACTTTGGG - Intronic
1007649847 6:43412667-43412689 CCCAGGCATCTCTGTGCTCTTGG + Intergenic
1007766734 6:44165146-44165168 CTCTGTAATCTCAGCACTTTTGG - Intronic
1009241797 6:61193859-61193881 CTCAGGCATCTCTGCACTCTCGG - Intergenic
1009534358 6:64861226-64861248 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1009534399 6:64861431-64861453 CCCGGGCATCTCTGCACTCTCGG - Intronic
1009588535 6:65637562-65637584 CTCTAGCATCACTGCACTCTTGG + Intronic
1009684246 6:66936132-66936154 CTCTGGCCTCTCTGCACTCCTGG + Intergenic
1009705577 6:67246418-67246440 ATCAGGCATTTTTGCACTTTGGG - Intergenic
1009769090 6:68121726-68121748 CTCAGGCAGCTCTGCCCTTGTGG + Intergenic
1010411788 6:75569067-75569089 CTCTGGGATCTCTGACCTTTAGG - Intergenic
1010519612 6:76817566-76817588 CCTAGGCATCTCTGCATTCTCGG + Intergenic
1010559564 6:77333196-77333218 CCCAGGCATTCCTGCACTCTCGG + Intergenic
1010654163 6:78492149-78492171 ATCTGGCATCTCTGAACTTCAGG - Intergenic
1010851313 6:80781621-80781643 CTCAAGGATCTCTCCAGTTTGGG + Intergenic
1011530225 6:88312853-88312875 CTCAGATATCCCTGCACTCTTGG - Intergenic
1011930249 6:92701811-92701833 CCCAGACATCCCTGCACTCTTGG - Intergenic
1014227253 6:118862192-118862214 CCTAGGCATCCCTGCACTCTTGG - Intronic
1014563076 6:122914253-122914275 CTCAGGCAGCTCTGTCCCTTTGG - Intergenic
1014770383 6:125452991-125453013 CCCAGGCATCTCTGCATTCTTGG + Intergenic
1016190641 6:141260939-141260961 CTCAGGCATTCCTGCACTCTTGG + Intergenic
1016199902 6:141394643-141394665 CCCAGGCATTTCTGCACTCCAGG + Intergenic
1016210786 6:141531355-141531377 CTCAGGCCTCTCCAGACTTTGGG + Intergenic
1017319894 6:153078131-153078153 CTCAGTAATCCCAGCACTTTGGG - Intronic
1017403977 6:154096317-154096339 GTCTGGAATCTCAGCACTTTGGG - Intronic
1017420578 6:154268254-154268276 CTCAGGCATCACTGCACTCTTGG - Intronic
1017472695 6:154755508-154755530 GTCAGGCATCCCAGCACTTTGGG - Intronic
1017478303 6:154822857-154822879 CCCAGAAATCTCTGCCCTTTTGG + Intronic
1017486235 6:154904053-154904075 CGCCTGCATCTCAGCACTTTGGG - Intronic
1018000687 6:159576081-159576103 GTCTGTCATCTCAGCACTTTGGG - Intergenic
1018069531 6:160150927-160150949 CTCAGCCATCTTTGCACTCCTGG - Intronic
1018291849 6:162299171-162299193 ATCAGGCATCTCAGCCCCTTCGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018802517 6:167235433-167235455 CTCTGGCATCCCTGCACTCTTGG - Intergenic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019897994 7:3997982-3998004 CTCAGGCATTCTTGCACTCTTGG - Intronic
1020208333 7:6137615-6137637 GTCTGTAATCTCTGCACTTTGGG - Intronic
1020394888 7:7703678-7703700 CGCAGACATCTCAGCACTTTGGG + Intronic
1020421753 7:8014254-8014276 ATCTGTCATCTCAGCACTTTGGG - Intronic
1020586666 7:10078613-10078635 CCTAGGCATCTCTGCACTCTTGG + Intergenic
1020761150 7:12269486-12269508 CCTAGGCACCTCTGCACTCTTGG + Intergenic
1021014073 7:15510435-15510457 GTCAGTAATCTCAGCACTTTGGG - Intronic
1021500872 7:21330453-21330475 CCCAGGCATATCTGCACTCTTGG - Intergenic
1022393993 7:29969321-29969343 CTCCCACATCACTGCACTTTTGG - Intronic
1022423505 7:30246216-30246238 CTCAGCCCCCTCTGAACTTTGGG - Intergenic
1022553715 7:31270129-31270151 CTCTGTAATCTCAGCACTTTGGG - Intergenic
1022742587 7:33137330-33137352 CCCAAGCATCCCTGCACTGTCGG - Intronic
1023053331 7:36272303-36272325 ATCACTCATCTCTGCCCTTTAGG - Intronic
1023394924 7:39743817-39743839 CTCAGGAATGTCTTCATTTTGGG - Intergenic
1024093540 7:45967097-45967119 AAAAGGAATCTCTGCACTTTGGG + Intergenic
1024335378 7:48201460-48201482 GTCTGGCATCCCAGCACTTTGGG + Intronic
1024857129 7:53794923-53794945 CCCAGGCATCCCTGCATTCTTGG - Intergenic
1025608435 7:63056138-63056160 CTCATGAATCCCAGCACTTTGGG - Intergenic
1026766490 7:73163240-73163262 CTCACGCCTCCCAGCACTTTGGG - Intergenic
1026843554 7:73684279-73684301 CTCAGCAATCGCAGCACTTTGGG + Intronic
1027042965 7:74972935-74972957 CTCACGCCTCCCAGCACTTTGGG - Intronic
1027080678 7:75229421-75229443 CTCACGCCTCCCAGCACTTTGGG + Intergenic
1027144393 7:75684017-75684039 CTCACGCATCCCAGCACTTTGGG + Intronic
1028191033 7:87852319-87852341 CGCCGGTATCTCAGCACTTTGGG + Intronic
1028212031 7:88085373-88085395 CTCAGGTGTCTTTGAACTTTTGG + Intronic
1028527505 7:91801768-91801790 CCTGGGCATCTCTGCACTCTCGG - Intronic
1028816953 7:95157264-95157286 CCCAGGTATCCCTGCACTCTGGG - Intronic
1029244517 7:99189384-99189406 CTCAGGCCTGTCATCACTTTGGG - Intronic
1029327550 7:99823144-99823166 CTCAGGCATCCCTGCACTCTTGG + Intergenic
1029389881 7:100268031-100268053 CTCACGCCTCCCAGCACTTTGGG + Intronic
1029391514 7:100277901-100277923 GTCTGTAATCTCTGCACTTTGGG + Intergenic
1029899205 7:104022053-104022075 CCCAGGCATCTCTGCACTCTGGG + Intergenic
1029973872 7:104814939-104814961 CCCAGGCATCCCTGCACTACTGG - Intronic
1030359404 7:108579585-108579607 CTCAGTCCTCACTGGACTTTGGG + Intergenic
1030514159 7:110519832-110519854 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1030570190 7:111213086-111213108 CCCAGGCATTTCTACACTCTTGG + Intronic
1030910773 7:115246282-115246304 CTCAGGCATCCCTGCTCCTATGG + Intergenic
1031249073 7:119356792-119356814 CTTAGGCAGCTCTGCTCCTTTGG + Intergenic
1031275178 7:119712394-119712416 CTTAGGCAGCTCTGCACTTGTGG + Intergenic
1031407715 7:121406222-121406244 CTCAGTAATCCCAGCACTTTGGG + Intergenic
1031743834 7:125468582-125468604 CACAGGCATCCACGCACTTTTGG - Intergenic
1031837127 7:126691410-126691432 CTCAGGCATCTCTGCACTTTTGG - Intronic
1031859042 7:126957662-126957684 CTCAGCCCCCTCTGGACTTTGGG + Intronic
1032227032 7:130040544-130040566 CCCTGTAATCTCTGCACTTTAGG + Intronic
1032238923 7:130146509-130146531 GTCTGTAATCTCTGCACTTTGGG - Intergenic
1032340762 7:131070730-131070752 ATGAGGTATCTCAGCACTTTGGG + Intergenic
1032522427 7:132555949-132555971 TCCAGGCATCTCTGCCCTTTGGG + Intronic
1033515051 7:142097194-142097216 GTCTGTCATCTCAGCACTTTGGG - Intronic
1034101905 7:148457639-148457661 CTCCGGCATCCCTGCACTCTTGG - Intergenic
1034999005 7:155596454-155596476 CCCAGGCATCTCTGCAATCAAGG - Intergenic
1035252453 7:157606084-157606106 CTCAGCCCCCTCTGGACTTTGGG - Intronic
1035720612 8:1788638-1788660 ATCTGTCATCCCTGCACTTTGGG + Intergenic
1036828235 8:11996510-11996532 CTCAGGCCTCCATGTACTTTTGG - Intergenic
1037118765 8:15257830-15257852 CTAATGCATTTCTGCATTTTTGG + Intergenic
1037150187 8:15626779-15626801 CTCAGTCCCCTCTGGACTTTCGG + Intronic
1039568810 8:38570260-38570282 CCCAGGCATCTCTCTACTTCTGG + Intergenic
1039895734 8:41715239-41715261 GGCAGGCATCCCTGCACTTACGG + Intronic
1040685390 8:49865545-49865567 CTCAAGCATCTCTCCATGTTTGG + Intergenic
1041146092 8:54877386-54877408 CTCAGTAATCCCAGCACTTTGGG - Intergenic
1041205554 8:55495079-55495101 CTCAGCCCGCTCTGGACTTTGGG - Intronic
1041205594 8:55495298-55495320 CCCAGGCATCTCTGTGCTCTTGG - Intronic
1041357374 8:57014601-57014623 CCCAGGCATGCCTGCACTCTTGG - Intergenic
1042057052 8:64775384-64775406 CTCAGGTTTCTCGGCATTTTGGG + Intronic
1042196901 8:66238569-66238591 CCCAGGCATCCCTGCACTCTTGG - Intergenic
1042337132 8:67640532-67640554 CCCAGGCATCTCTACACTCCTGG - Intronic
1042358769 8:67858480-67858502 CTCAGACATAGCTGCAATTTTGG + Intergenic
1042548348 8:69971189-69971211 CTCTGTAATCCCTGCACTTTGGG - Intergenic
1043036961 8:75210626-75210648 CTCAGGCATCTATGCCCCTGTGG + Intergenic
1043082644 8:75785011-75785033 CCCAGTCAACTCTGCACTCTCGG - Intergenic
1043087264 8:75849882-75849904 CCCAGACATCTCTGCACTCTTGG - Intergenic
1043195429 8:77287060-77287082 CCCAAGCATCTCTGCACTCTTGG + Intergenic
1043708095 8:83378418-83378440 CTCAGCCTCCTCTGGACTTTGGG - Intergenic
1043750404 8:83926854-83926876 CTCAGGCATCTCTGTGCTCTTGG - Intergenic
1043756149 8:84005949-84005971 CCCAGGCATTCCTGCACTCTTGG - Intergenic
1043956500 8:86366088-86366110 CTCCGGCATCCCTTCACTGTAGG - Intronic
1044323785 8:90837127-90837149 CCCAGGCATCTCTGGCTTTTTGG - Intronic
1044409441 8:91867763-91867785 ACCAGGCATCTCTGCACTCTCGG + Intergenic
1044409485 8:91867972-91867994 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1044525055 8:93242040-93242062 CCCAGGCATCTCTACAATCTTGG - Intergenic
1044538561 8:93384784-93384806 CTCACACATCCCAGCACTTTAGG + Intergenic
1044775008 8:95678431-95678453 CTCAGCCAGCTCTGGACTTCTGG - Intergenic
1045480945 8:102591660-102591682 CTCTGTAATCTCAGCACTTTGGG + Intergenic
1045856144 8:106767833-106767855 CTCATGCATCCCAGGACTTTGGG + Intronic
1045887994 8:107122801-107122823 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1045996934 8:108374017-108374039 ATCTGTAATCTCTGCACTTTGGG + Intronic
1046395327 8:113633001-113633023 CTCAGCCACCTCTGGATTTTGGG - Intergenic
1046407383 8:113791342-113791364 CCCAGGCATCTCTGCACTCTTGG - Intergenic
1046459798 8:114518370-114518392 CTGAGGCATCCCTGCACTCTTGG - Intergenic
1046503806 8:115111721-115111743 CTCAGCCCCCTCTGGACTTTGGG - Intergenic
1047213054 8:122855094-122855116 CTCTGGCCTCTGTGCACTGTGGG + Intronic
1047407536 8:124597869-124597891 CTCAGGCATCTCTGCAGGAGAGG + Intronic
1047544000 8:125797728-125797750 CTCAGCCCTCTCTGGACTTTGGG - Intergenic
1048238442 8:132716125-132716147 CCCAGGCATCCCTGCACTCTTGG + Intronic
1048421804 8:134284520-134284542 CTCAGGCATCTCTGCACTCTTGG - Intergenic
1048505620 8:135018370-135018392 CTTATGCATCTCTGCATTTATGG - Intergenic
1049332695 8:142063636-142063658 CTCAGCCCTGTCTGCACTTGGGG - Intergenic
1050011402 9:1189020-1189042 CTCATGCCTCCCAGCACTTTGGG - Intergenic
1050138020 9:2488392-2488414 CTCAGTAATCCCGGCACTTTGGG + Intergenic
1050182234 9:2934037-2934059 CCCAGGCATCTCTGCGCTCTTGG + Intergenic
1050483886 9:6114243-6114265 CCCAGGCATCCCTGCACTTTTGG + Intergenic
1050947860 9:11549372-11549394 CCCAGGCATCCATGCACTCTCGG + Intergenic
1051473932 9:17481581-17481603 CTCAGGCAGGGCTGCACATTGGG - Intronic
1052597261 9:30575703-30575725 TTCTGGCATCTCTGAGCTTTTGG + Intergenic
1052691396 9:31820777-31820799 CTCAAGCCCCTCTGGACTTTGGG + Intergenic
1052707465 9:32010711-32010733 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1053128087 9:35599109-35599131 CTCAGGAATCCCTGCCCTCTTGG + Intergenic
1053444974 9:38145920-38145942 CCCAGGCCTCTCTGCACTCTAGG + Intergenic
1053877393 9:42558324-42558346 CCCAGGAATCTCTGTACTCTTGG - Intergenic
1054234302 9:62543398-62543420 CCCAGGAATCTCTGTACTCTTGG + Intergenic
1054460017 9:65457762-65457784 GTCTGTCATCTCAGCACTTTGGG - Intergenic
1055265636 9:74493122-74493144 GTCTGTCATCTCAGCACTTTCGG + Intergenic
1055532451 9:77198519-77198541 CCCAGGTATCTTTGCTCTTTTGG + Intronic
1055880033 9:80989820-80989842 CTCAGGCTACTCTCCACTTAGGG + Intergenic
1055936027 9:81605004-81605026 CTCAGCCTTCTCTGCCCTTGGGG - Intronic
1056327990 9:85496964-85496986 CTCAGCAATCCCAGCACTTTGGG + Intergenic
1056986041 9:91364390-91364412 CCCAGGCATCCCTGCACTCTTGG + Intergenic
1057467919 9:95332433-95332455 GCCAGTCATCTCAGCACTTTGGG - Intergenic
1057468436 9:95337262-95337284 ACCAGGCATCCCTGCACTCTTGG + Intergenic
1057950624 9:99366488-99366510 CTCAGGCTTCTCTGCAGCATGGG - Intergenic
1059067963 9:111104838-111104860 CACAGTAATCTCAGCACTTTGGG - Intergenic
1059083518 9:111275085-111275107 CTCAGGCAGCTCAAAACTTTTGG - Intergenic
1059172882 9:112143243-112143265 CTCTGTAATCTCAGCACTTTGGG - Intronic
1059183817 9:112246240-112246262 ATCTGTAATCTCTGCACTTTGGG - Intronic
1060180022 9:121527524-121527546 CCCAGGCATTTCTGTACTCTCGG + Intergenic
1060332105 9:122682620-122682642 CCCAGGTTTCTCTGGACTTTGGG + Intergenic
1061093760 9:128442266-128442288 CTCAGGAAACTCTGCAGTTTGGG - Intergenic
1061621964 9:131816391-131816413 CTCAAGCCTCTCTGCACTCTAGG + Intergenic
1061677530 9:132226815-132226837 CTCTGACATCTCTGCCCTCTCGG + Intronic
1061800438 9:133110664-133110686 ATCAGTCATCCCGGCACTTTGGG + Intronic
1061804554 9:133130892-133130914 CCCTGGCATCTCTGGGCTTTGGG - Intronic
1062032215 9:134366792-134366814 CCCAGGCATCTGTGGACCTTAGG - Intronic
1062510581 9:136903208-136903230 GCCAGGAATCTCAGCACTTTGGG - Intronic
1203612433 Un_KI270749v1:21623-21645 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1203635379 Un_KI270750v1:105868-105890 CTCAGGCAGCTCTGCCCCTGTGG + Intergenic
1185512640 X:674872-674894 GTCTGTCATCTCAGCACTTTGGG - Intergenic
1185525357 X:774212-774234 CACGGTCATCTCTGCTCTTTTGG + Intergenic
1185563373 X:1077774-1077796 GCCAGTCATCTCAGCACTTTGGG + Intergenic
1186344699 X:8679899-8679921 CTCAGTAATCCCAGCACTTTGGG + Intronic
1186467696 X:9796902-9796924 ATCAGTAATCTCAGCACTTTCGG - Intronic
1186954680 X:14669226-14669248 CTCAGGCAGCTCTGCCCCTGTGG + Intronic
1188207681 X:27380458-27380480 CCCAGGCATCTCTGCATTCTTGG + Intergenic
1188756407 X:33969007-33969029 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1188832276 X:34913678-34913700 CTCACGCCTCTCAGCACTTTGGG + Intergenic
1189010971 X:37045444-37045466 CTCTGTAATCTCAGCACTTTGGG + Intergenic
1189856464 X:45229447-45229469 GCCAGGCATCTCTGCACTCTCGG - Intergenic
1190114087 X:47614355-47614377 CTCAGGGATCTCTGCAGGATGGG + Intronic
1190304625 X:49074971-49074993 CTCAGGCATCTCAGGACCTAGGG + Intronic
1190369405 X:49726900-49726922 TGCAGGCATCTATGCACTCTTGG + Intergenic
1190621053 X:52287572-52287594 CTCAGGCCCCTCTGGACTTTGGG + Intergenic
1192244876 X:69363709-69363731 CCCAGGCATCTCTGCCCCCTGGG - Intergenic
1192463609 X:71339314-71339336 CTCAATAATCTCAGCACTTTGGG + Intergenic
1193108557 X:77704860-77704882 CCCAGGTGTCTCTGCACTCTTGG - Intronic
1193224966 X:78971788-78971810 CTTGGGCATCTCTGCACCTGTGG + Intergenic
1193460491 X:81786201-81786223 CTTGGGCAGCTCTGCCCTTTTGG + Intergenic
1194409785 X:93543639-93543661 CTTGGGCATCTCTGCTCCTTTGG + Intergenic
1195126417 X:101813453-101813475 CGCAGGCATCTCTGCACTCTTGG + Intergenic
1195179163 X:102339883-102339905 CGCAGGCATCTCTGCACTCGGGG - Intergenic
1195348363 X:103974093-103974115 CTCAGCTATTTCTGCACTGTGGG + Intergenic
1195359079 X:104064748-104064770 CTCAGCTATTTCTGCACTGTGGG - Intergenic
1195992178 X:110693612-110693634 CTCATGCCTCACAGCACTTTGGG - Intronic
1196385744 X:115147789-115147811 GTCAGTAATCTCAGCACTTTGGG + Intronic
1196894120 X:120317406-120317428 ATCAAGCACCTCTGCAGTTTTGG - Intergenic
1197155863 X:123269620-123269642 CTCAGACATCTCTGTGGTTTAGG + Intronic
1197342107 X:125287163-125287185 CCCAGGCATCTCTGCACTCTTGG + Intergenic
1197366721 X:125572726-125572748 CTTGGGCATCTCTGCCCTTGTGG + Intergenic
1197609641 X:128623654-128623676 CCTGGGCATCTCTGCACTCTTGG - Intergenic
1198189430 X:134287876-134287898 CTCAGCCCCCTCTGGACTTTGGG + Intergenic
1199360093 X:146907470-146907492 CTCAGGCATCTCTGCACTCTTGG - Intergenic
1199861170 X:151801462-151801484 CTCAGGCATCCCTGCACTCTTGG - Intergenic
1201488804 Y:14519828-14519850 GCCTGGAATCTCTGCACTTTGGG - Intergenic
1201699742 Y:16867491-16867513 ATCTGTAATCTCTGCACTTTGGG - Intergenic
1202079597 Y:21071082-21071104 TCTACGCATCTCTGCACTTTTGG + Intergenic
1202079613 Y:21071158-21071180 CTCTGGCCTCTCCACACTTTTGG + Intergenic
1202247395 Y:22833892-22833914 CTCAGACATGCCTGCACTTAGGG - Intergenic
1202400383 Y:24467640-24467662 CTCAGACATGCCTGCACTTAGGG - Intergenic
1202470397 Y:25202446-25202468 CTCAGACATGCCTGCACTTAGGG + Intergenic