ID: 1031841715

View in Genome Browser
Species Human (GRCh38)
Location 7:126749881-126749903
Sequence TTGCTGTTAGTGATGCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1339
Summary {0: 1, 1: 0, 2: 6, 3: 195, 4: 1137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031841715 Original CRISPR TTGCTGTTAGTGATGCAAAA TGG Intronic
902102589 1:14004264-14004286 TTGCTGATAGTGGTGTAAATTGG + Intergenic
902133451 1:14283630-14283652 TTGCTGGTGGGAATGCAAAATGG + Intergenic
902673138 1:17989279-17989301 TTGCTGGTGGAAATGCAAAATGG - Intergenic
903644327 1:24884849-24884871 TTGCTGGTGGGGATGTAAAATGG - Intergenic
903689826 1:25165469-25165491 TTGCTGGTGGGGATGTAAAATGG + Intergenic
903727916 1:25465396-25465418 TTGCTGGTGGGAATGCAAAATGG - Intronic
903819488 1:26090829-26090851 TTGCTGGTGGGAATGCAAAATGG + Intergenic
904067796 1:27768128-27768150 TTGCTGGTGGGGATGCAAAATGG - Intergenic
904406436 1:30292558-30292580 TTGCTGGTGGGAATGCAAAATGG + Intergenic
904551246 1:31320882-31320904 TTGCTGGTAGGAATGTAAAATGG - Intronic
904802960 1:33108970-33108992 TTGCTGGTGGGAATGCAAAATGG - Intronic
905261180 1:36720479-36720501 TTGCTGGTGGAAATGCAAAATGG - Intergenic
905407525 1:37745424-37745446 TTGCAGGTAGGAATGCAAAATGG + Intronic
905505895 1:38479188-38479210 TTGCTGATGGAGATGTAAAATGG + Intergenic
905628101 1:39501851-39501873 TTGCTGGCAGGAATGCAAAATGG - Intronic
905663534 1:39747400-39747422 TTGCTGGTAGAAATGTAAAATGG - Intronic
905700162 1:40006775-40006797 TTGATGGTAGGGATGTAAAATGG + Intergenic
905700504 1:40009575-40009597 TTGATGGTAGGGATGTAAAATGG - Intergenic
905836686 1:41129932-41129954 TTGCTGGTAGGAATGTAAAATGG - Intronic
906417605 1:45633052-45633074 TTGCTGGTGGGAATGCAAAATGG + Intronic
906420984 1:45666614-45666636 TTGCTGGTAGAAATGTAAAATGG + Intronic
906569330 1:46822766-46822788 GTGCTGTTGGTGAAGCATAATGG - Intergenic
906971836 1:50523361-50523383 TTGCTGATTGGGATGTAAAATGG - Intronic
907170193 1:52455836-52455858 TTGCTGGTAGAAATGCAAACTGG + Intronic
907629972 1:56070777-56070799 TTACTGTTTGTGATGGGAAAAGG - Intergenic
908026888 1:59961515-59961537 TTGCTGGTAGGAATGAAAAATGG + Intergenic
908223033 1:62027564-62027586 TTGTTGGTAGGGATGTAAAATGG - Intronic
908282415 1:62554510-62554532 TTGATTTTAGTCAGGCAAAAAGG - Intronic
908699129 1:66879630-66879652 TTGCTGGTGGGGATGCACAATGG - Intronic
909619565 1:77652486-77652508 TTGCTGGTAGGAATGCAAAATGG + Intronic
909699480 1:78506130-78506152 TTGCTGTTAGGAATGGAAAATGG - Intronic
910307471 1:85782604-85782626 TTGTTGTCAATAATGCAAAAAGG - Intronic
910403361 1:86858692-86858714 TTGCTGGTGGGAATGCAAAATGG + Intergenic
910661789 1:89681368-89681390 TTAATGTTTTTGATGCAAAAAGG - Intronic
910681259 1:89867711-89867733 TTGCTGGTGGGAATGCAAAATGG - Intronic
910704119 1:90108370-90108392 TTCCTTTTAAAGATGCAAAAAGG - Intergenic
910946918 1:92603243-92603265 TTGCTGGTAGAAATGTAAAATGG + Intronic
911128342 1:94362876-94362898 TTGCTGGTGGTGATGTAAAATGG - Intergenic
911215622 1:95189957-95189979 TTGCTGCTAGGAATGCAAAATGG - Intronic
911295839 1:96113945-96113967 TTGCTGGTGGGAATGCAAAATGG + Intergenic
912141357 1:106732730-106732752 TTGCTGGTGGGAATGCAAAATGG + Intergenic
912923195 1:113889106-113889128 TTGCTGGTAGGAATGCAAAATGG + Intergenic
913499477 1:119458176-119458198 TTGCTGGTGGGGATGCAAAATGG + Intergenic
913503497 1:119494057-119494079 TTGCTGGTGGGGATGCAAAATGG + Intergenic
913507372 1:119529876-119529898 TTGCTGGTGGGGATGCAAAATGG + Intergenic
913514561 1:119592704-119592726 TTGCTGGTGGGGATGCAAAATGG + Intergenic
914404049 1:147352471-147352493 TTGCTGTTGGGAATGTAAAATGG - Intergenic
914414118 1:147462557-147462579 TTGTTGTTGGGGGTGCAAAATGG - Intergenic
914785692 1:150827776-150827798 TTGCTGATAGACATGTAAAATGG - Intronic
914991450 1:152502643-152502665 TTACAGTCAGTGATGCAAATAGG - Intergenic
915238788 1:154504467-154504489 TTGCTGGTAGGAATGTAAAATGG - Intronic
916514651 1:165504597-165504619 TTGCTGGTGGGGATGTAAAATGG + Intergenic
916554171 1:165878915-165878937 TTGCTGGTAGGGCTGCAAAATGG - Intronic
916775402 1:167957729-167957751 TTGCTGTCAGAAATGTAAAATGG - Intronic
917466363 1:175280371-175280393 TTGCTGGTGGGAATGCAAAATGG + Intergenic
917564508 1:176199012-176199034 TTGCTGGTAGAAATGCAAAATGG + Intronic
917756701 1:178108054-178108076 TTGCTGGTAAGGATGTAAAAGGG - Intronic
917762984 1:178183903-178183925 TTGCTGGTAAGAATGCAAAATGG - Intronic
917836948 1:178948612-178948634 TTGCTGGTGGGAATGCAAAATGG + Intergenic
917850239 1:179056734-179056756 TTGCTGGTGGGAATGCAAAATGG - Intronic
918025299 1:180738357-180738379 TTGCTGGTGGGAATGCAAAATGG - Intronic
918461398 1:184780698-184780720 TTGCTGGTGGAGATGCGAAATGG - Intergenic
918707892 1:187691060-187691082 TTGCTGGTGGGAATGCAAAATGG + Intergenic
918876479 1:190051944-190051966 TTGCTGGTTGTAATGCAAAATGG - Intergenic
918928762 1:190824910-190824932 TTGCTGGTGGAGATGCAAAATGG + Intergenic
919071302 1:192758613-192758635 TTGCTGTTAGGAATGCAAAATGG - Intergenic
919420116 1:197359696-197359718 TTGCTGGTGGGAATGCAAAATGG - Intronic
919836381 1:201576731-201576753 TTGCTGGTAGAAATGTAAAATGG - Intergenic
920245850 1:204586905-204586927 TTTCTGGTGGGGATGCAAAATGG - Intergenic
920289548 1:204909182-204909204 TTGCTGGTAGAAATGTAAAATGG - Intronic
920617479 1:207507665-207507687 TTGCTGGTAGGAATGCAAAATGG + Intronic
920626083 1:207601515-207601537 TTGCTGATGGGGATGTAAAATGG - Intronic
920633863 1:207679484-207679506 TTGCTGGTAGGAATGCAAAATGG + Intronic
920985122 1:210881409-210881431 TTGCTGGTGGGAATGCAAAATGG + Intronic
921014914 1:211180521-211180543 TTGCTGGTAGGAATGCAAAATGG - Intergenic
921093070 1:211861566-211861588 TTGCTGATAGGAATGCAAAGTGG - Intergenic
921150917 1:212402262-212402284 TTGCTGATAGGAATGTAAAATGG - Intronic
921587774 1:216967841-216967863 TTACTGATAGGAATGCAAAATGG - Intronic
921627245 1:217390405-217390427 TTGCTGGTAGGAATGCAACATGG + Intergenic
922069843 1:222181085-222181107 CTGCTGGTAGGAATGCAAAATGG + Intergenic
922475243 1:225902485-225902507 TTGCTGGTGGGTATGCAAAATGG + Intronic
922656069 1:227384892-227384914 TTGCTGGTAGGAATGCAAAATGG + Intergenic
922704891 1:227785319-227785341 TTGCTGGTGGAAATGCAAAATGG + Intergenic
922860596 1:228812426-228812448 TTGCTGGTAGAAATGAAAAATGG + Intergenic
923181570 1:231525299-231525321 TTGCTGGTAGGAATGTAAAATGG - Intergenic
923417138 1:233774042-233774064 TTGCTGGTGGAGATGCAAAGTGG - Intergenic
923428982 1:233902287-233902309 TTGCTGGTGGGAATGCAAAATGG - Intergenic
923758872 1:236820750-236820772 CTGCTGGTAGGAATGCAAAATGG - Intronic
924204056 1:241692953-241692975 TTGCTGATGGGAATGCAAAATGG + Intronic
924214451 1:241806167-241806189 TTGCTGCTGGGAATGCAAAATGG + Intergenic
924664348 1:246055239-246055261 TTACTGGTAGGAATGCAAAACGG + Intronic
1062776909 10:158321-158343 TTGCTGGTGGTAATGTAAAATGG - Intronic
1063078214 10:2737939-2737961 TTACTGTTGGTTTTGCAAAAGGG - Intergenic
1063361715 10:5464750-5464772 CTGCTGGTAGGAATGCAAAATGG + Intergenic
1063807463 10:9662054-9662076 TTGCTGGTGGGAATGCAAAAGGG - Intergenic
1063829683 10:9937709-9937731 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1063946739 10:11183541-11183563 TTGCTGGTAGGAATGTAAAATGG - Intronic
1064184542 10:13150023-13150045 TTGCTGGTGGATATGCAAAATGG + Intergenic
1064219629 10:13429657-13429679 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1064319911 10:14295409-14295431 TTGCTGGTTGAGATGCAAAGAGG + Intronic
1064945594 10:20784908-20784930 TTCCTATTATTGAAGCAAAAAGG - Exonic
1064999939 10:21329263-21329285 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1065067248 10:21982783-21982805 TTGCTGGTAGGAATGTAAAATGG + Intronic
1065104315 10:22365958-22365980 TTGCTGGTAGGAATGTAAAATGG + Intronic
1065372781 10:25006729-25006751 TAGATGTTACTGAAGCAAAAAGG + Intronic
1065419375 10:25525171-25525193 TTGCTGGTAGGAATGTAAAATGG + Intronic
1065505214 10:26423553-26423575 TTGTTGGTGGGGATGCAAAATGG + Intergenic
1065806973 10:29402785-29402807 TTGCTGGAAGGAATGCAAAATGG + Intergenic
1065954381 10:30679752-30679774 TTGCTGGTGGAGATGCAAAATGG - Intergenic
1066080275 10:31924095-31924117 TTGCTGGTGGAAATGCAAAATGG + Intronic
1066184082 10:32991999-32992021 TTGCTGGTAGGAATACAAAATGG - Intronic
1066378239 10:34878868-34878890 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1066518759 10:36193241-36193263 TTGCTGATGGGAATGCAAAATGG - Intergenic
1067744100 10:48921859-48921881 TTGCTGATGGGAATGCAAAATGG + Intronic
1067826671 10:49579079-49579101 TTGCAGGTAGGGATGCAACATGG - Intergenic
1068382442 10:56274253-56274275 TTGCTGATGGCAATGCAAAATGG + Intergenic
1068869904 10:61931895-61931917 TTGCTGTTGGGAATGTAAAATGG + Intronic
1068906340 10:62328252-62328274 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1069058599 10:63870364-63870386 TTGCTGGTAGGAATGCAAACTGG - Intergenic
1069299498 10:66888761-66888783 TTGCTGCTGGGGATACAAAATGG + Intronic
1069346338 10:67474817-67474839 TTGCTGCTGGGAATGCAAAAAGG + Intronic
1071058073 10:81534335-81534357 TTTCTGATAGTGTTGAAAAATGG + Intergenic
1071081121 10:81812537-81812559 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1071171540 10:82870532-82870554 TTGCTGGTGGGAATGCAAAATGG - Intronic
1071253821 10:83848688-83848710 TTGCTGGTAGAAATGCAAAATGG + Intergenic
1071306295 10:84302013-84302035 ATGCTGTTTGTGATGGACAATGG - Intergenic
1071406554 10:85339836-85339858 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1071542220 10:86496332-86496354 TTGCTGGTAGCAATGTAAAATGG + Intronic
1071594958 10:86914749-86914771 TTGCTGGTTGGAATGCAAAATGG + Intronic
1071687820 10:87779865-87779887 TTGCTGGTGGAAATGCAAAATGG + Intronic
1071704814 10:87986287-87986309 TTGCTGTTGGGAATGCAAAATGG + Intergenic
1071714409 10:88080821-88080843 TTGCTGTTAGAAATGTCAAATGG + Intergenic
1071864011 10:89705276-89705298 TTGCTGTTATTCTTGCAGAATGG + Exonic
1072076313 10:91977663-91977685 TTGCTGGTAGAAATGCAAAATGG - Intronic
1072269483 10:93761889-93761911 TTGCTTTTAGTGATAGAAAGTGG + Intronic
1072370309 10:94759490-94759512 TTGCTGGTGGAAATGCAAAATGG + Intronic
1072496191 10:95962440-95962462 TTGCTGATGGGAATGCAAAATGG + Intronic
1072571362 10:96660558-96660580 TTGCTGGCAGGAATGCAAAATGG + Intronic
1072597675 10:96890006-96890028 TTGCTGGTGGGAATGCAAAACGG - Intronic
1073576360 10:104629190-104629212 TTGCTGATGGGAATGCAAAATGG + Intergenic
1073595767 10:104798567-104798589 TTGCTGGTGGGAATGCAAAATGG + Intronic
1073625649 10:105093777-105093799 TTGCTGGTGGGGATGCAAAATGG + Intronic
1073942702 10:108716035-108716057 TTGATGTTTGAGATACAAAAGGG + Intergenic
1074276302 10:112005742-112005764 TTTCTGTTGGTGCTGCAAGATGG - Intergenic
1074660012 10:115643861-115643883 TTGCTGTTGGGAATACAAAATGG + Intronic
1074936393 10:118185954-118185976 TTGCTGATGGGAATGCAAAATGG - Intergenic
1075175827 10:120160108-120160130 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1075343423 10:121664948-121664970 TTGCTGTTGAGGATGCCAAATGG + Intergenic
1075952199 10:126489616-126489638 TTGCTGGTGGGGATGCCAAATGG + Intronic
1076085305 10:127622553-127622575 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1076140523 10:128074862-128074884 TTGCTGGTAGGAATGTAAAATGG - Intronic
1076341484 10:129749717-129749739 TTGCTGATGGGAATGCAAAATGG - Intronic
1076602334 10:131666744-131666766 TTGCTGGTAGTTATGTAAAATGG + Intergenic
1076940014 10:133598494-133598516 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1077238808 11:1499795-1499817 CTGCTGGTGGGGATGCAAAATGG + Intronic
1077421735 11:2453647-2453669 TTGCTGGTAGGCATGCAAGAGGG + Intronic
1077449054 11:2624015-2624037 TTGCTGGTGGGAATGCAAAATGG - Intronic
1077873372 11:6282028-6282050 TTGCTTTTTGTGTTGCAAACTGG - Intergenic
1078112224 11:8405183-8405205 TTGCTGGTGGGAATGCAAAATGG - Intronic
1078128216 11:8589058-8589080 TTGCCGTTGGGAATGCAAAATGG + Intronic
1078361538 11:10672713-10672735 TTGCTGGTAGAAATGTAAAATGG + Intronic
1078500154 11:11865605-11865627 TTGCTGGTAGGAATGTAAAATGG - Intronic
1078607632 11:12790901-12790923 TTGCTGATGGTAATGTAAAATGG + Intronic
1078738008 11:14038744-14038766 TTGCTGGTGGAAATGCAAAATGG + Intronic
1079293727 11:19212509-19212531 TTGCTGATGGAAATGCAAAATGG - Intergenic
1079581886 11:22075382-22075404 TTGCTGTGAATAAAGCAAAAAGG - Intergenic
1079624956 11:22606053-22606075 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1079927328 11:26510845-26510867 TGGATGTTAGTCATCCAAAAAGG + Intronic
1080096328 11:28412135-28412157 TTGCTGTTAGTAATGTAGATTGG + Intergenic
1080499731 11:32858979-32859001 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1080650383 11:34217880-34217902 TTGCTGGTGGGAATGCAAAATGG - Intronic
1080995083 11:37589510-37589532 TTGCTGATAGGAATGCAAAATGG + Intergenic
1081836417 11:46159071-46159093 TTGCTGGCAGGAATGCAAAATGG + Intergenic
1081926792 11:46836666-46836688 TTGCTAATAGGAATGCAAAATGG + Intronic
1083210051 11:61178004-61178026 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1083981461 11:66174314-66174336 TTGCTGGTAGGAATGTAAAATGG + Intronic
1085162106 11:74357569-74357591 TTGCTGGTAGGGATTTAAAATGG + Intronic
1085452801 11:76646202-76646224 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1085673233 11:78489483-78489505 TTGCTGGTAGGAATGCAAAATGG + Intronic
1085952673 11:81351387-81351409 TTGTTGGTAGAAATGCAAAATGG - Intergenic
1086375686 11:86198375-86198397 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1086874981 11:92084871-92084893 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1086962894 11:92998098-92998120 TTGCTGGTAGAAATGTAAAATGG + Intergenic
1087017885 11:93572186-93572208 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1087710412 11:101543246-101543268 TTGCTGGTGGGAATGCAAAATGG + Intronic
1087803986 11:102535770-102535792 TTGCTGGTGGGAATGCAAAAGGG - Intergenic
1087869613 11:103275963-103275985 TTGCTGGCAGGAATGCAAAAGGG - Intronic
1088049947 11:105499990-105500012 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1088306629 11:108416790-108416812 TTGCTGGTCGGAATGCAAAATGG + Intronic
1088397627 11:109386046-109386068 TTGCCGTCAGGGATGCAAAATGG - Intergenic
1088457473 11:110048139-110048161 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1088616071 11:111629857-111629879 TTGCTGGTAGGAATGTAAAATGG + Intronic
1088697572 11:112381546-112381568 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1088704175 11:112446901-112446923 TTGCTGGTAGGTATCCAAAATGG - Intergenic
1089224498 11:116905550-116905572 TTGCTGGTAGGGATGTATAATGG - Intronic
1089876761 11:121729635-121729657 TTGCTGATAGGGAGGTAAAATGG - Intergenic
1090112712 11:123932305-123932327 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1090219513 11:125006163-125006185 TTGCTGGTGGGAATGCAAAATGG - Intronic
1090314722 11:125775925-125775947 TTGCTGGCAGGAATGCAAAATGG - Intergenic
1090683429 11:129087134-129087156 TTGCTGCTGGGAATGCAAAATGG + Intronic
1090746776 11:129711919-129711941 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1090754463 11:129777533-129777555 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1090893280 11:130946873-130946895 TTGCTGGTAAATATGCAAAATGG - Intergenic
1090900145 11:131023270-131023292 TTGCTGGTGGGGATGTAAAATGG + Intergenic
1091096486 11:132827451-132827473 TTGCTGATGGGAATGCAAAATGG + Intronic
1091326946 11:134698337-134698359 CTGCTGATGGTGCTGCAAAATGG - Intergenic
1091438418 12:493459-493481 TTGCTGGTGGGAATGCAAAATGG + Intronic
1091454427 12:596050-596072 TTGCTGGTGGGAATGCAAAATGG + Intronic
1091902339 12:4154383-4154405 TTGCTAGCAGGGATGCAAAATGG + Intergenic
1091939103 12:4460039-4460061 TTGCTGGTAGAAATGCATAATGG + Intergenic
1092038864 12:5365556-5365578 TTGCTGGTGGGAATGCAAAACGG + Intergenic
1092293057 12:7176013-7176035 TTGCTGTTGGGAATGCAAAATGG - Intergenic
1092577260 12:9800187-9800209 TTGCTGATTGAAATGCAAAATGG - Intergenic
1092699399 12:11210598-11210620 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1092771222 12:11898806-11898828 TTGCTGGTGGGGATGTAAAATGG + Intergenic
1093222663 12:16441928-16441950 TTGCTGACGGAGATGCAAAATGG - Intronic
1093586881 12:20848376-20848398 TTGCTGGTAGGAATGCAAAATGG + Intronic
1093591038 12:20903144-20903166 TTGCTGGAGGTGATGTAAAATGG + Intronic
1093764816 12:22951437-22951459 TTGCTGTTGGGAATGTAAAATGG - Intergenic
1094006866 12:25762959-25762981 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1094312643 12:29101747-29101769 TTGCTGGTAGAAGTGCAAAATGG - Intergenic
1094530222 12:31267492-31267514 TTGCTGGTAGGAATGGAAAATGG - Intergenic
1095692463 12:45105802-45105824 TTGCTGATGGAAATGCAAAATGG - Intergenic
1095835478 12:46633540-46633562 TTGCTGTTGGCAATGCAGAATGG - Intergenic
1096039920 12:48506075-48506097 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1096161449 12:49380985-49381007 TTGCTGGTAGGAATGTAAAATGG - Intronic
1096307049 12:50486895-50486917 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1096442565 12:51656896-51656918 TTGCTGTTGGGAATACAAAATGG + Intronic
1096902117 12:54894839-54894861 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1097073398 12:56373907-56373929 TTGTTGTTGGGAATGCAAAATGG + Intergenic
1097291662 12:57921726-57921748 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1097371827 12:58792347-58792369 TTGCTAGTAGAAATGCAAAATGG + Intronic
1097497075 12:60353416-60353438 CTGCTGATGGTAATGCAAAATGG - Intergenic
1097932115 12:65199871-65199893 TTACTGGTAGGAATGCAAAATGG - Intronic
1098033173 12:66275328-66275350 TTGCTGATGGGGTTGCAAAAGGG - Intergenic
1098083899 12:66820395-66820417 TTGCTGATGGGAATGCAAAATGG + Intergenic
1098212694 12:68183227-68183249 TTGCTGATGGGAATGCAAAATGG + Intergenic
1098285234 12:68900428-68900450 TTGCTGGTGGGAATGCAAAATGG + Intronic
1098287307 12:68920540-68920562 TTGCTGTGAGTGGTCCAGAAGGG - Intronic
1098334813 12:69392276-69392298 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1098776348 12:74624260-74624282 TTGCTGACAGGAATGCAAAATGG + Intergenic
1098791278 12:74826997-74827019 TTTCTTTTAGTGATTCCAAAAGG - Intergenic
1099183027 12:79489293-79489315 TTGTTGCTAGTGATCCAAGATGG + Intergenic
1099482273 12:83182631-83182653 TTGCTGATGGGAATGCAAAACGG - Intergenic
1099629254 12:85119608-85119630 TTGCTGGTGGGAATGCAAAATGG - Intronic
1099686564 12:85897289-85897311 TTGCTGTTGAGAATGCAAAATGG - Intergenic
1099722778 12:86384690-86384712 TTGATGTTTCTGATACAAAAAGG - Intronic
1100030548 12:90184656-90184678 TTGCTGGTAGGAATACAAAATGG + Intergenic
1100445986 12:94660505-94660527 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1100483804 12:95005297-95005319 TTGTTGTTAGTAATGTAAAATGG - Intergenic
1101043984 12:100785843-100785865 TTGCTGGAAGGAATGCAAAATGG - Intronic
1101482473 12:105112519-105112541 GTGCTGGTAGTAATGTAAAATGG - Intronic
1101497207 12:105265982-105266004 TTGCTGGTGGGAATGCAAAATGG + Intronic
1102067504 12:109989534-109989556 TTGCTATTAGAAATGCAGAATGG - Intronic
1102209440 12:111114184-111114206 TTACTGGTAGAAATGCAAAATGG - Intronic
1102811743 12:115830342-115830364 TTGCTGGCAGGGATGCAAAGTGG - Intergenic
1102901511 12:116641471-116641493 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1102935646 12:116894585-116894607 TTGCTGGTAGGAATGCACAATGG - Intergenic
1103249098 12:119484789-119484811 TTTCAGTTACTGATGGAAAATGG - Intronic
1103431139 12:120887901-120887923 TTGCTGGTGGTAATGTAAAATGG + Intronic
1103712783 12:122925306-122925328 TTGCTGGTGGGAATGCAAAATGG + Intronic
1104082039 12:125437532-125437554 TCGCTGGTAGGAATGCAAAATGG - Intronic
1104654693 12:130565299-130565321 TTGCTGGTAGGGATGTAAAATGG + Intronic
1104737427 12:131145013-131145035 TTGCTGGCAGGAATGCAAAATGG - Intergenic
1105295235 13:19083424-19083446 TTCCTGGTGGGGATGCAAAATGG + Intergenic
1105520668 13:21128020-21128042 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1105679944 13:22715764-22715786 TTGCTGGTGGGGATGTAAAATGG - Intergenic
1105687459 13:22799267-22799289 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1105965687 13:25382532-25382554 TTGCTGGTGGGGATGCAAAATGG - Intronic
1106175186 13:27324142-27324164 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1106215385 13:27693134-27693156 TTGCTGGGGGGGATGCAAAATGG - Intergenic
1106556529 13:30813765-30813787 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1106604926 13:31219886-31219908 TTGATGATAATGATGAAAAAAGG + Intronic
1107234345 13:38150945-38150967 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1107452798 13:40526714-40526736 TTGCTGCTAGGAATGCAAAATGG + Intergenic
1107502643 13:40996211-40996233 CTGCTGGTAGGAATGCAAAATGG + Intronic
1107572967 13:41682999-41683021 TTGCTGATAGAAATGCAAAATGG + Intronic
1107847408 13:44530884-44530906 TTGCTGATGGGAATGCAAAATGG + Intronic
1107882783 13:44847591-44847613 TTGCTGATGGTAATGCAAAATGG - Intergenic
1108101106 13:46957000-46957022 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1108269249 13:48742666-48742688 TTGCTGATAGGAATGTAAAATGG - Intergenic
1108281436 13:48866118-48866140 TTGCTCTTAGTTTTGCAACAGGG - Intergenic
1108482278 13:50885979-50886001 TTGCTGGTAGAAGTGCAAAATGG + Intergenic
1108531773 13:51333581-51333603 TTGCTGGTGGGAATGCAAAAAGG + Intergenic
1108762270 13:53582558-53582580 TTGCTAGTAGTAATGTAAAATGG - Intergenic
1108998902 13:56769745-56769767 TTGCTGATTGAAATGCAAAATGG + Intergenic
1109532076 13:63663013-63663035 TTGCTGTTTGAAATGCAAAATGG - Intergenic
1109612307 13:64782265-64782287 TTGTTGATAGTGATGCAAAATGG - Intergenic
1109676568 13:65683594-65683616 TAGCTGGTAGACATGCAAAATGG - Intergenic
1110102741 13:71630394-71630416 TAGTTGTTAGAGAGGCAAAATGG + Intronic
1110210286 13:72963874-72963896 TTGCTGGTAGGAATGTAAAATGG + Intronic
1110303882 13:73961884-73961906 TTTCTGGTAGAAATGCAAAATGG + Intronic
1110458761 13:75719938-75719960 CTGCTGGTAGAAATGCAAAATGG - Intronic
1110593333 13:77290254-77290276 TTGCTGATGGTCATGTAAAATGG + Intronic
1110826962 13:79982235-79982257 TTGCTGATGGGAATGCAAAATGG - Intergenic
1110945429 13:81408923-81408945 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1110994557 13:82090027-82090049 TTGCTGCCAGGGATGCAAATTGG - Intergenic
1111190241 13:84797477-84797499 CTGTTGTTAGAAATGCAAAATGG - Intergenic
1111278559 13:85987316-85987338 TTACTGGTAGGAATGCAAAATGG - Intergenic
1111807219 13:93052698-93052720 TTGCTGGTAGAAATGCAAAATGG + Intergenic
1111959355 13:94793148-94793170 TTCCTGTTGGGGATGCAAAATGG + Intergenic
1112405148 13:99113088-99113110 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1112517645 13:100068744-100068766 TTGCTGTTGGGATTGCAAAATGG + Intergenic
1112939296 13:104841599-104841621 TTGCTGATAACAATGCAAAATGG + Intergenic
1112945913 13:104926779-104926801 TTGCTGGTAGAAATGCAAAATGG - Intergenic
1113136998 13:107101973-107101995 TTGCTGGTGGGGATGCAAAATGG - Intergenic
1113412083 13:110099353-110099375 TTGCTGGTGGATATGCAAAATGG + Intergenic
1113545031 13:111141926-111141948 TTGCTGGTGGGAATGCAAAATGG - Intronic
1114291255 14:21290268-21290290 TTGCTGGTAGGAATGTAAAATGG - Intronic
1114385472 14:22249951-22249973 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1115169514 14:30488377-30488399 TTGCCGGTAGGAATGCAAAATGG + Intergenic
1115288118 14:31740250-31740272 TTGCTGGTGGGGATGCAAATTGG - Intronic
1115834088 14:37378084-37378106 TTGCTGTTAGGAGTGTAAAATGG + Intronic
1115917979 14:38338302-38338324 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1116391894 14:44402115-44402137 TTGCAATCAGTGCTGCAAAAGGG + Intergenic
1116468897 14:45264872-45264894 CTGCTGGTAGGAATGCAAAATGG - Intergenic
1116604558 14:46973157-46973179 TTGCTGGTGGAAATGCAAAATGG + Intronic
1116723426 14:48529793-48529815 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1116839850 14:49809067-49809089 TTGCTGGTGGTGATGTAAAAGGG + Intronic
1117130402 14:52681031-52681053 TTGCTGGTAGGAATGTAAAACGG + Intronic
1117226107 14:53661030-53661052 TTGCTGGTGGGGATGCAAAATGG - Intergenic
1117290594 14:54328462-54328484 TTGCCGATAGTGATGTACAAAGG - Intergenic
1117357213 14:54935863-54935885 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1117784493 14:59268439-59268461 TTGCTGGTGGAGATGTAAAATGG - Intronic
1118124046 14:62879254-62879276 TTGCTGGTAGGAATGCAAATTGG + Intronic
1118268596 14:64319823-64319845 TTGCTGATGGAAATGCAAAATGG + Intronic
1118481242 14:66168280-66168302 TTGCTGATAGCAATGTAAAATGG - Intergenic
1118516509 14:66534644-66534666 TTGCTGGTGGGGATGTAAAATGG - Intronic
1118794312 14:69127028-69127050 TTGCTGGTAGGATTGCAAAATGG + Intronic
1118800830 14:69188096-69188118 TTGCTGTTGGGAATGCAAAATGG - Intergenic
1119162692 14:72466275-72466297 TTGCTAGTGGTAATGCAAAATGG + Intronic
1119762923 14:77165615-77165637 TTGCTGATAGGAATGTAAAATGG - Intronic
1120169460 14:81234355-81234377 TTGCTGTTTCTGATTCACAAAGG - Intergenic
1120237592 14:81910473-81910495 TTGCTGCTGGTGATGGAAATGGG - Intergenic
1120413305 14:84185921-84185943 TTGCTGCTGGGAATGCAAAAAGG - Intergenic
1120464472 14:84839154-84839176 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1120467493 14:84878866-84878888 TTGTTGGTAGGAATGCAAAATGG + Intergenic
1120554691 14:85915294-85915316 TTGCTGGTAGAAATACAAAATGG - Intergenic
1120580567 14:86242863-86242885 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1120606775 14:86588505-86588527 TTGCTGAGAGGGATGTAAAATGG + Intergenic
1120656359 14:87194774-87194796 TTGCTGTTGGGAATGCAAAATGG + Intergenic
1121147774 14:91600211-91600233 TTGCTGGCAGGAATGCAAAATGG - Intronic
1121167242 14:91816219-91816241 TTGCTATTGGGAATGCAAAATGG - Intronic
1121500456 14:94431834-94431856 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1121820393 14:96960943-96960965 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1122955708 14:105069944-105069966 TGGGTGTTAGTGATGCAAGCAGG + Intergenic
1123800184 15:23811083-23811105 TTGCTGTCTGTGATGAAAACTGG + Intergenic
1123980960 15:25602264-25602286 CTGCTGATAGTAATGTAAAATGG - Intergenic
1124558885 15:30752877-30752899 CTGCTGGTAGGAATGCAAAATGG - Intronic
1124711122 15:32012937-32012959 TTGCTGGTGGTAATGTAAAATGG - Intergenic
1124718347 15:32088530-32088552 TTGCTGGTAAGAATGCAAAATGG - Intronic
1124972796 15:34506097-34506119 TTGCTAGTTGGGATGCAAAATGG - Intergenic
1125060291 15:35412373-35412395 TTGCTGATTGGAATGCAAAATGG + Intronic
1125096658 15:35861404-35861426 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1125176161 15:36824550-36824572 TAGCTGGTAGGAATGCAAAATGG + Intergenic
1125242363 15:37590037-37590059 TTGCTGTTAGGAATGAAAAGTGG - Intergenic
1125262486 15:37843213-37843235 TTTCTACTAGTAATGCAAAATGG - Intergenic
1125306256 15:38319278-38319300 TTGTTGTTGTTGTTGCAAAATGG + Intronic
1126279731 15:46931035-46931057 TTGCTGTTTGGAATGCAAAATGG - Intergenic
1126346675 15:47702410-47702432 TTGCTGATGGGAATGCAAAATGG + Intronic
1126484353 15:49163087-49163109 CTGCTGTTGGATATGCAAAATGG - Intronic
1126642059 15:50838093-50838115 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1126760994 15:51970011-51970033 TTGCTGGTGGTAATGTAAAATGG + Intronic
1126851109 15:52797860-52797882 ATGATGTTAATGATGGAAAAAGG + Intergenic
1126894659 15:53245233-53245255 TTGCTGATGGGAATGCAAAATGG - Intergenic
1127067989 15:55260328-55260350 TTGCTGGTAGGAATGCAAAATGG + Intronic
1127150941 15:56074693-56074715 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1127162657 15:56205983-56206005 CTGCTGGTAGGGATGGAAAATGG + Intronic
1127163070 15:56211918-56211940 CTGCTGGTGGGGATGCAAAATGG + Intronic
1127280082 15:57481861-57481883 TTGCTGTTGGGAATGCAAAATGG - Intronic
1127283656 15:57513933-57513955 TTGCTGGTAGGAATGTAAAATGG - Intronic
1127445548 15:59059400-59059422 TTGCTGGTAGGAATGCAAAATGG + Intronic
1127607540 15:60603362-60603384 TTGCTGATAGGAATGCAAAATGG - Intronic
1127780029 15:62304577-62304599 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1128036992 15:64535719-64535741 TTGCTGGTGGTAATGTAAAATGG - Intronic
1128193782 15:65731470-65731492 TTGCAGTTATTAATGAAAAAAGG - Intronic
1128406803 15:67349912-67349934 TTGTTGGTAGGGATGCAAAATGG + Intronic
1128442710 15:67727555-67727577 TTGCTTTTAGTCTTGTAAAATGG - Intronic
1128461776 15:67874564-67874586 TTGCTGATGGAAATGCAAAATGG + Intergenic
1128738899 15:70070105-70070127 TTGGGGTTAGGGATGCAAGAGGG - Intronic
1129437962 15:75557607-75557629 TTGCTGTTAGGAATATAAAATGG - Intronic
1130002023 15:80056122-80056144 TTGCTGGTGGTTATGTAAAATGG + Intergenic
1130165037 15:81447064-81447086 TTGCTGGTAGAAATGTAAAATGG + Intergenic
1130204608 15:81864321-81864343 TTGCTGCTGGGAATGCAAAATGG + Intergenic
1130292727 15:82618185-82618207 CTGCTGGTAGGAATGCAAAATGG - Intronic
1130304791 15:82705975-82705997 TGGCTGTGTGTGATGAAAAAGGG - Intronic
1130616042 15:85408924-85408946 CTGCTGTTAGAAATGTAAAATGG - Intronic
1131363126 15:91812868-91812890 TTGCTGGTGGAAATGCAAAACGG + Intergenic
1131506391 15:93023595-93023617 TTGCTGGTAGGAATGTAAAATGG - Intronic
1131591464 15:93753817-93753839 TTGCTGCTAGGAGTGCAAAATGG + Intergenic
1131743964 15:95424861-95424883 TTGCTGGTAGGGGTGTAAAATGG - Intergenic
1132020466 15:98357266-98357288 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1132266256 15:100473690-100473712 GTGCTGGTAGGGATGCAAAATGG + Intronic
1132886846 16:2185939-2185961 TTGCTCTTGGTGAAGAAAAAAGG - Intronic
1132923439 16:2413094-2413116 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1133321431 16:4916093-4916115 TTGCTAGTGGGGATGCAAAATGG + Intronic
1134329243 16:13235368-13235390 TTGCTGTTGGTGATGAAGTATGG - Exonic
1134651609 16:15913584-15913606 TTGCTGCTAGGAATGTAAAATGG - Intergenic
1134654304 16:15936271-15936293 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1135244422 16:20842941-20842963 TTGCTGGTAGGAATGTAAAATGG - Intronic
1135989162 16:27206933-27206955 CTCCTGTTAGCCATGCAAAATGG - Intronic
1136292308 16:29282698-29282720 TTGCTGATGGGAATGCAAAATGG - Intergenic
1136928693 16:34398623-34398645 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1136975881 16:35013181-35013203 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1137425955 16:48381019-48381041 TTGCTTGTAGGAATGCAAAATGG + Intronic
1137577708 16:49614340-49614362 TTGCTGGTAGGAATGTAAAATGG + Intronic
1137628653 16:49926321-49926343 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1137657583 16:50173507-50173529 TTGCTGGTGGGAATGCAAAATGG - Intronic
1137660383 16:50200483-50200505 TTGCTGGTAGGAATGCAAAATGG - Intronic
1137702802 16:50509143-50509165 TTGCTGGCAGGAATGCAAAATGG - Intergenic
1137725904 16:50656464-50656486 TCCCTTATAGTGATGCAAAATGG + Intergenic
1138077920 16:54061058-54061080 TTGCATTTAGTGATTCAAAATGG + Intronic
1138176885 16:54908477-54908499 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1138291496 16:55851541-55851563 TTGCTGGTAGTAATGTAAAATGG + Intronic
1138371287 16:56528969-56528991 TTGCTGGAAGTGATCCAAAAGGG - Intergenic
1138379953 16:56593018-56593040 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1139312038 16:66035486-66035508 TTGCTGTTTGCCATGCCAAATGG - Intergenic
1139316381 16:66073285-66073307 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1139727985 16:68917503-68917525 TTGCTGCTGGGAATGCAAAATGG - Intronic
1139730265 16:68938039-68938061 TTGCTGGTAAGGATGTAAAATGG - Intronic
1139807946 16:69585369-69585391 TTGCTGGTGGTAATGTAAAATGG + Intronic
1142098201 16:88256653-88256675 TTGCTGATGGGAATGCAAAATGG - Intergenic
1142524392 17:528993-529015 TTGCTGGTGGTAATGCAAAACGG - Intronic
1143436600 17:6932840-6932862 TTGCTGGTGGGGATGAAAAATGG + Intronic
1143693746 17:8594472-8594494 TTGCTGGTAGAAATGCAAAATGG + Intronic
1143961040 17:10720103-10720125 TGGCTGGTTGGGATGCAAAATGG + Intronic
1144048262 17:11472772-11472794 TTGCTGGTGGGAATGCAAAATGG - Intronic
1144582643 17:16468104-16468126 CTGCTGGTAGGAATGCAAAATGG + Intronic
1144941293 17:18943309-18943331 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1145109198 17:20146957-20146979 TTGCTGGTGGAAATGCAAAATGG - Intronic
1145350944 17:22082670-22082692 TTGCTGTTAATGATTGATAAAGG + Intergenic
1145410504 17:22657233-22657255 TTGCTGCTGGGAATGCAAAATGG + Intergenic
1145790429 17:27623303-27623325 CTGCTGTTAATGCTGCAAAGAGG - Exonic
1145818080 17:27809990-27810012 ATGCTGGTAGTGATATAAAATGG - Intronic
1146193392 17:30790550-30790572 TTGCTGTTAATGATTCACAAAGG + Intronic
1146597278 17:34180918-34180940 TTGTTGGTATTGATGCAAAATGG + Intergenic
1147226417 17:38981594-38981616 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1148353782 17:46960395-46960417 TTGCTGGTGGAAATGCAAAATGG + Intronic
1148379461 17:47184049-47184071 TTGCTGTAAGTGAAAGAAAATGG + Intronic
1148396434 17:47311577-47311599 TTGCTGTGAATGATGCCAAGTGG - Intronic
1148398573 17:47332166-47332188 TTGCTGATGGGAATGCAAAATGG - Intronic
1148841335 17:50499497-50499519 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1149457470 17:56799674-56799696 TTGCTGGTGGAAATGCAAAATGG - Intronic
1149628476 17:58098125-58098147 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1149876390 17:60238012-60238034 TTGCTGGTAGAAATGTAAAATGG - Intronic
1149915648 17:60606493-60606515 TTGCTGGTAGGAATGTAAAATGG - Intronic
1149959511 17:61092472-61092494 TTGCTGATAGGAATGCAAAATGG - Intronic
1150035536 17:61792044-61792066 TTGCTGGTGGGAATGCAAAATGG + Intronic
1150052162 17:61975501-61975523 TTGCTGGTAGTTATGTAAAATGG + Intronic
1150070161 17:62143536-62143558 TTGCTGGTAGGAATGTAAAAGGG - Intergenic
1150372599 17:64653428-64653450 ATGCTGGTAGAAATGCAAAATGG + Intronic
1150627783 17:66853443-66853465 TTGCTGGTAGAAATGCAAAATGG - Intronic
1150779728 17:68111402-68111424 ATGCTGGTAGAAATGCAAAATGG - Intergenic
1150875576 17:68966500-68966522 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1151136751 17:71953796-71953818 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1151168965 17:72229741-72229763 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1151174834 17:72279042-72279064 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1151250009 17:72826891-72826913 TTGCTGATAGGAATGAAAAATGG + Intronic
1153320471 18:3769289-3769311 TTGCTGGTAGGAATGTAAAATGG + Intronic
1153403570 18:4708554-4708576 TTGCTGATGGGAATGCAAAATGG + Intergenic
1153532408 18:6061116-6061138 TTGCTGGTAGGGAAGCAAAATGG - Intronic
1153873821 18:9346929-9346951 TTGCTGGTAGGAATGCAAAATGG - Intronic
1153892383 18:9529981-9530003 TTGCTCTTGGTAATGCAAAATGG + Intronic
1153954448 18:10084358-10084380 TTGCTGGTGGGAATGCAAAAGGG - Intergenic
1154022823 18:10679763-10679785 GTGCTGTAAGTGATGCATGAGGG + Intronic
1154208178 18:12355466-12355488 TTGCTGGTAGGGATGGAAAATGG + Intronic
1154275800 18:12958946-12958968 TTGCTGGTAGGAATGTAAAATGG - Intronic
1154392321 18:13949114-13949136 TTGCCGATAGGAATGCAAAATGG - Intergenic
1154972573 18:21425490-21425512 TTGCTGGTAGAAATGTAAAATGG - Intronic
1155104685 18:22650800-22650822 TTGCTGGTGGCAATGCAAAATGG - Intergenic
1155255659 18:23996013-23996035 TTGCTGGTGGAGATGTAAAATGG - Intronic
1155416991 18:25609443-25609465 TTGCTGATGGAAATGCAAAATGG + Intergenic
1155538021 18:26837956-26837978 TTGCTTTTAGTTATTCAAAAAGG - Intergenic
1155640675 18:28010245-28010267 TTGTTGTTACTGATGCAAAAAGG - Intronic
1155926099 18:31657042-31657064 TTGCTGTTAGGGATATAAATTGG + Intronic
1156271231 18:35534562-35534584 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1156413613 18:36862768-36862790 TTGCTGTTGGGAATGTAAAATGG - Intronic
1156571561 18:38260024-38260046 TTGCTGATGGAAATGCAAAATGG - Intergenic
1156893900 18:42221636-42221658 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1156900463 18:42295285-42295307 TTGTTGCTTTTGATGCAAAAGGG - Intergenic
1157072720 18:44428147-44428169 TTTCTGGTAGGAATGCAAAATGG - Intergenic
1157103252 18:44749118-44749140 TTGCTTTGAGTGATGGAAAGGGG - Intronic
1157320966 18:46633988-46634010 TTGCTGGTAGGAATGTAAAATGG + Intronic
1157352699 18:46903603-46903625 TTGCTGGTAGGGATGTAAAATGG + Intronic
1157693987 18:49706171-49706193 TTGCTGGTGGGTATGCAAAATGG - Intergenic
1157775016 18:50387107-50387129 TTGCTGGTGGGAATGCAAAATGG - Intronic
1158939200 18:62391413-62391435 TTGCTGATGGGAATGCAAAATGG - Intergenic
1159055659 18:63461036-63461058 TTGCTGATGGGAATGCAAAATGG - Intergenic
1159330105 18:66981945-66981967 TTGCTAATAGGAATGCAAAATGG - Intergenic
1159344735 18:67186643-67186665 TTGCTGTTGGAAATGGAAAATGG - Intergenic
1159452349 18:68618500-68618522 CTGCTGGTAGGAATGCAAAATGG + Intergenic
1159454868 18:68648489-68648511 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1159487230 18:69078120-69078142 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1160470416 18:79127808-79127830 TTGCTGGTGGGGATGTAAAATGG - Intronic
1161743297 19:6038864-6038886 TTGCTGGTGGGAATGCAAAATGG + Intronic
1162537829 19:11274224-11274246 CTGCTGGTGGGGATGCAAAATGG + Intergenic
1163238659 19:16044833-16044855 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1163259031 19:16175689-16175711 TTGCTGGTGTTGATGCAAAATGG + Intergenic
1163361366 19:16848350-16848372 TTGCTGATAGGAATGTAAAATGG - Intronic
1163673156 19:18640888-18640910 TTGCTGGTGGGGATGCAAAATGG - Intronic
1164817748 19:31218444-31218466 TTGTTGGTAGAAATGCAAAATGG + Intergenic
1165598083 19:37028025-37028047 TTGCTGCTGGGAATGCAAAATGG - Intronic
1165682099 19:37786340-37786362 TTGCTGCTGGGAATGCAAAATGG + Intronic
1165682205 19:37787437-37787459 TTGCTGCTGGGAATGCAAAATGG + Intronic
1166649914 19:44565016-44565038 TTGCTGATGGAGATGTAAAATGG + Intergenic
1166902720 19:46078256-46078278 TTGCTGGTGGTAATGTAAAATGG + Intergenic
1168068807 19:53937366-53937388 TTGCTGGTGGGAATGCAAAACGG - Intronic
1168165184 19:54542374-54542396 TTTGTGTAAGTGATGGAAAATGG + Intronic
1168380538 19:55917591-55917613 TTGCTTTTTGTGAAGCAAAGGGG - Intronic
925520715 2:4741534-4741556 TTACTGGTAGAAATGCAAAATGG + Intergenic
925552861 2:5094936-5094958 TTGCTGGTAGAAATGTAAAATGG + Intergenic
925557666 2:5149785-5149807 TTGGATTTAGTGATGCAAATAGG - Intergenic
925608940 2:5687467-5687489 TTGCTGTTGGGAATGCAAAATGG + Intergenic
925784153 2:7412362-7412384 TTGCTGATGGGAATGCAAAATGG - Intergenic
925834652 2:7932292-7932314 TTGCTGGTAGACATGTAAAATGG + Intergenic
925840346 2:7986030-7986052 TAGCTCTTAGTGATGCAAGGGGG + Intergenic
926262919 2:11283801-11283823 TTGCTGGTAGGAATGCAAAGTGG + Intronic
926780805 2:16470110-16470132 TTGTTGGTGGAGATGCAAAATGG + Intergenic
926875633 2:17474799-17474821 TTGCTGATAGGAATGTAAAATGG - Intergenic
926947784 2:18206795-18206817 TTGCTGGTGGGAATGCAAAATGG - Intronic
927234874 2:20863149-20863171 TTGCTGTTGGATCTGCAAAATGG + Intergenic
928110250 2:28502074-28502096 TTGCTGGTAGGAATGCAAATTGG - Intronic
928348446 2:30522287-30522309 TTGCTGGTGGGAATGCAAAATGG - Intronic
928547991 2:32345809-32345831 TTGCTGGTAAGAATGCAAAATGG - Intergenic
928719818 2:34107075-34107097 TTGCTGGTAGGAATGCAAAACGG - Intergenic
928912056 2:36431885-36431907 TTGCTGTCATTGTTGCACAAAGG + Intronic
929095388 2:38258820-38258842 TTGCTGGTGGGAATGCAAAACGG - Intergenic
929236824 2:39614224-39614246 TTGCTGTTGGAAATGCACAATGG - Intergenic
929478574 2:42279392-42279414 CTGCTGGTAGGAATGCAAAATGG - Intronic
929649789 2:43666551-43666573 TTACTGGTAGGAATGCAAAATGG - Intronic
929998409 2:46844587-46844609 TTGCTGGTGGGAATGCAAAATGG - Intronic
930593706 2:53359561-53359583 TTGCTGTTGGAAATGGAAAATGG - Intergenic
930655549 2:54003836-54003858 TTGCTAGTAGGAATGCAAAATGG - Intronic
930804180 2:55473497-55473519 TTGCTGATAAAAATGCAAAATGG + Intergenic
930907227 2:56585929-56585951 TTGCTGGTAGAAATGCAAAATGG - Intergenic
931153881 2:59605953-59605975 TTGTTGTTAGGACTGCAAAATGG - Intergenic
931211291 2:60198414-60198436 TTGCTGATGGGAATGCAAAATGG + Intergenic
931266345 2:60663828-60663850 TTGCTGGTAGGAATGTAAAATGG - Intergenic
931312436 2:61095036-61095058 TAGCTGGTAGAAATGCAAAATGG - Intronic
931314231 2:61112142-61112164 CTGCTTGTAGAGATGCAAAACGG - Intronic
931738296 2:65218519-65218541 TTGCTGGTGGAAATGCAAAATGG - Intergenic
931782738 2:65592838-65592860 TTGCTGGCAGGAATGCAAAATGG - Intergenic
931838079 2:66120710-66120732 TTGCTGGTAGAAATGAAAAATGG - Intergenic
932045321 2:68342731-68342753 TTGCTGGTAGAAATGCAAAATGG - Intergenic
932107805 2:68963192-68963214 TTGCTGGTGGGGATGCAAGATGG + Intergenic
932333745 2:70917461-70917483 TTGCTGGTAGGAATGGAAAATGG - Intronic
932446271 2:71783461-71783483 TTGCTGGAAGGGATGTAAAATGG - Intergenic
932491392 2:72124834-72124856 TTGCTGGTGGGGATGGAAAAGGG + Intergenic
932628811 2:73320880-73320902 TTGCTGTTAGTGTCCCACAAGGG + Intergenic
932911555 2:75811284-75811306 TTGCTGTTGGGTCTGCAAAATGG - Intergenic
933177003 2:79185854-79185876 TGACTGTTAGTGAAGGAAAAGGG + Intronic
933460262 2:82574269-82574291 TTGCTGATGGCAATGCAAAATGG - Intergenic
933611217 2:84437579-84437601 TTGCTGGTAGACATGGAAAATGG + Intronic
933697515 2:85230897-85230919 TTGCTGTTAGTTTTCCATAAAGG + Intronic
933929566 2:87135048-87135070 TTGCTGATAAGGATGTAAAATGG - Intergenic
934000898 2:87710840-87710862 TTGCTGATAAGGATGTAAAATGG - Intergenic
934651606 2:96094880-96094902 TTGCTGTTAAGAATGTAAAACGG + Intergenic
935208509 2:100918789-100918811 TTGCTGGTAGGGAGGTAAAATGG + Intronic
935625093 2:105165746-105165768 TTGCTGGTAGGAATGTAAAACGG - Intergenic
935799706 2:106682071-106682093 TTGCTGTTGGGAATGTAAAATGG - Intergenic
935805129 2:106738224-106738246 TTGCTGGTGGAAATGCAAAATGG - Intergenic
935889735 2:107663385-107663407 TTGATGATGGTAATGCAAAATGG + Intergenic
936085487 2:109465427-109465449 TTGCTGGTAGGAAAGCAAAATGG - Intronic
936238179 2:110764073-110764095 TTGCTGGTAAGAATGCAAAATGG + Intronic
936242988 2:110804363-110804385 TTGCTGGTGGGGCTGCAAAATGG + Intronic
936256020 2:110913145-110913167 TTGCTGGTGGTAATGTAAAATGG + Intronic
936363368 2:111828329-111828351 TTGCTGATAAGGATGTAAAATGG + Intronic
936443751 2:112579399-112579421 TTGCTGGTAGGAATGTAAAATGG - Intergenic
936482316 2:112895275-112895297 TTGCTGGTAGAAATGTAAAATGG - Intergenic
936522473 2:113219945-113219967 GTGCTGTTTGTGATGGAAGAAGG - Intronic
936620468 2:114091358-114091380 TTGCTGGCAGAAATGCAAAATGG - Intergenic
936891534 2:117376273-117376295 TTGCTTTTGGGAATGCAAAATGG - Intergenic
936980357 2:118258612-118258634 TTGCTGGTGGAAATGCAAAAGGG - Intergenic
937108829 2:119346179-119346201 TTGCTGGTAGGAATGTAAAATGG + Intronic
937130270 2:119506052-119506074 TTGCTGGTAGAAATGTAAAATGG + Intronic
937200394 2:120200207-120200229 TTGCTGGTAGTAATGTAAAATGG + Intergenic
937226094 2:120369935-120369957 TTGCTGGTGGAGATGCAAAATGG - Intergenic
937524883 2:122756030-122756052 TGGCTGTTGGCGATTCAAAAAGG + Intergenic
937542743 2:122979410-122979432 TTGCTGGTGGGAATGCAAAATGG + Intergenic
937874506 2:126811347-126811369 TTGCTGGTAGGAATGTAAAACGG - Intergenic
937892690 2:126950834-126950856 TTGCTGGTGGGGATGTAAAATGG - Intergenic
938047601 2:128136809-128136831 TTGCTGGTGGAAATGCAAAATGG - Intronic
938627027 2:133121634-133121656 TTGCTAGTAGAAATGCAAAAAGG + Intronic
938718545 2:134043608-134043630 CTGCTGATACTGAGGCAAAAAGG + Intergenic
938937110 2:136136815-136136837 TGGCTGTTACAGAGGCAAAAAGG + Intergenic
939237059 2:139508293-139508315 TTACTGTTAGAAATGGAAAATGG + Intergenic
939798036 2:146672211-146672233 TTGCTGATGGGAATGCAAAATGG + Intergenic
940294025 2:152103845-152103867 TTGCTGATGGTAATGCTAAATGG + Intergenic
940310720 2:152276021-152276043 CTGATGTGAGTGATGTAAAAAGG + Intergenic
940336381 2:152532357-152532379 TCGCTGGTAGGAATGCAAAATGG - Intronic
940382105 2:153026832-153026854 TTGCTGGTGGGAATGCAAAATGG - Intergenic
940605424 2:155917790-155917812 TTAATATTAGTGATGCAGAAAGG - Intergenic
940606612 2:155932032-155932054 TTGCTGGTGGAAATGCAAAATGG + Intergenic
940623039 2:156137996-156138018 ATGCTGTTAGTGTTTCAATATGG + Intergenic
940696096 2:156980997-156981019 TAGCTGTTCGTGCAGCAAAAAGG - Intergenic
940714243 2:157201265-157201287 TTGCTGATGGGAATGCAAAATGG + Intergenic
940952777 2:159694918-159694940 TTGCTGTTAGGAATGTAAAATGG - Intergenic
941357045 2:164506499-164506521 TTACTGGTAGGAATGCAAAATGG + Intronic
941727194 2:168874269-168874291 TTGCTGGTAGAAATGTAAAATGG + Intronic
941799992 2:169648723-169648745 TTGCTGGTAGGAATGGAAAATGG + Intronic
941839947 2:170071117-170071139 TTACTGATAGGAATGCAAAACGG + Intronic
941863670 2:170311218-170311240 TTGCTGGTAGGGATGTAAAATGG - Intronic
941927767 2:170913466-170913488 TTGCTGGTGGAAATGCAAAATGG - Intergenic
942011890 2:171771764-171771786 TTGCTGATGGGAATGCAAAATGG + Intergenic
942287079 2:174430203-174430225 TTGCTGATAGGGATGCAAAATGG - Intergenic
942365707 2:175224182-175224204 TTGCTGATAGAAATGCAAACTGG - Intergenic
942404861 2:175643409-175643431 TTGCTGGTTGGAATGCAAAATGG - Intergenic
942906889 2:181193765-181193787 TTGCTGGTGGAAATGCAAAACGG + Intergenic
943030842 2:182683815-182683837 CTGCTGATAGAAATGCAAAATGG + Intergenic
943061801 2:183047611-183047633 TGGCTGTGTGTGATGAAAAAGGG - Intergenic
943234280 2:185298118-185298140 TTGGTGGTAGGGATTCAAAATGG - Intergenic
943678311 2:190739897-190739919 TTGCTGGTGGGAATGCAAAATGG + Intergenic
943978715 2:194517772-194517794 ATGCTGTTAGAAATGCTAAATGG + Intergenic
944216206 2:197258687-197258709 TTGCTGTTGGGAATGTAAAATGG - Intronic
944680393 2:202072059-202072081 TTGCTGTTGGAAATGCAAAATGG - Intergenic
944713307 2:202355235-202355257 TTGCTGTTGGGAATGCAAAATGG - Intergenic
945309196 2:208290715-208290737 TTGCTGGTAGGAATGCAAAATGG - Intronic
945897033 2:215495054-215495076 TTGCTGGTGGGGATGCAAAACGG + Intergenic
946005631 2:216522334-216522356 TTCCTGTTAATGCTGCAGAAGGG - Intronic
946373334 2:219293922-219293944 TTGGTGTCAGTGTTGGAAAAGGG + Intronic
946518114 2:220435510-220435532 TTGCCTTTGGTGATGCAAAATGG - Intergenic
946711681 2:222513074-222513096 TTGCTTATAGGAATGCAAAATGG - Intronic
946750260 2:222887520-222887542 TTGCTGGTGGGAATGCAAAATGG - Intronic
946786801 2:223255244-223255266 TTGCTGGTGGAGATGTAAAATGG - Intergenic
946871534 2:224089840-224089862 TGGCTGTGTGTGATGAAAAAGGG + Intergenic
946967879 2:225057333-225057355 TTGCTGTTGGGAATGTAAAATGG - Intergenic
947055621 2:226098404-226098426 TTGCTGATAGAAATGCAAAATGG + Intergenic
947067271 2:226241771-226241793 TTGCTGGTATGAATGCAAAATGG - Intergenic
947091851 2:226520981-226521003 TGGCTGTTAGTGAGGCCACAGGG - Intergenic
947820737 2:233067633-233067655 TTGCTAGTAGGAATGCAAAATGG - Intronic
948106213 2:235415988-235416010 TTGCTGGTGGGGATGTAAAATGG - Intergenic
948558257 2:238832651-238832673 TTGCTGGTGGGAATGCAAAATGG + Intergenic
948579706 2:238977367-238977389 TTGCTGGTGGGAATGCAAAATGG + Intergenic
948965670 2:241377953-241377975 TTGCTGGCAGGAATGCAAAATGG - Intronic
949064074 2:241979141-241979163 TTGCTGTCAGAACTGCAAAATGG - Intergenic
1168783979 20:521455-521477 TTCCTGGTAGGAATGCAAAATGG + Intronic
1168796834 20:615962-615984 TTTCTGTTAGTGAGGAAGAAGGG + Intergenic
1168988822 20:2076735-2076757 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1168989732 20:2084308-2084330 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1168989791 20:2085053-2085075 TTGCTGGTAGGCATGTAAAATGG + Intergenic
1169398902 20:5262602-5262624 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1169547802 20:6668503-6668525 TTGCTGGTGGAGATGCAAAATGG + Intergenic
1170008160 20:11691535-11691557 TTGCTGATGGGAATGCAAAATGG + Intergenic
1170187645 20:13609332-13609354 TTGCTGCTGGAAATGCAAAAAGG + Intronic
1170246787 20:14229600-14229622 TTGCTGGTGGGAATGCAAAATGG + Intronic
1170273045 20:14549728-14549750 TAGGTGCTAGAGATGCAAAAAGG + Intronic
1171137003 20:22703878-22703900 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1172651359 20:36504593-36504615 TTGCTGGTAGGAATGTAAAATGG - Intronic
1172717997 20:36978066-36978088 TTGCTGGTTGGAATGCAAAATGG - Intergenic
1172747054 20:37219118-37219140 TTGCTGGTAGAAATGTAAAATGG - Intronic
1173196991 20:40923164-40923186 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1173338462 20:42132709-42132731 TTGCTGGTGGGAATGCAAAATGG + Intronic
1174211793 20:48885445-48885467 TTGCTAGTAGTAATGCAAAATGG + Intergenic
1174248486 20:49200025-49200047 TTGCTGATGGGAATGCAAAATGG + Intergenic
1174408025 20:50315054-50315076 TTGCTGGTAGGGATGAAAAATGG - Intergenic
1174490105 20:50886880-50886902 TTACTATAAGTGAAGCAAAATGG - Intergenic
1174936152 20:54871345-54871367 TTGCTGGTAGGAATGCAAAACGG - Intergenic
1175410805 20:58767108-58767130 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1175659426 20:60799317-60799339 CTGCTGATGGGGATGCAAAATGG + Intergenic
1176983917 21:15413814-15413836 TTGCTGGTAGAAATGTAAAAGGG + Intergenic
1177221545 21:18200052-18200074 TTGCTGATGGGGATGAAAAATGG - Intronic
1177320087 21:19509647-19509669 TTGCTGATGGGAATGCAAAATGG + Intergenic
1177325652 21:19585114-19585136 TTCCTGGTAGGAATGCAAAATGG - Intergenic
1177408511 21:20700668-20700690 TTACTGGTAGGAATGCAAAATGG + Intergenic
1177567164 21:22839293-22839315 TTGTTGGTAGTAATGAAAAATGG - Intergenic
1177568659 21:22857692-22857714 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1177846745 21:26298078-26298100 TTGCTGGCAGGAATGCAAAATGG - Intergenic
1178064637 21:28890630-28890652 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1178114382 21:29402264-29402286 TAGCTGTTAGTGAAACATAAAGG - Intronic
1178346863 21:31836530-31836552 TTACTGGTAGGGATGTAAAATGG - Intergenic
1178641764 21:34350323-34350345 TTACTGGTAGGGATGTAAAATGG + Intergenic
1179202605 21:39239793-39239815 TTACTGATAGGAATGCAAAATGG + Intronic
1179636718 21:42716332-42716354 TTGCTGCTGGGAATGCAAAATGG - Intronic
1179805989 21:43837396-43837418 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1180238547 21:46481556-46481578 TTGCTGATGGGCATGCAAAATGG - Intronic
1181759651 22:25049360-25049382 TTGTGGTGAGTGATGCAACATGG + Exonic
1182138124 22:27925731-27925753 TTGCTGCTGGGAATGCAAAATGG - Intergenic
1182231789 22:28843128-28843150 TTGCTGGTAGAAATACAAAATGG + Intergenic
1182247427 22:28970406-28970428 TTGCTTTTGGTAATCCAAAATGG + Intronic
1182310711 22:29403818-29403840 TTGCTGGTGGAAATGCAAAATGG + Intronic
1182384239 22:29922751-29922773 TTGCTGGTAGGAATGTAAAATGG - Intronic
1182398301 22:30053422-30053444 TTGCTGGTAGAAATACAAAATGG + Intergenic
1182514769 22:30849346-30849368 TTGCTGGTGGGGATGTAAAATGG - Intronic
1182690335 22:32156930-32156952 TTGCTGGTGGAAATGCAAAATGG - Intronic
1182970588 22:34571315-34571337 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1183128192 22:35805517-35805539 TTGCTGGTGGAAATGCAAAACGG + Intronic
1183283763 22:36949830-36949852 TTGCTGATGGGGATGCAAAATGG - Intergenic
1183761508 22:39823761-39823783 TTACTGGTAGGAATGCAAAATGG - Intronic
1183766368 22:39879667-39879689 TTGCTGGTGGGAATGCAAAATGG + Intronic
1183892262 22:40939323-40939345 TTGCAGGTAGAAATGCAAAATGG - Intergenic
1184154623 22:42659163-42659185 TTGCTGGTGGGGATGTAAAATGG - Intergenic
1184427333 22:44419046-44419068 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1185293822 22:50042879-50042901 TTGCTGGTGGAAATGCAAAATGG + Intronic
949258171 3:2075368-2075390 CTGCTGGTAGGAATGCAAAACGG + Intergenic
949363422 3:3255521-3255543 TTTCTGATAGGCATGCAAAAGGG - Intergenic
949455805 3:4237229-4237251 CTGCTGGTAGAAATGCAAAATGG - Intronic
949653249 3:6185826-6185848 TTGCTGATGGAAATGCAAAATGG - Intergenic
949958988 3:9296239-9296261 TTGCTGTTGGGGATGTAAAATGG - Intronic
949963394 3:9333982-9334004 TTGCAGTTGGTGATGCTAAAGGG - Intronic
950257339 3:11516489-11516511 TTGCTGGTGGGAATGCAAAATGG + Intronic
950342202 3:12257534-12257556 TTGGTGTTAGTGCAGGAAAAGGG + Intergenic
950347627 3:12312074-12312096 TTCATGTTAGTGATGGAAATAGG + Intronic
950373377 3:12549985-12550007 TTGCTGGTGGGAATGCAAAATGG + Intronic
950512154 3:13437038-13437060 TTGCTGCTGCTGCTGCAAAAAGG + Intergenic
950537836 3:13591004-13591026 TGGCTGGTAGGGATGCAAATTGG - Intronic
950547890 3:13649463-13649485 TTGCTGGTGGGAATGCAAAATGG + Intergenic
950635242 3:14309608-14309630 TTGCCGGTAGGAATGCAAAATGG + Intergenic
950734834 3:14998366-14998388 TTGCTGGTAGTAATGTAGAATGG - Intronic
951416866 3:22434732-22434754 TTGCTGGAGGGGATGCAAAATGG + Intergenic
951646329 3:24895763-24895785 TTGCTGGTAGGAATACAAAATGG + Intergenic
951894047 3:27594111-27594133 TTGCTGTTAGAGAAGCCAAGTGG + Intergenic
951935693 3:28020488-28020510 TTGCTGGTAGGAGTGCAAAATGG + Intergenic
951974009 3:28482597-28482619 TTGCTGGTGGGAATGCAAAATGG - Intronic
952274343 3:31862809-31862831 TTGCTGATAGGGATGTAAAATGG + Intronic
952426167 3:33176444-33176466 TTGCTGGTGGGAATGCAAAATGG - Intronic
952661024 3:35846912-35846934 TTGCTGTTTGACATGGAAAATGG - Intergenic
952767212 3:36964392-36964414 TTGCTGGTGGAAATGCAAAATGG - Intergenic
952787339 3:37168058-37168080 TTGCTGGTGGTAATGTAAAATGG + Intronic
953256472 3:41295819-41295841 TTGCTGGTAAGAATGCAAAACGG + Intronic
953277806 3:41520657-41520679 TTGCTGGTAGAAATGTAAAATGG - Intronic
953422947 3:42769373-42769395 TTGCTGGTGGGGATGCAAAATGG + Intronic
953588382 3:44226868-44226890 TTGCTGGTAGGGATGCAAATTGG + Intergenic
953781948 3:45879050-45879072 TTGCTGGTGGGAATGCAAAAAGG + Intronic
953813802 3:46136572-46136594 CTGCTGTTGGTAATGTAAAATGG - Intergenic
953818751 3:46185309-46185331 TTGCTGGTAGGGATAAAAAATGG - Intronic
954477263 3:50759309-50759331 TTGCTGGTGGGGATGTAAAATGG - Intronic
954489165 3:50885502-50885524 TTGCTGGTACGAATGCAAAATGG - Intronic
954607759 3:51927160-51927182 TTGCTGGTGGGGATGCAAAATGG + Intergenic
954762341 3:52885012-52885034 TTGCTGGTAAAAATGCAAAATGG - Intronic
954842038 3:53520239-53520261 TTGCTGGTGGTAATGTAAAATGG - Intronic
954939401 3:54357462-54357484 TTGCTGGCAGGAATGCAAAACGG + Intronic
954998887 3:54908154-54908176 TTGCTGGTGGTGTTGTAAAATGG - Intronic
955242401 3:57190073-57190095 TTGCTGGTAGGAATGCAAAATGG - Intergenic
955247455 3:57239783-57239805 TTGCTGGTAGGAATGTAAAATGG - Intronic
955932822 3:64074873-64074895 TTGCTGATAGAAATGCAAAATGG + Intergenic
956042528 3:65159590-65159612 TTGCTGGTGGGAATGCAAAATGG - Intergenic
956976171 3:74582719-74582741 TTGCTGGTAGGAATGTAAAATGG + Intergenic
957609222 3:82446164-82446186 TTGCTGGTGGGAATGCAAAATGG - Intergenic
957941601 3:87012647-87012669 TTGCTGATTGGAATGCAAAATGG + Intergenic
958490946 3:94772410-94772432 TTGCTGGTGGGAATGCAAAATGG + Intergenic
958932633 3:100224364-100224386 TTGCTGGTAGGAATGTAAAATGG + Intergenic
959099576 3:101995243-101995265 TTGCTGCTGGTTATGCAGAAGGG - Intergenic
959607192 3:108254554-108254576 TTGCTGGTGGAAATGCAAAAAGG - Intergenic
959831796 3:110871967-110871989 TTGCTGATAGGAATGCAAAATGG - Intergenic
959861466 3:111220436-111220458 TTGCTGGTAGAAATGTAAAATGG - Intronic
960088852 3:113618522-113618544 TTGCTGGTGGGAATGCAAAACGG - Intronic
960236064 3:115283633-115283655 TTGCTGGCAGAAATGCAAAATGG - Intergenic
960421391 3:117450054-117450076 TTTCTCTTAGTGATGAGAAAGGG + Intergenic
960469990 3:118051193-118051215 TTGCTGGTAGGAATGCAAAATGG - Intergenic
960510031 3:118538909-118538931 TTGCTGGTAGAAATGCAATATGG - Intergenic
961220764 3:125197819-125197841 TTGCTGTGATGGCTGCAAAATGG - Intronic
961497227 3:127303226-127303248 TTGCTGATGGGAATGCAAAATGG - Intergenic
962561670 3:136612982-136613004 TTGCTGGTAGAAATGCAAAATGG - Intronic
963076640 3:141353343-141353365 TGGGGGTAAGTGATGCAAAAGGG - Intronic
963446155 3:145410925-145410947 TTGCTGGTTGGAATGCAAAATGG - Intergenic
963812821 3:149796217-149796239 TTACTGGTGGTAATGCAAAATGG - Intronic
963860950 3:150309736-150309758 ATGCTGGTAGGAATGCAAAATGG - Intergenic
963886769 3:150591693-150591715 TTGCTGGTGGGAATGCAAAATGG + Intronic
964033249 3:152164321-152164343 TTGCTGATGGGAATGCAAAATGG + Intergenic
964264956 3:154885101-154885123 TTGCTGGTGGGGATGCAAAATGG + Intergenic
964267740 3:154919407-154919429 TTGTTGGTAGGAATGCAAAATGG + Intergenic
964377352 3:156061631-156061653 TTGCTAGTGGTAATGCAAAATGG - Intronic
964445758 3:156755639-156755661 TTGCTGGTAGGAATGCAAAATGG - Intergenic
964807308 3:160625117-160625139 TTGCTAGTGGTAATGCAAAATGG - Intergenic
964875990 3:161369163-161369185 TTGCTGGTGGGGATGGAAAATGG - Intronic
964996649 3:162891066-162891088 TTGCTGGTAGGAATGCAAAAAGG + Intergenic
965053204 3:163678832-163678854 TTGCTGGTGGGGATACAAAATGG + Intergenic
965368618 3:167831230-167831252 TTGCTACTAGGAATGCAAAATGG - Intergenic
965480353 3:169211195-169211217 TTGCTGGTAGGAATGTAAAATGG - Intronic
965511629 3:169574162-169574184 TTGCTGTTTCTTATGCATAAGGG - Intronic
965641583 3:170834493-170834515 TTGCTGATGGCAATGCAAAATGG - Intronic
965653392 3:170957363-170957385 TTGCTGGTAGAAATGTAAAATGG - Intergenic
965771211 3:172182915-172182937 CTGCTGCTAGTGTGGCAAAAAGG - Intronic
965848870 3:172997240-172997262 TTGCTGGTGGGAATGCAAAATGG - Intronic
965938058 3:174139710-174139732 TTGCTGGTGGGAATGCAAAATGG - Intronic
966128822 3:176611542-176611564 TTGCTGGTAGGAATGTAAAATGG + Intergenic
966305680 3:178531471-178531493 TTGCTGGTGGAAATGCAAAATGG - Intronic
966322995 3:178721671-178721693 TTGCTGTTGGGAATTCAAAATGG - Intronic
966564940 3:181367999-181368021 TTGCTATTAATGAAGAAAAAAGG - Intergenic
966608021 3:181841570-181841592 TTGCTGGTAGGAATGCAAAATGG + Intergenic
966963395 3:184965034-184965056 TTGCTGGTAGCGATGTAAAGTGG - Intronic
967606318 3:191451471-191451493 TTGCTGTGAGTCTTGCAAAAAGG + Intergenic
967827759 3:193892236-193892258 TTGCTGGTGGAAATGCAAAATGG - Intergenic
967911638 3:194547034-194547056 TTGCTGGTGGGAATGCAAAATGG - Intergenic
968171905 3:196517559-196517581 GTGCTGTTAGAGATGCATAGAGG - Intergenic
968200441 3:196749702-196749724 TTGCTGGTGGGAATGCAAAATGG - Intronic
968257111 3:197285766-197285788 TTGCTGACAGGAATGCAAAATGG + Intronic
969074371 4:4566003-4566025 TTGCTGGTGGGAATGCAAAATGG + Intergenic
970212435 4:13723791-13723813 TTGCTGATAGTGATATAAAATGG - Intergenic
970229563 4:13894949-13894971 TTGCTGGTGGAAATGCAAAATGG - Intergenic
970289713 4:14558392-14558414 TTGCTGTTGAGAATGCAAAATGG - Intergenic
970334100 4:15015467-15015489 TTGCTGTCAGGGATTTAAAAAGG - Intronic
970588718 4:17540037-17540059 TTGCTGGTGGGAATGCAAAATGG - Intergenic
971076181 4:23152111-23152133 CTGCTGTGAGTCCTGCAAAAGGG + Intergenic
971090662 4:23341408-23341430 TTGTTGGTAGGAATGCAAAATGG + Intergenic
971189276 4:24412113-24412135 TTGCTGGTGGGAATGCAAAATGG - Intergenic
971289580 4:25324652-25324674 TTGCTGATAGGAATGTAAAACGG - Intronic
971433620 4:26595039-26595061 TTGCTGGTGGGAATGCAAAATGG - Intronic
971595878 4:28527797-28527819 TAGCTGTTAATTATTCAAAAAGG - Intergenic
971833518 4:31731571-31731593 TTGCTTTTTCTGATGGAAAATGG - Intergenic
972085912 4:35215505-35215527 GTGCTGATAGGAATGCAAAATGG + Intergenic
972103593 4:35453285-35453307 ATGCTATTAGGAATGCAAAATGG + Intergenic
972141173 4:35961310-35961332 TTGCTGGTAGAAATGTAAAATGG - Intronic
972352361 4:38247510-38247532 TTACTGTCAGAAATGCAAAACGG - Intergenic
972401466 4:38707832-38707854 TTGCTGGTGGAAATGCAAAATGG - Intergenic
972633940 4:40865998-40866020 TTGCTGTTGCGAATGCAAAACGG + Intronic
972784357 4:42313309-42313331 TTGCTGGTGGGAATGCAAAATGG - Intergenic
973091290 4:46140316-46140338 TTGCTGCTAGGAATGCAAAATGG - Intergenic
973275996 4:48309752-48309774 TTGCTGGTGGAAATGCAAAATGG + Intergenic
973899503 4:55453812-55453834 TTCCTTTTAGTAATGCAATATGG - Exonic
973950909 4:56012993-56013015 TTGCTGGTAGAAATGTAAAATGG - Intronic
974377404 4:61095936-61095958 TTGCTGGTGGGAATGCAAAATGG + Intergenic
974489164 4:62542674-62542696 TTGCTGGTGGGAATGCAAAATGG + Intergenic
974623263 4:64387508-64387530 TTGCTTTTAGGAATGCAAAATGG - Intronic
974854930 4:67449651-67449673 TTGCTGGTGGGGATGCAAAATGG + Intergenic
974910714 4:68116268-68116290 TTGGTGTTGGGAATGCAAAATGG + Intronic
975567777 4:75777732-75777754 TTGCTGATGGGAATGCAAAATGG + Intronic
975666187 4:76737527-76737549 TTGCAGGTGGTAATGCAAAATGG - Intronic
975760567 4:77615709-77615731 TTGCTGATGGGAATGCAAAATGG - Intergenic
976054265 4:81045057-81045079 TTGCTGGTGGGAATGCAAAATGG - Intronic
976273700 4:83254851-83254873 TTGCTGGTAGAAATGCAAAATGG - Intergenic
976395194 4:84547813-84547835 TTGCTGTTAGGATTGCAAAATGG - Intergenic
976520717 4:86022197-86022219 CTGCTGGTAGTAATGTAAAATGG - Intronic
976770224 4:88644168-88644190 TTGCTGGTGTTAATGCAAAATGG + Intronic
976852585 4:89565289-89565311 TTGCTAGTGGTAATGCAAAATGG - Intergenic
976921689 4:90450834-90450856 TTGCAGTTTGTGTTGCAAATGGG + Intronic
977143342 4:93403769-93403791 TTGCTGGTAGGAATGTAAAATGG + Intronic
977913105 4:102560485-102560507 ATGCTGTTGGTCATTCAAAAAGG + Intronic
977922062 4:102656469-102656491 TTGCTGGTAGAAATGCAAAATGG + Intronic
978011493 4:103691024-103691046 TTGCTGTTATGAATACAAAATGG + Intronic
978033250 4:103962201-103962223 TTGCTGGTGGAAATGCAAAATGG - Intergenic
978042510 4:104085538-104085560 TTGCTGTTAGGAATCCAGAATGG - Intergenic
978052068 4:104213382-104213404 TTGCTGGTAGTGATACAGAAAGG - Intergenic
978335312 4:107661244-107661266 TAGCTGGTGGGGATGCAAAATGG + Intronic
978832117 4:113100518-113100540 TTGATGTTAAGAATGCAAAATGG + Intronic
978993800 4:115123684-115123706 TTGCTGTTACTGATATAAAGAGG - Intergenic
979051032 4:115933653-115933675 TTGTTGGTGGTAATGCAAAATGG + Intergenic
979926819 4:126577899-126577921 TTGCTGGTGGGAATGCAAAATGG - Intergenic
980289046 4:130821616-130821638 TTGCTGATGGCAATGCAAAATGG - Intergenic
980302343 4:131011026-131011048 TGGCTGTGTGTGATGAAAAAGGG - Intergenic
980312647 4:131153575-131153597 TTGTTGTTATTGTTGAAAAAGGG - Intergenic
980344872 4:131601064-131601086 TTGCTGTTACTGATGAGAACTGG + Intergenic
980393548 4:132177574-132177596 TTGCTGGTAGGAATGTAAAATGG + Intergenic
980498092 4:133610651-133610673 CTGCAGTTAGTAATACAAAATGG + Intergenic
980562577 4:134497289-134497311 TTGCTGGTAGAAATGTAAAATGG - Intergenic
980759766 4:137215697-137215719 TTGCTGGTAGTAATATAAAATGG - Intergenic
981731520 4:147904055-147904077 TTGCTGGTGGCAATGCAAAATGG - Intronic
982133674 4:152252384-152252406 TTGCTGATGGGAATGCAAAATGG - Intergenic
982568501 4:157018505-157018527 TTGCTATTGGAAATGCAAAATGG - Intergenic
982666073 4:158265275-158265297 TTGCTGGTGGGAATGCAAAATGG - Intergenic
982967308 4:161928516-161928538 TTGCTGGTGGGAATGCAAAATGG - Intronic
983093326 4:163532908-163532930 TTGCTGATAGGTATGCAAAATGG + Intronic
983764093 4:171454445-171454467 TTGCTGGTAGGAATGCAAAATGG - Intergenic
983955240 4:173690083-173690105 TGGCTGTTAGGAATGCAAAATGG + Intergenic
983993182 4:174147600-174147622 TTGCTGTATATGAAGCAAAAAGG - Intergenic
984054844 4:174915306-174915328 TTGCTGTTGGGACTGCAAAATGG + Intronic
984073749 4:175149702-175149724 TTGCTATTGGAGATGTAAAATGG - Intergenic
984130298 4:175866863-175866885 TTGCTGGTGGGAATGCAAAATGG - Intronic
984138223 4:175968824-175968846 GGGCTGGTAGAGATGCAAAATGG + Intronic
984788850 4:183595089-183595111 TTGCTGGTGGGAATGCAAAATGG + Intergenic
984887157 4:184459901-184459923 TTGCTGATGGGGATGCAAAATGG + Intronic
985058393 4:186055913-186055935 TTGCTGATAGGAATGTAAAATGG - Intergenic
985308176 4:188566668-188566690 TTGCTGATGGGAATGCAAAATGG - Intergenic
985331930 4:188846770-188846792 TTGCTGTTTGAAATGCAAAGTGG - Intergenic
985486045 5:150771-150793 TTGCTGATGGAAATGCAAAATGG + Intronic
986000932 5:3630014-3630036 TTTCTGTTAATAATGCAAGAAGG - Intergenic
986021751 5:3811154-3811176 TTGCTGGTGGGAATGCAAAATGG + Intergenic
986251723 5:6065565-6065587 TTGCTGGTGGGAATGCAAAATGG + Intergenic
986871581 5:12053623-12053645 TTGCTGTTGTTGAAGCAGAATGG + Intergenic
986891126 5:12307701-12307723 TTGCTTGTAGGAATGCAAAATGG - Intergenic
987092970 5:14523690-14523712 TTGCTGGTGGAAATGCAAAAGGG + Intronic
987674416 5:21056101-21056123 GAGCTGTTAGTAATGCAAAGTGG - Intergenic
987688201 5:21232371-21232393 TTGCTGATAAGAATGCAAAATGG + Intergenic
988434671 5:31159912-31159934 TTGCTGCTGGGAATGCAAAATGG - Intergenic
988550027 5:32192182-32192204 TTGCTGGTAGAAGTGCAAAATGG + Intergenic
988637238 5:32997878-32997900 CTGCTGGTAGGAATGCAAAATGG - Intergenic
988810620 5:34781634-34781656 TTGCTGATAGAGATGTTAAATGG + Intronic
989419836 5:41224848-41224870 TTGCTGGTAGAAATGCAAAATGG - Intronic
989430327 5:41347103-41347125 TTCCTGTTGGGAATGCAAAATGG - Intronic
989804919 5:45591367-45591389 TTGCTGGTAGGAATGCAAAATGG - Intronic
990108923 5:52298868-52298890 TTGCTGATGGAAATGCAAAATGG + Intergenic
990109266 5:52303915-52303937 TTGCTGATGGAAATGCAAAATGG + Intergenic
990537835 5:56740980-56741002 TTGCTGGTAGGAATGTAAAATGG + Intergenic
990673494 5:58158978-58159000 CTGCTGTTGGGAATGCAAAATGG - Intergenic
991108838 5:62874484-62874506 TTGCTGGTATGAATGCAAAATGG + Intergenic
991221004 5:64217454-64217476 TTGCTGCTTGGAATGCAAAATGG - Intronic
991405462 5:66296913-66296935 TTGCTAGTGGGGATGCAAAATGG - Intergenic
991606880 5:68411459-68411481 TTGCTGGTGGGGATGCAAAATGG - Intergenic
991683880 5:69164498-69164520 TTGCTGATGGGAATGCAAAATGG + Intergenic
991996591 5:72393544-72393566 TTGCTGATGGGGATGGAAAATGG - Intergenic
992122511 5:73609162-73609184 TTGCTGGTAGAAATGCAAATTGG - Intergenic
992148027 5:73872088-73872110 TTGCTGGTGGGAATGCAAAATGG - Intronic
992456293 5:76919288-76919310 TTGCTGGTGGCAATGCAAAATGG - Intronic
992932913 5:81669225-81669247 TTGCTGGTGGGAATGCAAAATGG + Intronic
992993953 5:82314401-82314423 TTGCTGTTGGGAATGTAAAATGG + Intronic
993242114 5:85403586-85403608 TTGCTGGTAGAAATGCAAAATGG + Intergenic
993567352 5:89491571-89491593 TTGCTGGTAGAGATGCAATATGG - Intergenic
993975867 5:94479697-94479719 TTGCTGTTAGGAATGCAAAATGG - Intronic
994238830 5:97396028-97396050 TTGCTGGTGGGGATGCAAAGTGG - Intergenic
994275124 5:97827266-97827288 TTGCTTTTGGAGATACAAAATGG - Intergenic
994526170 5:100907368-100907390 TTGCTGATGGGAATGCAAAATGG - Intergenic
994651635 5:102536617-102536639 TTGCTGATGGGAATGCAAAATGG - Intergenic
995145070 5:108778428-108778450 TTGCTGGTAAGAATGCAAAATGG - Intronic
995415366 5:111905310-111905332 TTGCTGGTTGGAATGCAAAATGG - Intronic
995423450 5:111992651-111992673 TTGCTGGTAGGAATGAAAAATGG - Intronic
995800768 5:115991607-115991629 TTGCTCGTGGGGATGCAAAATGG - Intronic
995807022 5:116064389-116064411 TTGCTGGTGGGAATGCAAAAGGG - Intergenic
995950742 5:117710137-117710159 TTGCTGATGGGAATGCAAAATGG - Intergenic
995963141 5:117869931-117869953 TTGCTGATAAGGATGAAAAATGG + Intergenic
995975450 5:118030225-118030247 TTGCTGGTGGGAATGCAAAATGG + Intergenic
996000011 5:118349428-118349450 TTGCTGATGGGAATGCAAAATGG - Intergenic
996233761 5:121101056-121101078 TTGTTGTTGGGAATGCAAAATGG + Intergenic
996326347 5:122278835-122278857 TTGCTGTTGGGAATGAAAAATGG + Intergenic
996407322 5:123118395-123118417 TTGCGGTTTGAGATGCAAATAGG + Intronic
996656192 5:125939844-125939866 TTGCTGATGGGAATGCAAAATGG + Intergenic
996807632 5:127475340-127475362 CTGCTGTTAAGAATGCAAAATGG - Intergenic
997168895 5:131694113-131694135 TTGCTGGTGGGAATGCAAAATGG + Intronic
998187040 5:139988192-139988214 TTGCTGGTGGGAATGCAAAAGGG + Intronic
998196050 5:140072638-140072660 TTGCTGGTGGGAATGCAAAAGGG - Intergenic
998259645 5:140619934-140619956 TTGCTGGTGGAAATGCAAAATGG + Intergenic
998311064 5:141132682-141132704 TTGCTGGTGGGAATGCAAAATGG + Intronic
998589941 5:143466237-143466259 TTGCTGATGGGGATGCAAATTGG - Intergenic
998664029 5:144275300-144275322 TTGCACTTAATTATGCAAAATGG + Intronic
998782184 5:145670062-145670084 TTCTTTATAGTGATGCAAAATGG - Intronic
999006929 5:147991811-147991833 TTGCTTGTAGAAATGCAAAATGG - Intergenic
999220049 5:149968356-149968378 TTGCTGGTAGAAATGTAAAATGG - Intronic
999587964 5:153111820-153111842 TTTCTGGTTGTGATGCATAATGG + Intergenic
999725616 5:154435011-154435033 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1000053945 5:157587104-157587126 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1000627895 5:163560074-163560096 TTGCTGCTAGGGATGGAAAATGG - Intergenic
1000670357 5:164054708-164054730 ATGCTGGCAGTGATGCAAAATGG - Intergenic
1000987646 5:167878266-167878288 TTGGTGTGAGTGACGAAAAATGG - Intronic
1001151949 5:169237507-169237529 TTGCTGACAGTAATACAAAATGG - Intronic
1001273110 5:170330742-170330764 TTGTTGTTACTGTCGCAAAAGGG - Intergenic
1001463961 5:171945859-171945881 TTGGAGTTAGGGATTCAAAATGG - Intronic
1001635123 5:173204610-173204632 TTGCTGCTGGTAATGTAAAATGG - Intergenic
1001765432 5:174242214-174242236 TTACTGGCAGGGATGCAAAATGG - Intronic
1002005892 5:176234659-176234681 TTGCTGGTAGGGATGTAAAATGG - Intergenic
1002220485 5:177675968-177675990 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1002385753 5:178865601-178865623 TTGCTTTCTGTGATGTAAAATGG + Intronic
1002993663 6:2261896-2261918 TTGATGGTGGGGATGCAAAATGG - Intergenic
1003092726 6:3118105-3118127 TTGCTGTTGGGAATGTAAAATGG - Intergenic
1003636854 6:7839901-7839923 TTGCTGATGGGAATGCAAAATGG - Intronic
1003702673 6:8486904-8486926 TTGCTGTTGCTAATGTAAAATGG + Intergenic
1003781616 6:9434176-9434198 TTGCTCTTAGGAATGCAAAATGG - Intergenic
1003818642 6:9869806-9869828 TTGCTGGTAGGCATTCAAAATGG - Intronic
1003854404 6:10258413-10258435 TTGCTGATGGAAATGCAAAATGG + Intergenic
1003979433 6:11376163-11376185 TTCTTTATAGTGATGCAAAACGG + Intronic
1004033310 6:11895031-11895053 TTGCTGGAAGGAATGCAAAATGG - Intergenic
1004485846 6:16065680-16065702 TTGCTGGTAGGAATGAAAAATGG + Intergenic
1004539135 6:16532779-16532801 TTACTGATAGAAATGCAAAATGG + Intronic
1004762247 6:18680387-18680409 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1004772736 6:18802795-18802817 TTGCTGGTAGAAATGCAAAATGG - Intergenic
1004958785 6:20761318-20761340 TTGCTGGTGGTAATGCAAAATGG + Intronic
1004961670 6:20797387-20797409 TTGTTGTTGGAGATGCTAAATGG + Intronic
1004985162 6:21073434-21073456 TTGCTGGTAAGAATGCAAAATGG - Intronic
1005162655 6:22882367-22882389 TTGCTGGTAGTCATAAAAAATGG + Intergenic
1005232096 6:23714007-23714029 TTGCTGTTAGTCATGTAAATTGG - Intergenic
1005344953 6:24880029-24880051 CTGCTGGTAGGGATGTAAAATGG + Intronic
1005368264 6:25101816-25101838 TTGCTCTTAAGGATGCCAAATGG - Intergenic
1005600370 6:27420689-27420711 TTGCCGGTAGAGATGCAACATGG + Intergenic
1005781605 6:29198936-29198958 TTGCTGGTAGAAATGCAAAGTGG + Intergenic
1006841500 6:37031031-37031053 TTGCTGGTAGGAATGCAGAATGG - Intergenic
1006952459 6:37834595-37834617 CTGCTGATAGGAATGCAAAATGG - Intronic
1007365065 6:41385716-41385738 TTGCTGGTAGGAATACAAAATGG - Intergenic
1007457352 6:41989719-41989741 TTGCTGGTGGGAATGCAAAATGG + Intronic
1007882713 6:45185352-45185374 TTGGTGTTACTGATGCCCAATGG + Intronic
1008013745 6:46494569-46494591 TTGCTGGTGGCAATGCAAAATGG - Intergenic
1008235449 6:49041541-49041563 TTGCTGGTAGAAATGCAAAATGG - Intergenic
1008267231 6:49443407-49443429 TTGATGTGAGTGATGTGAAAAGG - Intronic
1008373749 6:50767628-50767650 TTGATGATACTGATGAAAAAGGG - Intronic
1008390502 6:50946095-50946117 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1008479973 6:51976047-51976069 TTGCTGGTAGAAATGTAAAATGG + Intronic
1008695825 6:54035566-54035588 TTGCTGATAGGAATGTAAAATGG - Intronic
1008945699 6:57094487-57094509 TTTTTGTTAGTGGTGCAATAGGG + Intronic
1008948019 6:57120496-57120518 TTGCTGGTTGGAATGCAAAATGG - Intronic
1009533905 6:64856209-64856231 TTTCTGGTGGAGATGCAAAATGG - Intronic
1009536306 6:64891081-64891103 TTGTTAATAATGATGCAAAAAGG + Intronic
1009842255 6:69092643-69092665 TTACAGTTAGTGATGAAAACAGG + Intronic
1010025323 6:71208665-71208687 TTGCTGATAGGAATGCAAAATGG - Intergenic
1010134744 6:72538010-72538032 GTGCTGTTGGGCATGCAAAATGG - Intergenic
1010137900 6:72576655-72576677 TTGCTGGTAGAAATGCAAAATGG + Intergenic
1010546380 6:77162104-77162126 TTGCTGGTAGGAATGTAAAACGG - Intergenic
1010560554 6:77343624-77343646 TGGCTGTTACTGATGCTGAATGG - Intergenic
1010923448 6:81713442-81713464 TTTCTGGTAGGAATGCAAAATGG + Intronic
1011105637 6:83777357-83777379 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1011191329 6:84731671-84731693 TTGCTGGTAAGCATGCAAAATGG + Intronic
1011230245 6:85153179-85153201 TTGCTGGTGGACATGCAAAATGG + Intergenic
1011247352 6:85333476-85333498 TTGGTGTTAGTGATAGAAAGAGG + Intergenic
1011265189 6:85510238-85510260 TTGCTGGTGGGCATGCAAAATGG - Intronic
1011274765 6:85619775-85619797 TTGCTGGTGGGAATGCAAAAGGG + Intronic
1011476618 6:87755037-87755059 ATGCTGTTAGCTCTGCAAAATGG - Intergenic
1011880672 6:92020812-92020834 TTGCTGGTAGAAATGCAAAATGG - Intergenic
1012122976 6:95390123-95390145 TTGCTGATGGGAATGCAAAATGG - Intergenic
1012147104 6:95698564-95698586 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1012706748 6:102540613-102540635 TTGTTGGTAGAAATGCAAAATGG - Intergenic
1012735574 6:102937036-102937058 TTGCTGGTAAAAATGCAAAATGG - Intergenic
1012891462 6:104902314-104902336 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1012936228 6:105370423-105370445 TTGCTGGCAGGAATGCAAAATGG + Intronic
1013031813 6:106341133-106341155 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1013497657 6:110714500-110714522 TTGCTGTTGGGAATGTAAAATGG - Intronic
1013544498 6:111142762-111142784 TTGCTGGTGGGAATGCAAAATGG + Intronic
1013931100 6:115534018-115534040 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1013956036 6:115841931-115841953 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1014038894 6:116800545-116800567 TTGCTTTGAGTGCTACAAAACGG + Intronic
1014167495 6:118242168-118242190 TTGCTGGTAGGAATGTAAAATGG - Intronic
1014390416 6:120856489-120856511 TTGCTGCTGGGAATGCAAAATGG + Intergenic
1014716389 6:124869160-124869182 TTGCTGATGGGAATGCAAAATGG + Intergenic
1014940389 6:127431298-127431320 TTGCTGTTGGGAATGGAAAATGG + Intergenic
1015873124 6:137797035-137797057 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1016203101 6:141437247-141437269 TTGCTACTGGCGATGCAAAACGG - Intergenic
1016226166 6:141741107-141741129 CTGCTGTTAGGAATGCAAAATGG - Intergenic
1016304559 6:142670283-142670305 TTGCTGTCAGTCATTCAAAGTGG + Intergenic
1016341776 6:143069418-143069440 TTGCTGGTGGTAATGCAACATGG - Intronic
1016385394 6:143526054-143526076 TTGCTGGTGGGAATGCAAAAGGG - Intergenic
1016396875 6:143633207-143633229 TTGCTGATGGGAATGCAAAATGG - Intronic
1016602387 6:145877259-145877281 TTGCTGGTAGGAATGTAAAATGG - Intronic
1016897917 6:149072091-149072113 TTGCTGGTAGGAATGTAAAATGG + Intronic
1017194210 6:151682841-151682863 TGGATGTTTGTGATGCAGAATGG + Intronic
1017217282 6:151923909-151923931 TTGCTGGTGGGAATGCAAAATGG - Intronic
1017297165 6:152811557-152811579 TTGCTGGTAGGAATGCAAAGTGG - Intergenic
1017416980 6:154231300-154231322 CTGCTGGTGGTAATGCAAAATGG + Intronic
1017437647 6:154432105-154432127 TTGCTGGTGGAAATGCAAAATGG - Intronic
1017854293 6:158336036-158336058 TTGCTGCTGGGAATGCAAAATGG - Intronic
1018585514 6:165353226-165353248 TTGCTGGTGGGAATGCAAAAAGG + Intronic
1018779509 6:167049810-167049832 TTGCTGGTAGGGATATAAAATGG - Exonic
1019153669 6:170024816-170024838 TTTGTGTTAGTGAGGCATAAAGG + Intergenic
1019222237 6:170482263-170482285 TTGCTGGTGGGAATGCAAAACGG + Intergenic
1019367303 7:640912-640934 TTGCTGGTGGAAATGCAAAATGG + Intronic
1019381267 7:725249-725271 TTGATCTTCGTGTTGCAAAATGG - Intronic
1020512787 7:9080151-9080173 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1020513039 7:9083601-9083623 TTGCTGCTGGGAATGCAAAATGG + Intergenic
1020825973 7:13028887-13028909 TTTTTGTTATTGATACAAAAGGG + Intergenic
1021086478 7:16425870-16425892 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1021151157 7:17152115-17152137 TTACTGGTAGGAATGCAAAATGG + Intergenic
1021506247 7:21388828-21388850 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1022060732 7:26791756-26791778 TTGCTGGTGGGCATGCAAAATGG + Intronic
1022194884 7:28055233-28055255 AATGTGTTAGTGATGCAAAAAGG - Intronic
1022420733 7:30220802-30220824 TTGCTGCTAGGAATGCAAAATGG + Intergenic
1022435806 7:30383768-30383790 TTGCTGTTGGGAATGTAAAATGG - Intronic
1022448353 7:30489647-30489669 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1022511816 7:30939983-30940005 TTGCTGGTAGGAATGCAAAATGG - Intronic
1022600515 7:31754277-31754299 TTGCTGATTGGAATGCAAAATGG + Intronic
1022625050 7:32026567-32026589 TTGCTGGTAGGAATGCAAAATGG + Intronic
1022689012 7:32627591-32627613 TTGCTGGTGGTAATGCAAAATGG + Intergenic
1022916592 7:34961990-34962012 TTGCTGGTGGTAATGCAAAATGG + Intronic
1022947119 7:35297716-35297738 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1022992629 7:35723781-35723803 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1023037537 7:36146613-36146635 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1023553505 7:41394513-41394535 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1023589780 7:41769331-41769353 TTGCTGGTAGAAATGTAAAATGG - Intergenic
1023750780 7:43370393-43370415 TTGCTGGTGGAAATGCAAAATGG + Intronic
1023878248 7:44304136-44304158 TTGTTGGTAGGAATGCAAAATGG + Intronic
1023903478 7:44503461-44503483 TTACTGATAGGAATGCAAAATGG - Intergenic
1023942359 7:44777610-44777632 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1023978026 7:45047108-45047130 TTGCTGGTAGGGATGTAAAATGG + Intronic
1024032542 7:45475641-45475663 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1024057569 7:45672603-45672625 TTTATATTAGTGATGAAAAAAGG - Intronic
1024104593 7:46069736-46069758 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024572830 7:50738157-50738179 TTGCTGGTAGGCATGCAAAATGG + Intronic
1024786635 7:52914594-52914616 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1024806601 7:53148776-53148798 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1024854821 7:53765785-53765807 TTGCTGATGGGAATGCAAAATGG - Intergenic
1025293226 7:57750509-57750531 TTGCTGCTGGGAATGCAAAATGG + Intergenic
1026599403 7:71763544-71763566 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1026975830 7:74497613-74497635 CTGCTGGTAGGGATGCAAAATGG - Intronic
1027277045 7:76567825-76567847 TTGCTCATGGGGATGCAAAATGG + Intergenic
1027766403 7:82348793-82348815 GTGTTGTTAGTGATGCAATGAGG - Intronic
1028153617 7:87404910-87404932 TTGCTGGTAGGAATGTAAAATGG + Intronic
1028223713 7:88225435-88225457 AGGCTGTCAGTGATGCTAAAGGG + Intronic
1028817518 7:95164173-95164195 TTGCTGATAGGAATACAAAATGG - Intronic
1029060582 7:97793688-97793710 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1029412766 7:100426551-100426573 ATACTGTTATTAATGCAAAAAGG - Intronic
1029882833 7:103834841-103834863 TTGCTGGTGGGAATGCAAAATGG + Intronic
1030089229 7:105842791-105842813 TTGCTGTTGGGAATGTAAAATGG - Intronic
1030513119 7:110509397-110509419 TTGCTGATGGGAATGCAAAATGG - Intergenic
1030538112 7:110794041-110794063 TTGCTGGTAGAAATGCAAAATGG + Intronic
1030877147 7:114828031-114828053 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1031228799 7:119077180-119077202 TAGCTATTCGTGTTGCAAAATGG + Intergenic
1031428021 7:121631390-121631412 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1031446977 7:121866983-121867005 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1031636347 7:124105866-124105888 TTGCTGTTGGGATTGCAAAATGG + Intergenic
1031658729 7:124393532-124393554 TTGCTGATGGTAATGTAAAATGG - Intergenic
1031841715 7:126749881-126749903 TTGCTGTTAGTGATGCAAAATGG + Intronic
1032003087 7:128278341-128278363 TTGCTGCTGAGGATGCAAAATGG + Intergenic
1032309955 7:130776019-130776041 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1032586127 7:133148495-133148517 TTGCTGATGGGAATGCAAAATGG - Intergenic
1032769961 7:135042070-135042092 TTTTTGTTGGGGATGCAAAATGG + Intronic
1033004133 7:137542158-137542180 TTGCTGGTAGAAATGCAAAATGG + Intronic
1033393571 7:140951826-140951848 TTGCTGGTGGTGATGTAAAATGG + Intergenic
1033467785 7:141611881-141611903 TTGTTGGTAGGAATGCAAAATGG + Intronic
1033844949 7:145420530-145420552 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1034108092 7:148508542-148508564 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1034607688 7:152332386-152332408 TTGGGGTTAGTGATGCAGAAAGG - Intronic
1034794882 7:154003935-154003957 TTGCAGTTACTTCTGCAAAAGGG - Intronic
1035456440 7:159012240-159012262 TTGCTGATAGTAATGAACAATGG - Intergenic
1035905161 8:3501964-3501986 TTGCTGATGGGAATGCAAAATGG + Intronic
1036005725 8:4661010-4661032 TTGCTGGTTGGAATGCAAAATGG + Intronic
1036099795 8:5767121-5767143 CTGCTGCTGGGGATGCAAAATGG - Intergenic
1036118240 8:5985039-5985061 TTGCTGCTGGGAATGCAAAATGG + Intergenic
1036192530 8:6683563-6683585 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1036522246 8:9502431-9502453 TTGCTGATAGAAATGAAAAATGG - Intergenic
1036580266 8:10067617-10067639 TTGCTGGTGGCAATGCAAAATGG - Intronic
1036742868 8:11381013-11381035 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1037016384 8:13913001-13913023 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1037048591 8:14341370-14341392 TTGCTGAGAGAGATGTAAAATGG - Intronic
1037073219 8:14678578-14678600 TTGCTGGTAAGAATGCAAAATGG + Intronic
1037080514 8:14779731-14779753 TTGGTGTGGGTGAAGCAAAAGGG + Intronic
1037148134 8:15599041-15599063 TTGCTGGTAGGAATACAAAATGG - Intronic
1037684125 8:21123544-21123566 TTGCTGTTGGGGATATAAAATGG - Intergenic
1037724992 8:21475718-21475740 TTGCTGGTGGGGACGCAAAATGG + Intergenic
1038100657 8:24370599-24370621 TTGCTGGTAGAAAAGCAAAATGG - Intergenic
1038183906 8:25255096-25255118 TTGCTGATGGGAATGCAAAATGG + Intronic
1038273136 8:26093291-26093313 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1038324033 8:26557984-26558006 TTGCTGGTGAGGATGCAAAATGG + Intronic
1038599337 8:28923704-28923726 TTGCTGGTAGGGATATAAAATGG - Intronic
1038769318 8:30462207-30462229 TTGCTGTTGGGAATGCAAAAAGG - Intronic
1039313703 8:36348459-36348481 TTGCTGGTAGGAATGTAAAATGG + Intergenic
1039521882 8:38177955-38177977 TTGCTGGTGGGGATGTAAAATGG + Intronic
1039690055 8:39853229-39853251 TTGCTGTTAGGAGTGAAAAATGG - Intergenic
1039701625 8:39967886-39967908 TTGCTGGTTGAAATGCAAAATGG + Intronic
1039782797 8:40803620-40803642 TTGCTGGTGGAGATGTAAAATGG + Intronic
1039853109 8:41388575-41388597 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1040671994 8:49703143-49703165 TTGTTCTTAGTGATAAAAAATGG - Intergenic
1040673748 8:49724190-49724212 TTGCTGTTGTGAATGCAAAATGG + Intergenic
1040690098 8:49927145-49927167 TTGCTGGTAGAAATGCAAAATGG + Intronic
1040807757 8:51412577-51412599 TTGCAGTTAGTGGTCAAAAAGGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041317150 8:56575719-56575741 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1041502069 8:58550013-58550035 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1041578350 8:59426464-59426486 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1041804944 8:61839726-61839748 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1041845499 8:62323071-62323093 TTGCTGGTGGGAATGCAAAATGG + Intronic
1042127412 8:65552483-65552505 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1042309142 8:67363165-67363187 ATGCTATTATTTATGCAAAATGG + Intergenic
1042660776 8:71152075-71152097 TTGCTGGTTGGAATGCAAAATGG - Intergenic
1043016139 8:74942425-74942447 TTGCTGGTGGTGAAGTAAAATGG + Intergenic
1043220726 8:77660171-77660193 TTGCTGTTGGTGGTGACAAAAGG + Intergenic
1043234701 8:77848416-77848438 TTGCTGGTGGACATGCAAAATGG - Intergenic
1043327240 8:79067940-79067962 TTGCTGGTAAGAATGCAAAATGG + Intergenic
1043494416 8:80784365-80784387 TTGCTGGTAGGAATGCAGAATGG - Intronic
1043618128 8:82153339-82153361 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1043790534 8:84462039-84462061 TTGCTGGTAGAAATACAAAATGG - Intronic
1043828591 8:84960417-84960439 CTGCTGGTGGAGATGCAAAATGG + Intergenic
1044074928 8:87808653-87808675 TTGCTGATAGGAATGCAGAATGG + Intergenic
1044104215 8:88182600-88182622 CTGCTGGTAATAATGCAAAATGG + Intronic
1044280342 8:90347177-90347199 TTGCTGGTAGAAATGTAAAATGG - Intergenic
1044533240 8:93331819-93331841 TAGCTGTGAGTGGTGAAAAAGGG - Intergenic
1044593300 8:93934897-93934919 TTGCTGGTGGTGTTGTAAAATGG - Intergenic
1045028165 8:98109506-98109528 TTGTCGGTAGTAATGCAAAATGG + Intronic
1045056853 8:98376018-98376040 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1045619915 8:103964254-103964276 TTGCTGGTGGGAATGCAAAATGG - Intronic
1045665458 8:104479647-104479669 TTGCTGGTAGGAATGTAAAACGG - Intergenic
1045730427 8:105232620-105232642 TTGCTGTTGGAAATGCAAAATGG - Intronic
1045989694 8:108291420-108291442 TTGCTGGTAGGAATGCAAAATGG - Intronic
1046335294 8:112778780-112778802 TTGCTGGTGGAAATGCAAAATGG - Intronic
1046472647 8:114697730-114697752 TTGATGGAAGAGATGCAAAATGG + Intergenic
1046883949 8:119341780-119341802 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1047138746 8:122110870-122110892 TTGCTTGTGGTAATGCAAAATGG - Intergenic
1047161342 8:122383557-122383579 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1047243994 8:123122082-123122104 TTGCTGGTAGACATGTAAAATGG + Intronic
1047585997 8:126273377-126273399 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1047627515 8:126671448-126671470 TTGCTGTTAAGAATGTAAAATGG + Intergenic
1047708671 8:127527729-127527751 TTGCTGGTGGGGATGCAAAACGG - Intergenic
1047999851 8:130369762-130369784 TTGCTGGTAGGAATGTAAAATGG + Intronic
1048654511 8:136520997-136521019 TTGCTGGTAGAGATGTAAAATGG - Intergenic
1048759368 8:137775607-137775629 TTACTGTTACTAATGGAAAAAGG + Intergenic
1049027234 8:140001770-140001792 CTGCTAGTAGTGATGGAAAATGG + Intronic
1049072452 8:140367113-140367135 TTGCTGAAGGGGATGCAAAATGG + Intronic
1049074289 8:140381848-140381870 TTGCTGGTAGAAATGTAAAATGG + Intronic
1049837125 8:144743659-144743681 TTGCAGGTGGGGATGCAAAACGG - Intronic
1050196722 9:3092462-3092484 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1050374284 9:4954676-4954698 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1050467559 9:5945425-5945447 TTGCTGTTGGGGTTGCTAAAAGG + Intronic
1050474419 9:6025113-6025135 CTGCTGTTAGGAATGAAAAATGG - Intergenic
1050491371 9:6191597-6191619 TTGCTGGTAGGGATGTGAAATGG - Intergenic
1050582257 9:7072195-7072217 TTGCTTGTGGTAATGCAAAATGG + Intronic
1050771547 9:9207597-9207619 TTGCTGGTAGGTATGAAAAATGG + Intronic
1051063103 9:13068306-13068328 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1051558871 9:18417266-18417288 TTTCTGTTAGTAAAGAAAAAAGG + Intergenic
1051659850 9:19415854-19415876 TTGCTGTAAGTGAGGCAGATGGG - Intronic
1051765876 9:20523262-20523284 TTGCTGGTAGAAATGCAAAATGG + Intronic
1052393724 9:27912123-27912145 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1052458375 9:28730885-28730907 TTGCTGTTGGGAATGTAAAATGG + Intergenic
1052761339 9:32595023-32595045 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1052765605 9:32636886-32636908 CTGCTGTTAGGTATGTAAAATGG - Intergenic
1052765669 9:32637945-32637967 TTGCTGTTAGGAATGAAAAATGG - Intergenic
1052783821 9:32810168-32810190 TGGCTGGTAGGAATGCAAAATGG + Intergenic
1052816471 9:33106060-33106082 TTGCTGGTAGGAATGTAAAATGG - Intronic
1053551900 9:39089662-39089684 TTGCTGTTTGGAATGTAAAATGG - Intronic
1053816033 9:41909800-41909822 TTGCTGTTTGAAATGTAAAATGG - Intronic
1054163316 9:61695470-61695492 TTGCTGCTGGGAATGCAAAATGG - Intergenic
1054614564 9:67277641-67277663 TTGCTGTTTGAAATGTAAAATGG + Intergenic
1054726519 9:68657376-68657398 CTGCTGGTAGGGATGCAAAATGG + Intergenic
1054856972 9:69910918-69910940 TTGCTGGTAGAAATGTAAAATGG - Intergenic
1055015407 9:71612325-71612347 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1055187971 9:73479082-73479104 TTGCTGATAGGAATGCAAAATGG - Intergenic
1055276361 9:74621686-74621708 TTGCTGCTAGGAATGCAAAATGG - Intronic
1055448319 9:76405990-76406012 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1055474506 9:76648211-76648233 TTGCTGGTGGGAATGCAAAATGG + Intronic
1055662968 9:78524667-78524689 TTGCTGTTAAGAATGTAAAATGG + Intergenic
1055743408 9:79415062-79415084 TTGCTGGTGGAAATGCAAAACGG + Intergenic
1055997506 9:82176395-82176417 TTGCTAGTAGGAATGCAAAATGG - Intergenic
1056369501 9:85940458-85940480 TTGGTGGTGGTAATGCAAAATGG - Intergenic
1056433804 9:86555803-86555825 TTGCTGCTAGGAATGTAAAATGG + Intergenic
1056441070 9:86621931-86621953 TTGCTGGTAGGGGTGTAAAATGG - Intergenic
1056513245 9:87326183-87326205 TTGCTGATGGAAATGCAAAATGG + Intergenic
1056562072 9:87739325-87739347 TCGCTGTTTGGAATGCAAAATGG + Intergenic
1056648406 9:88435461-88435483 TTGCTGGTAAGAATGCAAAATGG - Intronic
1056819821 9:89831564-89831586 TTGCTGCTGGGGATACAAAATGG - Intergenic
1057264612 9:93606319-93606341 TTGCTGGTGGGGATGCAAAATGG - Intronic
1057286811 9:93763251-93763273 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1057326707 9:94071113-94071135 TTGCTGGTAGGAATGTAAAATGG - Intronic
1057642821 9:96843088-96843110 TTGCTGGTGGAAATGCAAAATGG + Intronic
1057754934 9:97826019-97826041 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1057760024 9:97864495-97864517 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1057847207 9:98534768-98534790 TTGCTGGTGGGAATGCAAAATGG + Intronic
1057876688 9:98760986-98761008 TTGCTAATAGGAATGCAAAATGG - Intronic
1057894550 9:98897877-98897899 TTGCTGGTAGGAATGTAAAACGG + Intergenic
1058023381 9:100115022-100115044 TTGTTGGTAGAAATGCAAAATGG - Intronic
1058039649 9:100289963-100289985 TTGCTGGTAGGAATGCAAAATGG - Intronic
1058059507 9:100479966-100479988 TTGCTGGTAGAAATGTAAAATGG - Intronic
1058430763 9:104917013-104917035 TTGCTGGTAGGGGTGCAAACTGG + Intronic
1058628797 9:106964267-106964289 CTGCTGTTTGGAATGCAAAATGG - Intronic
1059188595 9:112301391-112301413 TTGCTGGTAGCAATGTAAAATGG + Intronic
1059698555 9:116752906-116752928 TTGCTGGTGGGAATGCAAAATGG + Intronic
1059736157 9:117101922-117101944 TTGCTGCTGGATATGCAAAATGG + Intronic
1059919834 9:119147369-119147391 TTGCTGCTGGGAATGCAAAACGG + Intergenic
1059939900 9:119348535-119348557 TTGCTAGTGGGGATGCAAAATGG - Intronic
1060169449 9:121449395-121449417 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1060363010 9:122978777-122978799 TTGCTGGTAGGAATGCAAAATGG - Intronic
1060503006 9:124177156-124177178 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1060633179 9:125178249-125178271 TTGCTGGTGGGAATGCAAAATGG - Intronic
1061527761 9:131181427-131181449 TTGCTGTTGGGAATGAAAAATGG - Intronic
1062223414 9:135433588-135433610 TTCCTGGTAGGAATGCAAAATGG + Intergenic
1062719246 9:138026869-138026891 TTGCTGGTGGGAATGCAAAATGG - Intronic
1203449364 Un_GL000219v1:97745-97767 TTGCTGGTAGAAATGTAAAATGG + Intergenic
1186012660 X:5153001-5153023 TTGCTGATGGGAATGCAAAATGG + Intergenic
1187310965 X:18142075-18142097 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1187375637 X:18750771-18750793 TTGCTGGTAGAAATGCAAAATGG - Intronic
1187630740 X:21168420-21168442 TTGCTGATGGAGATGTAAAATGG + Intergenic
1187643668 X:21322570-21322592 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1187938432 X:24358860-24358882 TTGCTGTTGGGAATACAAAATGG + Intergenic
1187964895 X:24601832-24601854 TTGCTGGTGGGAATGCAAAATGG + Intronic
1187988013 X:24835351-24835373 TTTCTTTTAGAAATGCAAAATGG - Intronic
1188246670 X:27843186-27843208 TTGATGGTAGGGATGCAAAATGG - Intergenic
1188249384 X:27874055-27874077 TTGCTGGTGGAGATGTAAAATGG - Intergenic
1188261438 X:28029541-28029563 TTGCTGGTGGGTATGCAAAATGG - Intergenic
1188700818 X:33260162-33260184 TTGCTGGTGGGAATGCAAAAGGG - Intronic
1188872038 X:35384069-35384091 TTGCTGGTTGTAATGCATAATGG + Intergenic
1188949692 X:36355253-36355275 TTGTTGGTAGGAATGCAAAATGG + Intronic
1189046458 X:37597454-37597476 TTGCTGGTGGGGATGTAAAATGG - Intronic
1189475900 X:41355388-41355410 TTGCTGGTAGGAATGTAAAATGG - Intronic
1189569401 X:42279235-42279257 TTGCTGGCAGGGATGCAAAATGG + Intergenic
1189574177 X:42332923-42332945 TTGCTGGTGGTGATGCAAAATGG - Intergenic
1189584883 X:42448943-42448965 TTGCTGGTGGGGATACAAAAAGG + Intergenic
1189584899 X:42449087-42449109 TTGCTGGTGGGGATACAAAAAGG + Intergenic
1189699740 X:43706003-43706025 TTGCTGGTAGAAATGTAAAATGG + Intronic
1189727193 X:43979169-43979191 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1189740094 X:44108705-44108727 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1189762524 X:44336511-44336533 TTGCTGGTGGGAATGCAAAATGG + Intronic
1190008930 X:46766394-46766416 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1190083665 X:47376662-47376684 TTGCTGGTGGGAATGCAAAATGG - Intronic
1190364844 X:49682384-49682406 TTGCTGATAGGAATGAAAAATGG - Intergenic
1190402348 X:50050322-50050344 TAGCTGGTAGGAATGCAAAATGG - Intronic
1190436072 X:50426891-50426913 TTGCTAGTAGGAATGCAAAATGG + Intronic
1190468961 X:50756594-50756616 TTGCTGATACGAATGCAAAATGG - Intronic
1190724525 X:53179824-53179846 TTGCTGATGGGAATGCAAAATGG + Intergenic
1190894368 X:54602181-54602203 TTGCTGACAGATATGCAAAATGG - Intergenic
1190898680 X:54647320-54647342 TTGCTGGTAGGAAAGCAAAATGG - Intergenic
1190923922 X:54884297-54884319 TTGCTGGTAAATATGCAAAATGG + Intergenic
1190957595 X:55210668-55210690 TTGCTGGTGGAAATGCAAAATGG - Intronic
1191684628 X:63877623-63877645 TTGCTGGTTGGAATGCAAAATGG + Intergenic
1191980640 X:66920856-66920878 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1192002330 X:67166740-67166762 TTGCTGGTAGTCATGTAAAATGG + Intergenic
1192016038 X:67332327-67332349 TTGTTGGTAGTATTGCAAAATGG - Intergenic
1192585095 X:72313093-72313115 TTCCTGTTATTTATGCATAATGG + Intergenic
1192588062 X:72336125-72336147 TTGCTGGTAGGAATGCAATATGG - Intronic
1192597329 X:72425150-72425172 TTGCTGGTGGGGATGTAAAATGG - Intronic
1192601707 X:72471438-72471460 TTGCTGATGGGGATGTAAAATGG - Intronic
1193235551 X:79102317-79102339 TTGCTGGTAGGAATGTAAAATGG - Intergenic
1193413197 X:81189828-81189850 TTGCTGGTGGAAATGCAAAATGG - Intronic
1193470915 X:81902295-81902317 TTGCTGATGGTAACGCAAAATGG - Intergenic
1194540469 X:95163984-95164006 TTCCTGTTAGGAATGCAAAGTGG + Intergenic
1194593128 X:95825544-95825566 TTGCTGTTGGAAATACAAAATGG + Intergenic
1194615818 X:96102614-96102636 CTGCTGTTGGAGATGTAAAATGG + Intergenic
1194638715 X:96376483-96376505 TTGGTGTGAGTGATGTAAACAGG + Intergenic
1194693074 X:97010360-97010382 ATGGTGTTGGTGATTCAAAATGG + Intronic
1194808199 X:98356754-98356776 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1194915500 X:99702563-99702585 TTCCAGTTAGTGATTCAAATAGG + Intergenic
1195408627 X:104544765-104544787 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1195512204 X:105729298-105729320 TTGCTGGTGGGAATGCAAAATGG - Intronic
1195525677 X:105887471-105887493 TTGCTCTTGGTAATGCAAAATGG + Intronic
1195584418 X:106548602-106548624 TTGCTGGTGGAAATGCAAAATGG - Intergenic
1195587431 X:106581155-106581177 TTGCTGGCAGGAATGCAAAATGG + Intergenic
1195608600 X:106837581-106837603 TTGCTGTTGGGAATGTAAAATGG + Intronic
1195827398 X:109017057-109017079 TTGCTGATAAGAATGCAAAATGG + Intergenic
1195952649 X:110292251-110292273 TTGCTGGTGGGAATGCAAAATGG + Intronic
1196023545 X:111015546-111015568 TTGCTGGTAGGGATGTAAAATGG - Intronic
1196091439 X:111747898-111747920 TTGCTGGTGGGAATGCAAAATGG - Intronic
1196136530 X:112215897-112215919 TTGCTGATAGGAATGTAAAATGG - Intergenic
1196227499 X:113183843-113183865 TTGCTGGTGGAAATGCAAAATGG + Intergenic
1196236759 X:113290780-113290802 TTGCTGGTTGGAATGCAAAATGG - Intergenic
1196251930 X:113470888-113470910 TTAATTTTAGTGATGCAGAAGGG - Intergenic
1196322506 X:114358315-114358337 TTGCTGGTAGGAATGCAAAATGG + Intergenic
1196360692 X:114852990-114853012 TTGCTGGTGGGAATGCAAAATGG - Intronic
1196767305 X:119258936-119258958 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1197030730 X:121810985-121811007 TTGCTGGCAGCAATGCAAAATGG - Intergenic
1197192452 X:123662999-123663021 TAGCTGTTAGGAATGCAAAATGG + Intronic
1197241122 X:124124217-124124239 TTGCTGGTGGGAATGCAAAATGG + Intronic
1197485590 X:127046277-127046299 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1197494901 X:127166892-127166914 TTGCTATTAGGAATGCAAAATGG + Intergenic
1197598520 X:128496943-128496965 TTGCTGGTGGTGATGTAAAATGG - Intergenic
1197803266 X:130374588-130374610 TTGCTGTTGGGAATGCAAAATGG - Intergenic
1198181061 X:134209570-134209592 TTGCTGTTGAGAATGCAAAATGG + Intergenic
1198182791 X:134225752-134225774 TTGCTGTTGAGAATGCAAAATGG + Intergenic
1198367492 X:135956642-135956664 TTGCTGATAGGAATGCAAAATGG + Intergenic
1198367495 X:135956669-135956691 TTGCTGATAGGAATGCAAAATGG + Intergenic
1198410888 X:136366636-136366658 TTGCTGATAGGAATGCAAAATGG - Intronic
1198432351 X:136580275-136580297 TTGCTGGTAGGGTTGTAAAATGG - Intergenic
1198473142 X:136968088-136968110 TTGCTGGTAGAAATGTAAAACGG - Intergenic
1198719425 X:139599702-139599724 CTGCTGTTGGAAATGCAAAACGG + Intronic
1199078778 X:143553177-143553199 TTGCTCATGGGGATGCAAAATGG + Intergenic
1199095580 X:143734788-143734810 TTGCTGGTGGGGATGCAGAATGG + Intergenic
1199246993 X:145617076-145617098 TTTCTGGTAGAAATGCAAAATGG + Intergenic
1199254758 X:145706431-145706453 TTGCTGTTGATAAAGCAAAATGG + Intergenic
1199361876 X:146929811-146929833 TTGCTGGTGGTAGTGCAAAATGG + Intergenic
1199363383 X:146947978-146948000 TTGCTGGTGGTAATGTAAAATGG - Intergenic
1199475773 X:148243368-148243390 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1199735503 X:150682431-150682453 TTGCTGGTGGGAATGCAAAATGG + Intergenic
1199817918 X:151415881-151415903 TTGCTGGTAGGAATGCAAAATGG - Intergenic
1199838412 X:151617702-151617724 TTTCTGTTCCTGATGCAAACTGG + Intronic
1199864879 X:151835233-151835255 TTGCTGATGGAAATGCAAAATGG + Intergenic
1199867685 X:151868151-151868173 TTACTTTTAGCAATGCAAAATGG + Intergenic
1199951544 X:152710592-152710614 TTGCTGGTAGAAATGCAAAATGG + Intergenic
1199958139 X:152757848-152757870 TTGCTGGTAGAAATGCAAAATGG - Intergenic
1200718561 Y:6577815-6577837 TTGCTGGTGGGAATGCAAAATGG - Intergenic
1202047419 Y:20748908-20748930 TTGCTGGTAGGAATGTAAAATGG - Intergenic