ID: 1031844367

View in Genome Browser
Species Human (GRCh38)
Location 7:126786629-126786651
Sequence TGCCATGAGGTGGCCTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031844367 Original CRISPR TGCCATGAGGTGGCCTGTAC AGG (reversed) Intronic
904664805 1:32111831-32111853 TGCCACTAGGTGCCCTGTAGGGG + Intronic
904666436 1:32125434-32125456 TGGCAAGAGATGGCCTGTGCAGG - Intronic
905783749 1:40735711-40735733 TGCCAAGATGAGGCCTGTCCAGG + Intronic
906049012 1:42855360-42855382 TGCCTTAACCTGGCCTGTACTGG + Intergenic
911166023 1:94725023-94725045 TGCCATGAGGTGTGCTTAACCGG - Intergenic
912044366 1:105436664-105436686 TGCCATGAGGCGGGCTGCAGTGG + Intergenic
912801653 1:112723205-112723227 AGCCATAAGGAGGCCTGTTCAGG + Intronic
913123829 1:115766980-115767002 TGCCTTTGGGTGGCCAGTACAGG - Intronic
915794728 1:158717378-158717400 GACCATGAGGTGGCCTGCACAGG + Exonic
921516365 1:216097656-216097678 TGCCATGAAGAGGCCTATAGAGG + Intronic
922545400 1:226453035-226453057 TGCCATCAGTTTGCCTGTGCGGG + Intergenic
922734387 1:227971595-227971617 TGCCGCCCGGTGGCCTGTACAGG + Intergenic
922734676 1:227972727-227972749 TGCCGCCCGGTGGCCTGTACAGG + Intergenic
922866602 1:228866045-228866067 GCCCCTGAGGTGGCCTGTAGGGG + Intergenic
924343528 1:243055062-243055084 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1065403412 10:25332974-25332996 TGACATGAACTGGCCTGTAGAGG + Intronic
1065770287 10:29071814-29071836 TGCCATGAGGTGGCCATTGGTGG - Intergenic
1066732587 10:38449042-38449064 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1066946244 10:41913127-41913149 TGCAATGAGATGGAATGTACTGG + Intergenic
1070554667 10:77518350-77518372 TGCCATGTGTTGGCCTGTTCTGG - Intronic
1076026012 10:127114062-127114084 AGCCATGAGGTGGCATGTAGGGG - Intronic
1077218909 11:1406651-1406673 TGGCATGAGGAGGCCTGCAGAGG + Intronic
1080767925 11:35313916-35313938 TTTCATGAGGTGGCCAGTCCAGG + Intronic
1081953383 11:47066461-47066483 TGGAATGAGATGTCCTGTACAGG + Intronic
1084468799 11:69343140-69343162 AGCCTTGAGGTGGCCTGAGCCGG + Intronic
1084563078 11:69914949-69914971 TGCCAAGAAGTGGCCTGTGGGGG + Intergenic
1087322083 11:96675375-96675397 TGCCATGATGTGGCCAGAATGGG + Intergenic
1090915095 11:131156015-131156037 TGCCATCAGGTGGCCGGAGCCGG - Intergenic
1091384320 12:83125-83147 TGTGATGAGCTGGGCTGTACAGG + Intronic
1101519700 12:105469869-105469891 TTCAAGGATGTGGCCTGTACAGG - Intergenic
1105707121 13:22974872-22974894 TGCCATGTGGTGTCCTGGACGGG - Intergenic
1109818795 13:67623847-67623869 AGCCATGTGATGCCCTGTACTGG + Intergenic
1118900666 14:69982773-69982795 TGCCATCAGGTGGGCTGGGCTGG + Intronic
1119291387 14:73498054-73498076 TGCCATTAGGTAGCCTGGAAAGG + Intronic
1119372756 14:74161709-74161731 TGCCATCAGGTGGGCTGCTCCGG - Intronic
1122851053 14:104531357-104531379 TGTCATGTGGTGTCCTGGACGGG - Intronic
1124619494 15:31265730-31265752 TGGCATGGGGTGGCCTGTCTAGG + Intergenic
1125988068 15:44075028-44075050 TGCTAAGAGCTGGCCTGGACCGG - Intronic
1128777114 15:70329020-70329042 TGCCATGAGGTGGCCTGGCCAGG - Intergenic
1130903721 15:88225775-88225797 TGCCGTGAGGTGTGGTGTACGGG - Intronic
1134608213 16:15587511-15587533 TGCCTGGAGGGGGCCTGGACTGG + Exonic
1135872123 16:26160887-26160909 TGGCATGAGGTTACCTGTGCAGG - Intergenic
1137720183 16:50623152-50623174 TGGCGTGATGTGGCCTGTGCTGG + Intronic
1138230239 16:55331206-55331228 TCCCATTGGTTGGCCTGTACCGG - Intergenic
1142256254 16:89015185-89015207 CGCCAGGAGGTGGCCTCTGCTGG + Intergenic
1143374877 17:6461591-6461613 GGGCATCAGGTGGCCTGCACTGG - Intronic
1144466101 17:15498969-15498991 TGCCACGAGTGGGGCTGTACAGG + Intronic
1144469540 17:15525217-15525239 TGCCATTAGGTGCCCGGCACTGG + Intronic
1144926815 17:18818458-18818480 TGCCATTAGGTGCCCGGCACTGG - Intergenic
1146506471 17:33409945-33409967 TGCCCTGAGCTGGTTTGTACTGG - Intronic
1148498201 17:48067864-48067886 TTACCTGAGGTGTCCTGTACTGG - Intergenic
1152379783 17:79936464-79936486 TCCCAGGAGGTGGCCTGGGCAGG + Exonic
1162515113 19:11142902-11142924 TCCCATCAGGCGGCCTGTGCCGG - Intronic
1163650227 19:18513203-18513225 TGCCAGGCCGTGGCCTGTGCTGG + Intronic
1165331225 19:35142172-35142194 TGCCATGAGATGGCCTGGGTTGG - Intronic
925113026 2:1352443-1352465 TGCTAGGAGGAGGCCTGCACAGG - Intronic
925384489 2:3452585-3452607 TGCCAGGATGCGGCTTGTACTGG + Intronic
927387756 2:22555674-22555696 GGCCAAGAGGTGGCATATACTGG + Intergenic
928347730 2:30516704-30516726 TAACATCTGGTGGCCTGTACAGG + Intronic
932863812 2:75321005-75321027 AGACATGAGGTGGCCAGTCCAGG + Intergenic
934127869 2:88915944-88915966 TGCCATGTGGAGGAGTGTACTGG + Intergenic
938741274 2:134234829-134234851 TGTCATGAGGTGGACTGAGCAGG + Intronic
940330496 2:152469173-152469195 AGCCAGGAGGAGGCCTGTCCTGG - Intronic
943965436 2:194327316-194327338 TGCCATGACATGGGCTGTAGTGG + Intergenic
943988400 2:194654034-194654056 TGCAATGTGGTAGCCTGGACTGG + Intergenic
1169546365 20:6654958-6654980 AGCCATGAGCTGGCGTGTCCTGG + Intergenic
1173227482 20:41170338-41170360 TGCTCTGAGGGGGCCTGTGCTGG - Intronic
1177520360 21:22213823-22213845 TGCCAAGAGGTGGCCTGCAAAGG + Intergenic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1181521669 22:23451969-23451991 TGCCATCGGATGGCCTCTACTGG - Intergenic
1181764176 22:25079450-25079472 TGTCAGGAGGTGGGCTGTGCTGG + Intronic
950011379 3:9726656-9726678 GGCAATGAGGAGGCCTGTAGGGG - Exonic
952103960 3:30048596-30048618 TCACATGAAGTTGCCTGTACAGG - Intergenic
956057157 3:65311969-65311991 GCCCATGAGGTGGTCTGGACTGG - Intergenic
960914694 3:122683283-122683305 TGCCAGGAAGTGGCCTCAACAGG + Intronic
961513632 3:127419721-127419743 TGCAGTGAGGTGGCCTTTTCTGG - Intergenic
961819377 3:129567441-129567463 TGCCTTGAGGTGGCTGGCACAGG + Intronic
962604844 3:137024549-137024571 TGCCATGAGCTGGCCAGAAGAGG - Intergenic
963604956 3:147405910-147405932 TGCCGGGAGGGGGCCTTTACAGG - Intronic
966077184 3:175951491-175951513 TGCCTTGAGGGGGCCTGCACTGG + Intergenic
968727319 4:2253790-2253812 TGCCTGGAGGTGGCCTGAACAGG + Intronic
973534658 4:51868342-51868364 TGCCATGAGGTGGGCTGCAGTGG - Intronic
978769481 4:112439390-112439412 GGCCATGACGTGACCTGTCCTGG - Intronic
985494198 5:195538-195560 TGCCATGCGGTGCCCTTTAGTGG + Intergenic
986763968 5:10906446-10906468 TGCCATGAGGTAGACAGTAGAGG - Intergenic
997039321 5:130233186-130233208 AGCAATGTGGTAGCCTGTACCGG + Intergenic
997388401 5:133493630-133493652 AGCCCTGAGGTGGCCCGTGCTGG + Intronic
1001744733 5:174083486-174083508 TGGCAAGAGGTGGACTGTGCTGG + Intronic
1001856932 5:175020958-175020980 TGGCATGAGATGGCCCTTACTGG - Intergenic
1004319048 6:14618290-14618312 TGCCCAGAGGAGGCCTGAACAGG - Intergenic
1019660515 7:2221289-2221311 TCCCATGTGCTGGGCTGTACTGG - Intronic
1022195798 7:28066270-28066292 AGCCCTGACCTGGCCTGTACCGG - Intronic
1023401005 7:39793024-39793046 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1023493707 7:40771471-40771493 TGCCATGAGGTTGTCAGTGCTGG + Intronic
1023878432 7:44305551-44305573 TCCCCTGAGGTGCCCTGCACTGG + Intronic
1024074450 7:45811493-45811515 TGCCTCTCGGTGGCCTGTACAGG + Intergenic
1024074783 7:45812851-45812873 TGCCTCTCGGTGGCCTGTACAGG + Intergenic
1024523387 7:50327534-50327556 TGGCATGAGGAGGCAGGTACTGG - Intronic
1024648627 7:51387753-51387775 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025052576 7:55742578-55742600 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025052956 7:55744035-55744057 TGCCTCTCGGTGGCCTGTACAGG - Intergenic
1025129861 7:56369585-56369607 TGCCTCTCGGTGGCCTGTACAGG - Intergenic
1025130161 7:56370814-56370836 TGCCTCTCGGTGGCCTGTACAGG - Intergenic
1025130481 7:56372112-56372134 TGCCTCTCGGTGGCCTGTACAGG - Intergenic
1025130800 7:56373406-56373428 TGCCTCTCGGTGGCCTGTACAGG - Intergenic
1025131116 7:56374703-56374725 TGCCTCTCGGTGGCCTGTACAGG - Intergenic
1025176391 7:56804426-56804448 TGCCTCCCGGTGGCCTGTACGGG + Intergenic
1025178155 7:56812223-56812245 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025178586 7:56813962-56813984 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025179024 7:56815752-56815774 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025179480 7:56817638-56817660 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025179929 7:56819476-56819498 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025180404 7:56821458-56821480 TGCCTCCCGGTGGCCTGTACAGG - Intergenic
1025180847 7:56823296-56823318 TGCCTCCCGGTGGCCTGTACAGG - Exonic
1025181274 7:56825047-56825069 TGCCTCCCGGTGGCCTGTACAGG - Intronic
1025181720 7:56826885-56826907 TGCCTCCCGGTGGCCTGTACAGG - Intronic
1025182853 7:56832425-56832447 TGCCCCCAGGTGGCCTCTACAGG - Intergenic
1025689073 7:63744549-63744571 TGCCCCCAGGTGGCCTCTACAGG + Intergenic
1025690197 7:63750110-63750132 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025690644 7:63751933-63751955 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025691095 7:63753756-63753778 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025691529 7:63755532-63755554 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025691969 7:63757355-63757377 TGCCTCCCGGTGGCCTGTACAGG + Exonic
1025692418 7:63759178-63759200 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025692862 7:63761001-63761023 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025693278 7:63762680-63762702 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025693721 7:63764503-63764525 TGCCTCCCGGTGGCCTGTACAGG + Intergenic
1025695398 7:63771960-63771982 TGCCTCCCGGTGGCCTGTACGGG - Intergenic
1026874724 7:73872537-73872559 TGCCTGGTGGTGGCCTGGACAGG + Intergenic
1031844367 7:126786629-126786651 TGCCATGAGGTGGCCTGTACAGG - Intronic
1032051496 7:128653361-128653383 TGCCTCCTGGTGGCCTGTACAGG + Intergenic
1032725403 7:134586196-134586218 TAACATTTGGTGGCCTGTACAGG + Intergenic
1037570667 8:20155214-20155236 TAACATCTGGTGGCCTGTACAGG + Intronic
1041966935 8:63689059-63689081 GTCCCTGAGGTGGCCTGCACAGG - Intergenic
1049969736 9:811336-811358 TGCCATGCGGTGGCATGTGGCGG - Intergenic
1054769836 9:69073327-69073349 TGCCAAGGTGTGGCCTGCACTGG + Exonic
1056534652 9:87516991-87517013 TTCCCTGAAGTGGCATGTACTGG - Intronic
1059389716 9:113991290-113991312 GCCCATGAGGTGGCCGGGACAGG - Intronic
1060611300 9:124967723-124967745 TGCCAGGGTGTGGCCTGCACTGG - Intronic
1061822336 9:133235533-133235555 TCCCAGGAGGTGACCTGGACAGG - Intergenic
1187296312 X:18004316-18004338 TGCCATGAAGTGGTTTCTACTGG - Intergenic
1187958286 X:24542361-24542383 TGCCATGAGCTGGACTACACAGG + Intergenic
1189744786 X:44158338-44158360 TTCCAGGTGGTGGCCTGTCCTGG + Intronic
1190373227 X:49763353-49763375 TGCCATGAGGGGGCCAGTGTGGG + Intergenic
1190760779 X:53436395-53436417 TGCAATAAGGTGGCCTGGACAGG - Intergenic