ID: 1031844503

View in Genome Browser
Species Human (GRCh38)
Location 7:126788486-126788508
Sequence TGTAGTATAAGTAGGATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031844503 Original CRISPR TGTAGTATAAGTAGGATGGG AGG (reversed) Intronic
903962556 1:27065684-27065706 TGCAGTATGAGTGGGGTGGGAGG + Intergenic
911158274 1:94657196-94657218 TGGAATATATGTATGATGGGGGG - Intergenic
911838101 1:102646552-102646574 TGTATTTTATGTGGGATGGGAGG - Intergenic
916312190 1:163409802-163409824 TGTAGTATAATTTGGGTGGGTGG - Intergenic
917111134 1:171549291-171549313 TGTAGTATCAGCATAATGGGAGG - Intronic
918309724 1:183276951-183276973 TGTAGGATAACCAAGATGGGAGG - Intronic
918546786 1:185693711-185693733 TGGAGTGCAAGTAGGATGGTTGG - Intergenic
1063439498 10:6061130-6061152 TGTAGTACCAGCAGTATGGGAGG + Intronic
1065548233 10:26843728-26843750 GGTAGGAGAGGTAGGATGGGTGG + Intronic
1065858948 10:29854524-29854546 TGGAGTATAGTTAGGATAGGTGG + Intergenic
1072933859 10:99693078-99693100 GGTAGTGTGAGTAGGGTGGGAGG + Intronic
1076490937 10:130861056-130861078 TGTCCTATAAGCAGGATGGAGGG - Intergenic
1078485782 11:11722115-11722137 AAAAGTATAAGTAGGCTGGGTGG - Intergenic
1079842604 11:25423478-25423500 TGTAGTATAAGAAGCATTGCAGG + Intergenic
1089128634 11:116194679-116194701 TGTAAAATAAGTAGGCTGGGTGG - Intergenic
1089632373 11:119791781-119791803 TGGAGTATCAGTAGGAGGGGAGG - Intergenic
1090514988 11:127415583-127415605 TGTAGTGAAAGAAGGGTGGGGGG - Intergenic
1092686738 12:11057252-11057274 TGTAGTCTTAGTAGTTTGGGAGG - Intronic
1095523829 12:43101197-43101219 TGTAGAAAAAATAGGATGGTTGG + Intergenic
1099074132 12:78083611-78083633 TGAAGTACAAGTAGAATGGAAGG - Intronic
1101979202 12:109390954-109390976 TTGAGTGAAAGTAGGATGGGTGG - Intronic
1104622804 12:130331126-130331148 TGTAATATATGTAAGATGCGGGG - Intergenic
1107585872 13:41847754-41847776 TTTATTCTAAGTATGATGGGAGG + Intronic
1107723074 13:43269596-43269618 TTTAGCATAAGTAGGATTGAAGG + Intronic
1116673579 14:47875857-47875879 TGGAGAAAAAGTAGGATGGAGGG - Intergenic
1119491708 14:75039665-75039687 AGTAGTGTAAGTAGGTTTGGAGG - Intronic
1120420592 14:84281244-84281266 TACAGTATAAATAAGATGGGAGG + Intergenic
1121773385 14:96572870-96572892 GGTAGTATAACTGGGATGTGGGG + Intergenic
1124161564 15:27274725-27274747 TGTTATATAAGTAGGAAGGATGG - Intronic
1124827712 15:33115242-33115264 TGTCCTATAAGGAGGGTGGGAGG + Intronic
1125732265 15:41899776-41899798 TGTAGTTTAAGTATGATAAGTGG + Exonic
1127408584 15:58680937-58680959 TGTAGTTTCAGTTAGATGGGAGG - Intronic
1129883970 15:79025887-79025909 TTTTTTACAAGTAGGATGGGAGG - Intronic
1132633662 16:932175-932197 TCTACTCTAAGTAGGGTGGGGGG - Intronic
1133057192 16:3151303-3151325 TGTATTTTTAGTAGGGTGGGGGG + Intergenic
1134849951 16:17471092-17471114 CGTAGTGGGAGTAGGATGGGGGG + Intergenic
1143555781 17:7659065-7659087 TGTAGTATATGGGGGAGGGGAGG + Intergenic
1144278324 17:13699032-13699054 TGTAGTATAACAAGGATCAGGGG + Intergenic
1145831396 17:27919389-27919411 CGTAGTGTAAGTAGGATTTGGGG - Intergenic
1146579280 17:34022391-34022413 GGTTGTATAGGTGGGATGGGAGG - Intronic
1150769578 17:68029867-68029889 CGAAGTAGAAGTGGGATGGGAGG - Intergenic
1151824644 17:76517525-76517547 TGTAGTAGGGGTAGGAGGGGTGG - Intergenic
1153231453 18:2940773-2940795 TGTAGTATCAGTAGGTTTGGGGG - Intronic
1157913980 18:51646405-51646427 AATAGTATAAGTAGAAAGGGTGG + Intergenic
1158070708 18:53466860-53466882 TGTAGTTTTTGTAGGATGTGTGG + Intronic
1159875847 18:73810058-73810080 TATAGTATAAGTAGTATATGAGG + Intergenic
1163388308 19:17013971-17013993 TGTAGTGTAGGAAGGATGGAAGG - Intronic
1166356696 19:42231383-42231405 TCTACTGTCAGTAGGATGGGCGG + Intronic
928220078 2:29396173-29396195 TGGAGTATAAGCAGCACGGGAGG - Intronic
938791585 2:134681120-134681142 GGCAGTATAAGTTGGATGGAGGG - Intronic
940790042 2:158022621-158022643 TGCAGTAGAAGTAGCATGGTAGG - Intronic
943990225 2:194680242-194680264 TGTAGTAGAAGTAAGATCTGAGG + Intergenic
946255080 2:218436206-218436228 TGTAGTAGCAGTAGGAGGGATGG + Intronic
1169331189 20:4717640-4717662 TGGAGTATGGGGAGGATGGGAGG - Intergenic
1169629180 20:7607094-7607116 TGTAGTGTGAGTAGGATTGGGGG + Intergenic
1174770807 20:53298378-53298400 TGGAGTGTAAGTTGGATGGATGG + Intronic
1175007254 20:55698065-55698087 TGTAGGATAATTAGGATGGGTGG - Intergenic
1175710896 20:61220081-61220103 TGAGGAATAAGTAGGATGGCAGG - Intergenic
1178140208 21:29674407-29674429 TGTAGGAGTAGTAGAATGGGAGG + Intronic
1180715171 22:17866572-17866594 TGGACTATGAGTAGGATGGAAGG + Intronic
949336658 3:2982281-2982303 GGTAGTAAAAGTAGAATGGAAGG - Intronic
949441924 3:4090843-4090865 AATAGTAGAAGTATGATGGGAGG + Intronic
951285405 3:20806357-20806379 TGTAACATAAGTAGCATGGTTGG - Intergenic
952198310 3:31098943-31098965 TGTAGGAGAAGTAGGAGGTGAGG - Intergenic
953172267 3:40517932-40517954 TGAAGAATAAGTAGGGTGGGTGG - Exonic
953291599 3:41669512-41669534 TGTAGTCTCAGCAGGTTGGGAGG - Intronic
955454993 3:59110349-59110371 TTTATTCTAAGTATGATGGGAGG + Intergenic
957667999 3:83261348-83261370 TGAAATATAAGTTGGATGGCTGG - Intergenic
961179711 3:124867080-124867102 TGAAGCATCAGTAGGATTGGAGG - Intronic
961258871 3:125583282-125583304 AGTATTATAAGTGGGATGGCCGG + Intronic
969203208 4:5622287-5622309 TGTAGTAACAAGAGGATGGGTGG - Intronic
969851849 4:9963686-9963708 TGTAGAAAAAGGAGGTTGGGAGG + Intronic
970148131 4:13058552-13058574 TATAGTATAAGTTGGAAGGCTGG - Intergenic
973156379 4:46959253-46959275 TCTAGAATCAGGAGGATGGGTGG + Intronic
973865501 4:55108999-55109021 AAGTGTATAAGTAGGATGGGAGG - Intronic
979881531 4:125965113-125965135 TGTAATATAATTTGGATAGGAGG + Intergenic
981661070 4:147167214-147167236 TGTAGTATAAGAAGTATAGAAGG + Intergenic
988799709 5:34684786-34684808 TTTAGAATAATTAGGATGTGGGG + Intronic
990194048 5:53293012-53293034 TGAAGCCAAAGTAGGATGGGTGG - Intergenic
990767272 5:59198733-59198755 AGAAGTAGAAGAAGGATGGGAGG - Intronic
991096466 5:62745092-62745114 TGCAGTATAATTAGGGTGTGGGG - Intergenic
991919571 5:71642262-71642284 TGGCGGATAAGAAGGATGGGAGG + Intronic
993846684 5:92953284-92953306 GGTAGTAGAGGTAGGTTGGGTGG + Intergenic
994215086 5:97128898-97128920 GGGAGTATAGGTTGGATGGGAGG - Intronic
995539330 5:113169159-113169181 TGTTTTATAGGTAAGATGGGAGG + Intronic
995605013 5:113844879-113844901 TTCAGAATAAGCAGGATGGGAGG - Intergenic
996378100 5:122836600-122836622 TGTAGTGGAAGTAGGAAAGGAGG + Intergenic
996839607 5:127833490-127833512 TGTAGTATAAGGAGGATACATGG - Intergenic
997131097 5:131277300-131277322 TGAAGTTAAAGTAGGATGGCGGG - Intronic
998337267 5:141384258-141384280 TGTAGACTGAGTAGGATGAGTGG - Exonic
998385391 5:141754382-141754404 TGAAGTAGAAGTAGGGCGGGGGG + Intergenic
1000327116 5:160180623-160180645 TGTAGTCTCAGGAGGTTGGGAGG + Intergenic
1000335146 5:160236492-160236514 TGTAAAATAAGTATAATGGGAGG - Intronic
1003486914 6:6588026-6588048 GGTAGAAAAAGTAGGAAGGGTGG - Intergenic
1003784681 6:9471718-9471740 TGTAGTTCAAGTAGAATGTGTGG - Intergenic
1007040496 6:38716852-38716874 TGTAGTATTCCTAGGAGGGGAGG + Intronic
1011421272 6:87176055-87176077 TGTAGTATATGTGTGGTGGGGGG + Intronic
1012697949 6:102413331-102413353 AGTAGTATAAATAAGATAGGTGG + Intergenic
1015998502 6:139018821-139018843 TGTAGTAAAAGGAGGACAGGAGG + Intergenic
1020637887 7:10718335-10718357 TATAGTATATGTAGGTTGTGTGG - Intergenic
1020653903 7:10907838-10907860 TGTATTTTTAGTAGGATGGGGGG - Intergenic
1027503784 7:78989275-78989297 TGTAATAAAAGTATGACGGGTGG - Intronic
1027781272 7:82523484-82523506 TTTATTCTAAGTGGGATGGGAGG + Intergenic
1030421682 7:109314294-109314316 TGTAGTATAAGTTGAATTTGGGG - Intergenic
1031844503 7:126788486-126788508 TGTAGTATAAGTAGGATGGGAGG - Intronic
1037520548 8:19676606-19676628 TGTAGTATAAGAAGGAACAGAGG + Intronic
1038209658 8:25504385-25504407 TGTAATATCAGTAGTTTGGGAGG - Intronic
1038246637 8:25863342-25863364 TGTAGTATTCGTGGGGTGGGGGG - Intronic
1042056506 8:64769805-64769827 TGTATGCTCAGTAGGATGGGGGG - Intronic
1045689936 8:104749809-104749831 TATAGTGGGAGTAGGATGGGGGG + Intronic
1049923919 9:390704-390726 TTTAGTGGAAGAAGGATGGGAGG - Intronic
1050867316 9:10519041-10519063 TGTAGTATCAGAAAGCTGGGAGG - Intronic
1051110308 9:13627729-13627751 TGTAGTATCAGTAGGGCTGGGGG - Intergenic
1054874952 9:70086279-70086301 TGTAGTGGAAATCGGATGGGAGG - Intronic
1055983030 9:82024704-82024726 TGGAGTATAGGTAGGAGGGAAGG + Intergenic
1056200838 9:84274930-84274952 TGTAGTTTAATTAGGCTGGTAGG - Intergenic
1060911423 9:127354194-127354216 TGTAGAAAAACTAGGATTGGAGG - Intronic
1203655474 Un_KI270752v1:20042-20064 GGTACTATGAGTTGGATGGGAGG + Intergenic
1186361899 X:8851088-8851110 TGTAGTCTGAGCAGAATGGGTGG + Intergenic
1187399951 X:18950748-18950770 TGTAGGATATGTAGGATGGGAGG - Intronic
1188056907 X:25552163-25552185 TTAAGTATATGTAGGGTGGGAGG + Intergenic
1194461709 X:94177617-94177639 TGTAGTATATGTGGGATAAGGGG - Intergenic
1194947258 X:100083924-100083946 TTCAGAATGAGTAGGATGGGAGG - Intergenic
1195918557 X:109959578-109959600 TGAAGCATAAGTAGGGTGAGTGG - Intergenic
1197718098 X:129724656-129724678 TGTAGGATAGGTAGGATATGAGG + Intergenic
1201971826 Y:19806181-19806203 TGTAGTATAAGATGGAAGGCAGG - Intergenic
1202056278 Y:20834601-20834623 TATAGTTTCAGTAGGATTGGTGG + Intergenic