ID: 1031845619

View in Genome Browser
Species Human (GRCh38)
Location 7:126802710-126802732
Sequence CTGCAGCTCTTAAGGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031845619_1031845622 17 Left 1031845619 7:126802710-126802732 CCTATTTTCCTTAAGAGCTGCAG 0: 1
1: 0
2: 0
3: 9
4: 178
Right 1031845622 7:126802750-126802772 CTAGAAGCCATGCCACAAACTGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031845619 Original CRISPR CTGCAGCTCTTAAGGAAAAT AGG (reversed) Intronic
903138831 1:21326548-21326570 ATCCAAATCTTAAGGAAAATAGG + Intronic
904880016 1:33689266-33689288 CTGCAGCTCTCAGTGAAACTGGG + Intronic
907196819 1:52693714-52693736 CGGCAGCTTCTAATGAAAATAGG + Intronic
907927294 1:58966524-58966546 CTGCAGCTCTGCAGTCAAATAGG - Intergenic
911161872 1:94689379-94689401 CTGGAGCCCTTTAGAAAAATGGG + Intergenic
912080951 1:105935055-105935077 CTGCAGCTCTACAGGGAATTAGG - Intergenic
916361737 1:163977602-163977624 CTGGCGCTCATAAGAAAAATAGG - Intergenic
916411898 1:164554334-164554356 CTTCATCTCTTAAGGAAGATGGG + Intergenic
916633858 1:166646746-166646768 CAGCAGCTTAAAAGGAAAATCGG + Intergenic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919969732 1:202567251-202567273 CTGCTGCTCTAAAAGAAAAATGG + Intronic
920279734 1:204833859-204833881 CTGCAGCTCATCTGCAAAATGGG + Intronic
921376693 1:214481639-214481661 CTGCTGCTCTGAAGTAAGATTGG + Intronic
921737006 1:218640401-218640423 CACAAGCTCTTAAGGGAAATAGG - Intergenic
921871764 1:220148114-220148136 CTTCACCTCTTAAGGGAAACAGG - Intergenic
1062969856 10:1639105-1639127 CTGGAGCACTTCAGGAGAATGGG + Intronic
1063475362 10:6323822-6323844 CTGCAGCTTCTGTGGAAAATGGG + Intergenic
1065696240 10:28382747-28382769 CTGCAGCTCTTCCGTAAAACAGG + Intergenic
1068785508 10:60968160-60968182 CTGCACCTCTACAGGAAAACTGG + Intronic
1068863807 10:61873500-61873522 ATGCAGCTGTGAAGTAAAATTGG - Intergenic
1070783467 10:79150286-79150308 CAGCAGCTCTCATGGGAAATAGG - Intronic
1071094411 10:81956759-81956781 CTGGAGGTTTTAAGTAAAATAGG - Intronic
1072855757 10:98944316-98944338 CAGCATTTCTTAAGGCAAATGGG + Intronic
1073945626 10:108746889-108746911 TAACAGCTCATAAGGAAAATAGG + Intergenic
1076133301 10:128028467-128028489 CTGCATTTCTTAGGAAAAATGGG + Intronic
1078085754 11:8232238-8232260 ATGCAGCTCTAAAGGTTAATTGG + Intronic
1079710833 11:23680424-23680446 CTGCAGCTATGAAGGGAAGTGGG + Intergenic
1084403116 11:68956239-68956261 CTCCAGCTCGTAAACAAAATGGG - Intergenic
1086471204 11:87113206-87113228 CTGCAGCTTTTTAGTAAAAATGG - Intronic
1087165392 11:94998124-94998146 CTACAGTTCTCAAGGAAAATGGG + Exonic
1087168392 11:95026300-95026322 CTACAGTTCTCAAGGAAAATGGG + Exonic
1088464938 11:110125101-110125123 TAGCTACTCTTAAGGAAAATGGG + Intronic
1090418086 11:126554753-126554775 CTGCAGCCCTTAGTGAAAACAGG + Intronic
1091157869 11:133390501-133390523 CTGCAAGTCTGAAGAAAAATAGG + Intronic
1091433759 12:458097-458119 CTGCAGTTCTTTAGCAAAAAGGG - Intergenic
1095379806 12:41577216-41577238 CTGGAGCTTTTAAAGAAAAAAGG - Intergenic
1095537942 12:43274222-43274244 CTATAGTTCTTCAGGAAAATTGG - Intergenic
1096232657 12:49904885-49904907 CTGCAGCTCCTACGAAAAAGAGG + Intergenic
1096279816 12:50243138-50243160 CTGCAGCTATAAAGGACCATGGG + Intronic
1098067774 12:66637678-66637700 CTGCAGTCTTTATGGAAAATTGG - Intronic
1098499247 12:71171349-71171371 TTGCAGGTTTTCAGGAAAATTGG + Intronic
1098546579 12:71718212-71718234 ATTCAGCTCTTAGGGAAAAATGG - Intergenic
1100090061 12:90957304-90957326 CTGCTTCTCTTAAGAAAATTCGG - Intergenic
1100730800 12:97465670-97465692 CTGAATATCTTCAGGAAAATGGG + Intergenic
1101881362 12:108628374-108628396 CTGCTGCCCTGAAGGCAAATTGG - Intronic
1102560910 12:113761851-113761873 CTTCTGGTCCTAAGGAAAATGGG - Intergenic
1102720926 12:115015314-115015336 CTGCACAGGTTAAGGAAAATTGG + Intergenic
1102795059 12:115682026-115682048 CCCCAGCTCTAAAGGGAAATGGG + Intergenic
1106298205 13:28437700-28437722 CTTCATCTCTTAGGGAAAAAGGG - Intronic
1109589706 13:64462606-64462628 CTGCGGCCCTAAATGAAAATAGG + Intergenic
1111105462 13:83640212-83640234 CTGGAGCACATAAGGCAAATGGG + Intergenic
1112931527 13:104745268-104745290 CTCCACCTCTTTAGGAAAAATGG - Intergenic
1113264350 13:108600896-108600918 CAGCAGGTCTTATTGAAAATGGG + Intronic
1115413114 14:33098818-33098840 CCACCACTCTTAAGGAAAATGGG - Intronic
1116849208 14:49892371-49892393 CTGCAGTTTTTAAGAAACATGGG + Intergenic
1117476488 14:56100574-56100596 CTGCAGCCCTCAAGGAGATTAGG - Intergenic
1119147723 14:72332092-72332114 CTGCACCTCCTAAGGAACTTGGG - Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1125739017 15:41948613-41948635 CTGCAGAAATTAAGGAAAACAGG - Intronic
1126241903 15:46454542-46454564 GTGCTTCTCTCAAGGAAAATGGG + Intergenic
1126326728 15:47486511-47486533 CTTGAGCTCATAATGAAAATGGG - Intronic
1129621351 15:77149711-77149733 CTTGAGCACTTAAGGAAAACTGG + Intronic
1131402347 15:92135189-92135211 CTGCAACTCTGAAGGAACACAGG - Intronic
1133108858 16:3533562-3533584 CTGGAGCACTTAAGCAAAAGGGG + Intronic
1134017996 16:10902536-10902558 CTACTGCTCTTAGGGAAATTAGG + Intronic
1134071520 16:11262985-11263007 ATGCAGTTCTTAAGGAGCATGGG - Intronic
1134194307 16:12147248-12147270 ATGCAGCTGTTAAGGGAAAAGGG + Intronic
1134475183 16:14567498-14567520 CTGCAGCTTTTACCAAAAATGGG - Intronic
1135190068 16:20347600-20347622 CTGAATCTCTTAAGCAAATTTGG - Intronic
1135758619 16:25118495-25118517 ATGCAGCTCTTATGGAGCATTGG + Intronic
1137438705 16:48480373-48480395 CAGCAGCTCCTAGGTAAAATTGG - Intergenic
1137883519 16:52077638-52077660 ATGCAGCCCTTAAGCAAAGTGGG - Intronic
1140591558 16:76359243-76359265 GTGAAGCTCTTAAAGGAAATTGG - Intronic
1141553143 16:84819615-84819637 CTGCAGCTCAACTGGAAAATAGG - Intergenic
1144649675 17:16999511-16999533 GTGCAGCTGTTAAGGAAAACAGG - Intergenic
1145911212 17:28544279-28544301 CTGCAGCTGCTAAGTAAAACTGG - Intronic
1150851344 17:68706658-68706680 CTGGAGCTCTAGAGGAAATTTGG + Intergenic
1152994367 18:392626-392648 CTTCAGCTACTAAGGAAAAAGGG + Intronic
1153157900 18:2169666-2169688 CTGGAAATCCTAAGGAAAATGGG - Intergenic
1154162898 18:11993336-11993358 CTGTAGCTCTTCATGAAGATGGG - Intronic
1155783891 18:29874319-29874341 ATGCAGCTCACCAGGAAAATAGG + Intergenic
1157434171 18:47654522-47654544 CTGCAACTCTAGAGGTAAATGGG + Intergenic
1158737772 18:60103430-60103452 CAGCAGCTGTTAAAGTAAATAGG - Intergenic
1159103083 18:63976856-63976878 CAGCAACTCTTGGGGAAAATGGG + Intronic
1162986317 19:14272462-14272484 CTCCAGCTCTGAAGGAATGTGGG + Intergenic
1165961288 19:39536728-39536750 CTGCAAATTTAAAGGAAAATAGG + Intergenic
1166918099 19:46209563-46209585 CTGCAACTACTAAGAAAAATAGG + Intergenic
1167037699 19:47003833-47003855 CTGCTGCTCTTAGGGAAAGGAGG + Exonic
925832506 2:7910122-7910144 CAGCAACTCTAAATGAAAATGGG - Intergenic
926829247 2:16942532-16942554 CTGGAGCTCTTAAAGAAAGTGGG - Intergenic
929351501 2:40961505-40961527 CTTCATCTGTGAAGGAAAATGGG + Intergenic
930804164 2:55473276-55473298 CTCCATCTCTTAAAAAAAATGGG + Intergenic
930847193 2:55918758-55918780 CTTCAGCTCCTAAGGAACAGAGG + Intronic
932404969 2:71506729-71506751 CTGAGGCTCTTAAGGGAAAGTGG - Intronic
932514820 2:72334869-72334891 CATCAGGTCTTAAGGAAAAGGGG - Intronic
932641627 2:73453294-73453316 CTAAAACTCTTAAGGAAATTCGG + Exonic
933310356 2:80652683-80652705 GTAAGGCTCTTAAGGAAAATAGG + Intergenic
934789498 2:97046694-97046716 CTGCAGCTATCAATGTAAATAGG - Intergenic
934874854 2:97908175-97908197 CCTCAGGTGTTAAGGAAAATAGG - Intronic
938936284 2:136130477-136130499 CAGTCGTTCTTAAGGAAAATAGG + Intergenic
940337532 2:152544841-152544863 CAGCTGATCTAAAGGAAAATTGG - Intronic
942618982 2:177827144-177827166 ATGTAGCACTTAAGGATAATGGG - Intronic
944505648 2:200408049-200408071 CTGGAGCTATAAAGGAAAAGGGG + Intronic
947856114 2:233325760-233325782 CTGCAGGGCTTCAGGAAAGTGGG + Intronic
1168852983 20:989328-989350 CTGCACCTCTTCTGCAAAATAGG + Intronic
1170705601 20:18742324-18742346 CTACAGCTTTTCAGGTAAATGGG + Intronic
1170765311 20:19284954-19284976 CAGCAGTTATTAAGGGAAATGGG - Intronic
1174619028 20:51859892-51859914 CTGCAGCTGTCCAGGGAAATGGG - Intergenic
1174693032 20:52528383-52528405 ATACAGTACTTAAGGAAAATGGG - Intergenic
1176034677 20:63030422-63030444 GAGCAGCGCTGAAGGAAAATCGG - Intergenic
1178932780 21:36834198-36834220 CTGCAGCTCTTCATGAATACTGG + Intronic
1179285051 21:39970051-39970073 CTTCAGTTCTATAGGAAAATTGG - Intergenic
1182248916 22:28983970-28983992 CAGCAGCCCTTCAGGAAACTGGG - Intronic
949396348 3:3618214-3618236 CTGAAACTCTTAAACAAAATTGG + Intergenic
951612228 3:24503243-24503265 CTGCCTCTCTTGAGGAAATTTGG - Intergenic
952324847 3:32311963-32311985 CTTCAGCTTTTAAAGAAAAAAGG + Intronic
955488937 3:59463305-59463327 CTTCAGCTATTACGGATAATCGG - Intergenic
958425374 3:93973374-93973396 CTTCAGCTTTGAAGGGAAATGGG + Intronic
958843160 3:99233115-99233137 CTCCAGCTGTTCAGGAAAAGAGG - Intergenic
960461717 3:117943832-117943854 CTGCAGCTCTTAAGGATTGTGGG - Intergenic
963413086 3:144956814-144956836 ATACAGCTCTTAAGACAAATTGG + Intergenic
965276916 3:166695518-166695540 CTGCAGCTCTGAATGAGACTTGG - Intergenic
967261834 3:187649979-187650001 CTGAACCTCGGAAGGAAAATGGG - Intergenic
967649940 3:191973744-191973766 CTGCAGCTGCTAAGGAAAGAGGG + Intergenic
970830901 4:20338621-20338643 CTGCATATGTTCAGGAAAATTGG + Intronic
972517744 4:39824540-39824562 TGGCAGCTTTTAAGGAAAGTTGG - Exonic
974929654 4:68347755-68347777 CTTCCTCTCTTAAGGAAAAGTGG - Intronic
978291822 4:107151068-107151090 CTGTAAATCTTTAGGAAAATTGG - Intronic
978611383 4:110544990-110545012 CTGCAGCACATGAGGAAAATGGG + Intronic
981664404 4:147206818-147206840 TTGCATATCTAAAGGAAAATAGG + Intergenic
982297909 4:153848784-153848806 CTCCTGCTCTCAAGGAGAATAGG - Intergenic
986125125 5:4877239-4877261 ATGCAGCGTTTAAGGAAACTGGG + Intergenic
987749755 5:22024262-22024284 TTGCAGCTCTAAAGGATTATTGG - Intronic
987775208 5:22356745-22356767 CTACATCTCTTAATCAAAATAGG - Intronic
991138427 5:63210684-63210706 ATGCAGGACTTAAGGCAAATAGG - Intergenic
992146273 5:73852708-73852730 ATGCAGTTCCTCAGGAAAATTGG - Intronic
993091880 5:83436657-83436679 CAGCAGCTATTAACGAACATCGG - Intergenic
996307082 5:122059655-122059677 CTGCAGTTCTTGAAGAACATGGG + Intronic
1005268756 6:24140904-24140926 CTGCTGCTGGAAAGGAAAATTGG - Intronic
1006206134 6:32344818-32344840 CTGAAACTGTTAAGGAAACTTGG + Intronic
1011887174 6:92110396-92110418 CTGGAGCTTTTAAAGAAAAAAGG + Intergenic
1015132061 6:129823119-129823141 GTTCAGCTATTAAGGTAAATTGG + Intergenic
1015834886 6:137409670-137409692 TGGCAGCTTTTAAGGAAATTTGG + Intergenic
1017164386 6:151393517-151393539 TAGCAGCTCTTAAAGAGAATAGG - Intergenic
1017698758 6:157046788-157046810 TAGCAGCTCTAAAGGAAATTAGG - Intronic
1018342395 6:162865157-162865179 CTGCGGCTCTCAATGATAATTGG + Intronic
1023390012 7:39700657-39700679 CTTCAGCTCTTGATGAAAAGTGG + Intronic
1025171746 7:56764555-56764577 CTGTGGCTATTTAGGAAAATGGG - Intergenic
1025700118 7:63810983-63811005 CTGTGGCTATTCAGGAAAATGGG + Intergenic
1026824746 7:73574374-73574396 CTGCAGCTCTGAAGGTACGTGGG - Exonic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1031451722 7:121929015-121929037 CTTCATCTATTAAGTAAAATTGG - Intronic
1031845619 7:126802710-126802732 CTGCAGCTCTTAAGGAAAATAGG - Intronic
1032308003 7:130754827-130754849 CTGCAGCTCTTGAGGTCAGTGGG - Intergenic
1032510126 7:132465810-132465832 CTCCAGCTCTGCAGGAAAAGTGG - Intronic
1032646088 7:133825480-133825502 CTGGAGCTCTTACTGAAAGTTGG + Intronic
1033168244 7:139060077-139060099 CTGCAGTTCTAAAGCAGAATAGG + Intronic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1035249583 7:157588236-157588258 CTGCAGCTCTTTCTAAAAATAGG + Intronic
1038012197 8:23483967-23483989 CTGGAGATCTTCAGGAAGATAGG + Intergenic
1038124961 8:24663400-24663422 CTGCAGCACTCAGGGAAAAGAGG - Intergenic
1041132860 8:54721341-54721363 CTGGAGCTCTGAAGGGAAACAGG + Intergenic
1044517118 8:93152432-93152454 GTGCTTCTGTTAAGGAAAATTGG + Intronic
1045853183 8:106728103-106728125 AGGCAGCTCTTAAGAAAATTGGG + Intronic
1046007888 8:108508019-108508041 ATGCAATTCTTAAGGAAAAGAGG + Intergenic
1046526545 8:115388350-115388372 CTGAAGCTCTTGAGGACATTCGG - Intergenic
1046777582 8:118180289-118180311 CTGTGGCACTTAAGGAATATGGG + Intergenic
1047084675 8:121503492-121503514 TTGCATCTCTAAAGGAAAGTAGG - Intergenic
1048584934 8:135767096-135767118 CTGCAGCTGTTAAGTTAAAAGGG - Intergenic
1048980416 8:139700831-139700853 ATGCATTTCTTAAGGAAAACTGG + Intronic
1051356559 9:16244466-16244488 CTGAAGATCCTAAGGAAAAGAGG - Intronic
1052584543 9:30409485-30409507 CAGAAGCTGTTAAGGAAAAGAGG - Intergenic
1056090661 9:83202246-83202268 ATGCAGCTTAAAAGGAAAATTGG + Intergenic
1058421423 9:104836669-104836691 CTGCAGCCAAAAAGGAAAATAGG + Intronic
1059003815 9:110379672-110379694 CTGCTGCTGTTGAGAAAAATTGG + Intronic
1059308277 9:113371511-113371533 CTGCAGCTCCCAAAGAAAGTGGG - Intergenic
1061841494 9:133360902-133360924 CTGCAGCTGTTAAGGAAACGGGG + Intronic
1061872312 9:133527629-133527651 TTGCAGCGATTAAGGAGAATGGG + Intronic
1192345599 X:70301696-70301718 CTGAAGTTCCTAAGGAAGATTGG + Intronic
1192597327 X:72425128-72425150 GTGCAGCTGCTATGGAAAATAGG - Intronic
1194763115 X:97817280-97817302 CTGCAGCTCTAAATGAAGACAGG - Intergenic
1194824570 X:98545741-98545763 TTGCAGCTCTTCAGTAAAAAGGG - Intergenic
1196793702 X:119486141-119486163 CTGCAACCCTCAAGGACAATTGG + Intergenic
1197572157 X:128163152-128163174 CTGCAGCTGTTGTGGGAAATGGG + Intergenic
1199014578 X:142799301-142799323 CACCAGCTCTTAGGAAAAATAGG - Intergenic
1199169651 X:144721178-144721200 CTGCAGCTCAGAAGGAAAAAAGG + Intergenic
1200296821 X:154928340-154928362 CTGCAGCTCATAAGGTTGATAGG + Intronic