ID: 1031846885

View in Genome Browser
Species Human (GRCh38)
Location 7:126815973-126815995
Sequence CTAAACATACAAATACACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 762
Summary {0: 1, 1: 0, 2: 3, 3: 61, 4: 697}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031846882_1031846885 12 Left 1031846882 7:126815938-126815960 CCTTCCATGAGAATGATGCAAAG 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG 0: 1
1: 0
2: 3
3: 61
4: 697
1031846884_1031846885 8 Left 1031846884 7:126815942-126815964 CCATGAGAATGATGCAAAGGTGA 0: 1
1: 0
2: 1
3: 14
4: 225
Right 1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG 0: 1
1: 0
2: 3
3: 61
4: 697

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031846885 Original CRISPR CTAAACATACAAATACACAA AGG Intronic
902074485 1:13772557-13772579 CAAAAGATACACATTCACAATGG - Intronic
902324165 1:15687939-15687961 GCAAATATAGAAATACACAATGG - Intronic
902553803 1:17235114-17235136 CTAAACAAACAAATAAATGAAGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903248374 1:22033806-22033828 CTAAACATACAAAAATTCACTGG - Intergenic
903561895 1:24234254-24234276 GCAAACATACGAAAACACAAGGG - Intergenic
903785206 1:25856512-25856534 CTAAAAATACAAATTCACCTGGG + Intronic
904078170 1:27855411-27855433 CTAAAAATACAAAAACTAAAGGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904405329 1:30284662-30284684 CTAAACATAAAACGTCACAATGG + Intergenic
904418875 1:30378830-30378852 CAAAACATACAAATACCCACTGG - Intergenic
904947611 1:34210953-34210975 CTAAAAAAAAAAATCCACAAAGG - Intronic
905122878 1:35695322-35695344 CTGGACCTTCAAATACACAAAGG + Intergenic
905832883 1:41088028-41088050 ATACACACACACATACACAATGG + Intronic
905992971 1:42355845-42355867 GCAAACATACAAAAACAGAATGG - Intergenic
906160264 1:43643246-43643268 GTAAACAGACATTTACACAAAGG + Intergenic
906405140 1:45536031-45536053 CTAAACATCCTATTACACATAGG - Intergenic
907588226 1:55640651-55640673 ACAAACATACACATACTCAAAGG + Intergenic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
909145170 1:71920930-71920952 TTAGAGCTACAAATACACAATGG - Intronic
909330356 1:74402124-74402146 GTAGACAGACAAAAACACAACGG + Intronic
909504780 1:76376312-76376334 ACACACATGCAAATACACAAAGG - Intronic
909830343 1:80181318-80181340 TTAAACAAACAAAAATACAAGGG + Intergenic
910056689 1:83041462-83041484 AAAAACATATAATTACACAATGG - Intergenic
910983092 1:92977997-92978019 TTAAAGATACACATAGACAAAGG - Intergenic
911409752 1:97488413-97488435 ATATACACACACATACACAAAGG + Intronic
911464085 1:98229564-98229586 ATAAACATACACATACATATAGG + Intergenic
911628695 1:100157486-100157508 CAGAACAGACTAATACACAAGGG + Intronic
911869671 1:103079777-103079799 TTACACATGCACATACACAATGG - Intronic
911931563 1:103910655-103910677 CCAAACATATACACACACAATGG - Intergenic
912913333 1:113785964-113785986 CTAAACAAACAAAAAACCAAAGG - Intronic
913264057 1:117027193-117027215 CTGCACATACATATACACACAGG + Intronic
914838406 1:151227572-151227594 TTAAACATTCATATACAAAAAGG - Intronic
914892617 1:151640359-151640381 ATAAAAATAAAAATAAACAAAGG - Intronic
915432036 1:155874289-155874311 CAAAACAAACAAAAACACATTGG + Intronic
915695411 1:157736489-157736511 GTAAAGAGACAAATACATAATGG - Intergenic
917008536 1:170444449-170444471 GTAAAGAGACAAATAAACAATGG + Intergenic
917099322 1:171429822-171429844 CTAAATTTACAAAATCACAAGGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917802268 1:178581524-178581546 CCAAACATGCAAATACCCACAGG - Intergenic
918339207 1:183553383-183553405 ACAAACATACAGACACACAAAGG - Exonic
918841047 1:189540012-189540034 CTAGCAATACAAATACACAGTGG + Intergenic
918872143 1:189989027-189989049 CTAACCATACAAGTATAAAATGG + Intergenic
919105325 1:193142733-193142755 ATATACACACAAACACACAAAGG - Intronic
919225533 1:194694613-194694635 TTTAACATAAAAATACAAAAAGG - Intergenic
920770081 1:208875779-208875801 CTAAATCTACAAATATCCAAAGG - Intergenic
920909414 1:210201334-210201356 GTACACATACACATACACACAGG - Intergenic
921457248 1:215386833-215386855 GAAAATATACATATACACAATGG + Intergenic
921760483 1:218908177-218908199 TAAAATATACATATACACAATGG - Intergenic
921783994 1:219204503-219204525 CTAAGCACAACAATACACAAGGG - Intronic
922239038 1:223743479-223743501 ATAAACAAACAAATATATAAAGG - Intronic
923605833 1:235441735-235441757 CAAAACAAACAAACAAACAAAGG - Intronic
923655185 1:235909723-235909745 CTAAAAATACAAAAACATAGCGG + Intergenic
923822056 1:237455599-237455621 CTAAACAAACAAAACCAGAAAGG + Intronic
924480462 1:244427587-244427609 CTAAAGACACAGATACACTAAGG + Intronic
924503966 1:244663498-244663520 AAAATCCTACAAATACACAAAGG + Intronic
924695990 1:246400390-246400412 ATAAACAAACAAATAAATAATGG - Intronic
1064363091 10:14683384-14683406 CTAAACCTTGAAACACACAATGG - Intronic
1064432871 10:15286278-15286300 CTAAACAAACAAACAAACAAAGG - Intronic
1066229955 10:33422555-33422577 GAAAACACACACATACACAAGGG - Intergenic
1066603043 10:37128133-37128155 CTATACATACACATAGACTATGG + Intronic
1067071230 10:43133729-43133751 CTGAACATGCAAACAGACAATGG - Intergenic
1067922977 10:50478650-50478672 ATAAAAATACATTTACACAAAGG + Intronic
1068446138 10:57126103-57126125 ATAAACATATAAATGCACATAGG - Intergenic
1068561380 10:58518571-58518593 CCCAACACACACATACACAAAGG - Intronic
1068582688 10:58760122-58760144 CACAACATACAAATTCACAGTGG - Intronic
1068611355 10:59063845-59063867 ATAAACACCCAAATATACAAGGG - Intergenic
1068646726 10:59476243-59476265 ATAAACATACAAACAAACATAGG + Intergenic
1068851782 10:61750643-61750665 CTAATCAAACAAATACTCTAGGG + Intronic
1068944563 10:62716675-62716697 ATAAACAAACAAAAACACAAAGG + Intergenic
1069255549 10:66327707-66327729 CTAAATATCAATATACACAATGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071761435 10:88611886-88611908 CTAGACATCCAAATACAAGAAGG + Intergenic
1072599195 10:96908550-96908572 ATAAAACAACAAATACACAAAGG - Intronic
1073862045 10:107756313-107756335 GTAAACATCAAAATATACAATGG + Intergenic
1074340814 10:112627583-112627605 CAAAACATACGAATACATAGGGG - Intronic
1074705884 10:116131363-116131385 CTAAACATACAATTACCCTATGG + Intronic
1074868768 10:117561134-117561156 CTAAACACACACACACACAGAGG - Intergenic
1075059747 10:119247642-119247664 CAAAACAAACAAACAAACAAAGG - Intronic
1075110537 10:119577544-119577566 CAAAACATACAAATAAAACATGG + Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1075442160 10:122488404-122488426 GTAAAAATACAAAAATACAAAGG + Intronic
1075959033 10:126551055-126551077 CTAAATACACAAATACTCCAAGG + Intronic
1076867208 10:133173868-133173890 CTAAACTTCCAAACACACTAGGG + Intronic
1078413510 11:11147161-11147183 CTAAACATACAAAAATGCAAAGG - Intergenic
1079650548 11:22923002-22923024 AAAAACAAACAAATACACAAGGG + Intergenic
1079755583 11:24256303-24256325 GTAAACAAACAAAAACAAAAGGG + Intergenic
1079905129 11:26235489-26235511 GTAAACATATAAATACATTATGG - Intergenic
1079956127 11:26867055-26867077 CTAAACCTACACATTCACCATGG + Intergenic
1080309286 11:30870494-30870516 ATAAAAATAAAAATTCACAATGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081377424 11:42376560-42376582 CAAAACATACAAATAACCAAGGG + Intergenic
1081392531 11:42545810-42545832 CTAAAGAGAAAAATAAACAAGGG - Intergenic
1081947922 11:47015111-47015133 CCAAACGGACAAAGACACAAAGG + Intronic
1082025578 11:47569061-47569083 CTAAATATTCAAGTACCCAAAGG + Intronic
1082620912 11:55420574-55420596 TTAAATATACAAATACAAAGGGG - Intergenic
1082640966 11:55660207-55660229 ATAGACATACACATACACAAAGG - Intergenic
1082898668 11:58221339-58221361 ATAAATAAATAAATACACAAGGG - Intergenic
1083553104 11:63605851-63605873 TTAAACAAACAAACAAACAAAGG - Intronic
1083567595 11:63733151-63733173 CTAAAAATACAAAAAAAAAAAGG + Intronic
1083825289 11:65199134-65199156 ATAAAAATACAAATACAAAAAGG - Intronic
1084799603 11:71534061-71534083 CAAAACAAACAAACAAACAAAGG - Intronic
1085059920 11:73436042-73436064 CAAAAAATACAAATACAAAAGGG - Intronic
1085817102 11:79749852-79749874 CTAGACAAAAAAATACACTAAGG + Intergenic
1085824991 11:79837062-79837084 TAAAACATAAAAATACAAAATGG + Intergenic
1085980789 11:81721751-81721773 CAAAACATACAAAAACATATGGG + Intergenic
1086001407 11:81989802-81989824 CTTAAAATATAAATACATAAAGG - Intergenic
1086112269 11:83212579-83212601 TTAAAGAAACAAACACACAAAGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086943488 11:92821944-92821966 CTAAACAAACAAACAAGCAAGGG + Intronic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087435729 11:98114732-98114754 ATACACATACACATACACAGAGG - Intergenic
1087971154 11:104486087-104486109 CTACACATACACATGCACACTGG + Intergenic
1088411587 11:109540016-109540038 CTAAGCACACAGATACACAGTGG + Intergenic
1091575556 12:1731059-1731081 CTAAACAAACAAATAAAATAAGG - Intronic
1091608954 12:1986440-1986462 ATAAAAATAAAAATACATAATGG + Intronic
1092595177 12:9995252-9995274 GTAAACATAAATAAACACAATGG + Intronic
1092599433 12:10043187-10043209 GTAAACATAAATAAACACAATGG - Intronic
1092676018 12:10921756-10921778 CTAAACAAACAAAAATCCAAGGG - Intronic
1093171748 12:15868906-15868928 TTAAACATACAAATAGGCGAAGG + Intronic
1093188313 12:16047505-16047527 CAAAACACACAAACACTCAAAGG + Intergenic
1093228147 12:16510571-16510593 TTAAAAATACAAATTCAAAATGG - Intronic
1093250657 12:16800313-16800335 CGAAACAAACAAATAAAAAAAGG - Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093581481 12:20789045-20789067 ATCAACATACAAATACAAGAAGG - Intergenic
1093646964 12:21597407-21597429 GAAGACATACAAATGCACAATGG + Intronic
1093866624 12:24234921-24234943 CTAAACATCCTAAAACACACAGG + Intergenic
1094001510 12:25700058-25700080 CTAAAAATATATATACACAATGG - Intergenic
1094163290 12:27415226-27415248 GTCAACATACACATACACACAGG + Intronic
1094396163 12:30008213-30008235 ATACACATACACATACACATAGG + Intergenic
1094593106 12:31839664-31839686 CAAAACAAACAAACAAACAAAGG - Intergenic
1094718751 12:33039825-33039847 CTAAACATACATCTACACTATGG - Intergenic
1094776700 12:33737856-33737878 ACAAACATACAAATGTACAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095260874 12:40098139-40098161 ATACACACACATATACACAATGG + Intronic
1095334181 12:41006924-41006946 CTAAGCATACAAATCCAATAAGG + Intronic
1095421834 12:42032130-42032152 CTAAATAAGCAAGTACACAATGG - Intergenic
1095458413 12:42415090-42415112 CTATGCTTACAAATACTCAAGGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095771105 12:45958225-45958247 CAACACATACAAACACACACAGG - Intronic
1096371605 12:51073568-51073590 CTAAAAATACAAAAACAAGACGG + Intronic
1096935646 12:55271028-55271050 CTAAAGATCCAAATCAACAAAGG - Intergenic
1097947480 12:65388173-65388195 CTAAATATACAAATAATCTAGGG - Intronic
1098413452 12:70206224-70206246 CTAAAGGTAGAAATACGCAATGG - Intergenic
1098561419 12:71877288-71877310 TTAAAAAAACAAATCCACAAAGG - Intronic
1098622703 12:72623247-72623269 CAAAACACACAAAAACAAAAGGG - Intronic
1099087440 12:78262556-78262578 CTAAAAATACAAAAAAAAAAAGG + Intergenic
1099100368 12:78432469-78432491 ATACACGTACATATACACAATGG - Intergenic
1099381914 12:81965016-81965038 CTAAACTAAAAAATAAACAAAGG - Intergenic
1099426814 12:82533640-82533662 GTAAAAATACAAATACTCACTGG - Intergenic
1099427508 12:82541733-82541755 CCAAGAATACACATACACAATGG - Intergenic
1099564710 12:84228899-84228921 ATAAATATCCAAATACACAAAGG - Intergenic
1099582472 12:84468287-84468309 CTAAAAATAAACATACACTAAGG - Intergenic
1099612603 12:84893424-84893446 CGTAACATACAAATAAAGAAAGG - Intronic
1100125992 12:91425759-91425781 CTATACACACATATACAAAATGG - Intergenic
1100333226 12:93605346-93605368 CTTAAGACATAAATACACAATGG + Intergenic
1101077203 12:101143029-101143051 ATATACATACACATACACCATGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1103421329 12:120785983-120786005 ATAAACATAGCAAGACACAAAGG + Intronic
1103762079 12:123257884-123257906 CAAAACATACAATCTCACAAAGG - Exonic
1103885368 12:124196452-124196474 CAAAACATCCCAATACATAATGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104123861 12:125825211-125825233 CTATACAAACAAGTAAACAATGG + Intergenic
1104187487 12:126446752-126446774 CTAAACACACACACACACAATGG + Intergenic
1104357028 12:128095914-128095936 GTAAACTTCCAAAGACACAAAGG + Intergenic
1105746837 13:23385096-23385118 CTAAAAATACAAATACAGCCTGG + Intronic
1106105650 13:26730823-26730845 GTATATATACATATACACAATGG - Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106323347 13:28663139-28663161 CTAAACATACAGAAACAAAAAGG - Intronic
1107820622 13:44282447-44282469 CAAAACACACACATACACATGGG + Intergenic
1107893474 13:44934674-44934696 ATAAACATACAAATAAATATGGG + Intergenic
1107947473 13:45432106-45432128 CTAAAAATACAAAAACAAACCGG + Intergenic
1108595822 13:51948249-51948271 CAAAAAGTACAAATACAGAATGG - Intronic
1109235865 13:59819042-59819064 CCAAACACACAAAGAAACAAGGG - Intronic
1109408206 13:61928286-61928308 CTAAGCATACAAATGAAAAATGG - Intergenic
1109484710 13:63003174-63003196 CTAGACATCCAAATACAAGAAGG + Intergenic
1109593540 13:64520078-64520100 CTACACACACACACACACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110470256 13:75852234-75852256 ATAAAAATAAAAATAAACAAAGG + Intronic
1110517687 13:76435336-76435358 CGAAACCTACAGATATACAAAGG + Intergenic
1110529547 13:76580218-76580240 CTAACCATATACATATACAATGG + Intergenic
1110586319 13:77197732-77197754 CAAAACAAAAAAATACAGAAGGG + Intronic
1110593471 13:77291896-77291918 CTAAACATCCACATTCCCAAAGG - Intronic
1110724148 13:78800275-78800297 CCAAACAAACAAAAAAACAAAGG - Intergenic
1111439819 13:88266453-88266475 GCATACATACAAATACACCATGG - Intergenic
1111532924 13:89563391-89563413 ATAAACATATAAAAACAAAAAGG - Intergenic
1111670648 13:91325459-91325481 ATACACAAACAAATACAAAATGG + Intergenic
1111987040 13:95076479-95076501 CCACACAAACAAAAACACAATGG - Intronic
1112137931 13:96603596-96603618 CTAAACATACACATACCCTATGG - Intronic
1112316783 13:98370248-98370270 CCAAGCATTCAAATACATAAAGG + Intronic
1112639027 13:101251674-101251696 ATAATCATATTAATACACAAAGG + Intronic
1112705446 13:102063288-102063310 CTAAACATACTAATATAAATAGG + Intronic
1113019947 13:105873742-105873764 ATAAACATACAGATAAACAAAGG + Intergenic
1113039279 13:106087033-106087055 TAAAAAATAAAAATACACAAGGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1113716335 13:112510846-112510868 TGAAACATACAAATACAGATTGG - Intronic
1114854099 14:26416648-26416670 TTAAACATACACAGACAGAAAGG + Intergenic
1114961699 14:27899603-27899625 ATAAATATACAAATAAACCAAGG + Intergenic
1115305961 14:31933678-31933700 CTATAGATATATATACACAATGG - Intergenic
1115307521 14:31947641-31947663 CTAAACATACAAGTATTGAATGG + Intronic
1115862912 14:37709490-37709512 GTAAAAACAGAAATACACAAGGG - Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116163215 14:41297060-41297082 CAAAAAGTACAAATTCACAATGG - Intergenic
1116240519 14:42336958-42336980 CTTAACTAAGAAATACACAATGG - Intergenic
1116836958 14:49778132-49778154 CTAAAAATTCAAATACCCATAGG - Intronic
1117079279 14:52134778-52134800 AAAAACAGACAAATACACCATGG + Intergenic
1117983209 14:61362430-61362452 CAAAACATTCAAATAATCAAGGG - Intronic
1118295976 14:64570095-64570117 CTAAACATACTAGAACACAGTGG + Intronic
1118598070 14:67451443-67451465 CTATACATGCAAAGCCACAAGGG + Intronic
1118601952 14:67476962-67476984 CTAAAAATACAAAAAAACAATGG + Intronic
1118644488 14:67824254-67824276 CTAAACAAACAAACAAAAAAAGG - Intronic
1119852682 14:77877215-77877237 AAAAACAAACAAAAACACAAAGG + Intronic
1119984509 14:79121909-79121931 CTAAATGTACATATACACACAGG - Intronic
1120086835 14:80285235-80285257 GTACATATACATATACACAATGG + Intronic
1120261729 14:82193968-82193990 TTAAACACACACATACACAAAGG - Intergenic
1120404264 14:84074520-84074542 TTAGACATAAAAATACAGAATGG - Intergenic
1120679863 14:87468015-87468037 CTAAAAATACAAAAAAAAAAGGG - Intergenic
1121932639 14:97986795-97986817 ATAAACATAAACATACACAAGGG + Intergenic
1122538225 14:102481163-102481185 CTAAAAATACAAATACATAGTGG - Intronic
1122732519 14:103811685-103811707 CTAAATAAATAAATACATAAAGG + Intronic
1122759563 14:104012406-104012428 CTGAAAATACAATAACACAAAGG - Intronic
1122850452 14:104525495-104525517 GTGAACAGACAAATACATAAAGG + Intronic
1123806978 15:23883892-23883914 CTAAAAAAACAAATATAAAAAGG - Intergenic
1124210308 15:27757918-27757940 TTAATGATACAAATACATAAGGG + Intronic
1124287035 15:28410778-28410800 CTAAAAATACAAAAAAAAAAAGG + Intergenic
1124295666 15:28500849-28500871 CTAAAAATACAAAAAAAAAAAGG - Intergenic
1124474967 15:30025386-30025408 GGAAATATACAAATATACAAGGG - Intergenic
1124883782 15:33665274-33665296 CTAAAGAAACAGATACAGAAAGG - Intronic
1126652567 15:50939154-50939176 CTAAACTTAAAAATACAACATGG - Intronic
1126717425 15:51534038-51534060 CCAAATGTACAAATACAGAATGG + Intronic
1126983897 15:54280129-54280151 ATAAACATATACATATACAAGGG + Intronic
1127887076 15:63211008-63211030 CAAAAGATACCACTACACAAGGG + Intronic
1129973078 15:79797440-79797462 TTAAACATAAAAAAACACTAAGG - Intergenic
1130167455 15:81477407-81477429 ATAAAAATATAAAAACACAATGG + Intergenic
1130399334 15:83534457-83534479 TTAAAAATACATAGACACAAAGG - Intronic
1130923047 15:88365184-88365206 GGAAACAGACAAATCCACAATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1135105336 16:19644812-19644834 CTAAAGAAAAAAATACACAAGGG - Intronic
1135221533 16:20618628-20618650 TTAAAAATACAAACTCACAATGG + Intronic
1135839774 16:25864748-25864770 ATAAATATATATATACACAATGG - Intronic
1136264180 16:29105293-29105315 TTAAACACACACACACACAAAGG + Intergenic
1136496636 16:30649165-30649187 CAAAACAGACAAACAAACAAGGG - Intergenic
1136968244 16:34941172-34941194 CTAAAAATACAAAAAAATAACGG - Intergenic
1137256989 16:46783888-46783910 CTGACCATACAGAAACACAAAGG + Intronic
1137305281 16:47192795-47192817 CTACACACACAGAAACACAAGGG + Intronic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1138009880 16:53368539-53368561 CTATACATATAAAGACACAAGGG + Intergenic
1138022938 16:53501428-53501450 CTAAAAATACAAAGAAGCAAAGG + Intronic
1138088241 16:54153474-54153496 CTAAGCAAACAAATACAGAAAGG + Intergenic
1138756429 16:59491873-59491895 ATAAACATGCAAACACAGAAAGG + Intergenic
1138973863 16:62179750-62179772 ATGAACATCCAGATACACAAAGG + Intergenic
1139147310 16:64340388-64340410 TGAAACATACATATACACCATGG - Intergenic
1140023325 16:71260522-71260544 CTTAACATTCAAATACCCCAAGG - Intergenic
1140285684 16:73600581-73600603 CTAAAAATACAAAAAAACATTGG - Intergenic
1142918691 17:3165024-3165046 ACAAACAAACAAATACAGAAAGG + Intergenic
1143436761 17:6934515-6934537 CAAACCATACCAATACCCAAAGG - Intronic
1143566662 17:7725993-7726015 ATAAACAAACAAATAAATAAAGG - Intronic
1144308355 17:13989908-13989930 CTAAACATACAAGCAAAAAAAGG + Intergenic
1144464262 17:15484059-15484081 CCAAACATGCAAACACACGAAGG + Intronic
1145722353 17:27085128-27085150 CAAAACATACAAAAAGTCAATGG + Intergenic
1145782806 17:27574555-27574577 AAAAACAAACAAATACAGAAAGG + Intronic
1148113005 17:45157503-45157525 CTAAAAATACAAATACAGGCCGG + Intergenic
1148310896 17:46638675-46638697 CTAAAAATACAAAAAAAAAATGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1148385329 17:47230348-47230370 CTAAACACACATATACAATAAGG - Intergenic
1148909730 17:50934992-50935014 CTAAAGATAAAAATACTCAAAGG - Intergenic
1148945121 17:51255487-51255509 AAACACATACAGATACACAAGGG + Intronic
1148957241 17:51363971-51363993 AAAAACACACATATACACAAGGG - Intergenic
1149130139 17:53290269-53290291 CTAAACATACACACACAAACCGG + Intergenic
1149190210 17:54051853-54051875 AAAAATATACAAATACAAAATGG + Intergenic
1149380566 17:56089210-56089232 GTATACATACAAAGACAGAAAGG - Intergenic
1149546316 17:57506389-57506411 CTGTGCATACAAATACACCACGG - Intronic
1149827812 17:59845747-59845769 TTAAATATGCAAATACACACAGG - Intergenic
1150180738 17:63118339-63118361 CTAAAAATACAAGTAAACAAAGG - Intronic
1150845851 17:68657174-68657196 CTAATCATGCACATAAACAAAGG + Intergenic
1150962821 17:69933764-69933786 ATACACATGCAAAAACACAAAGG - Intergenic
1151048533 17:70949066-70949088 CTAGACATCCAAATACAAGAAGG + Intergenic
1151178429 17:72308178-72308200 CAAATCATAGAAATATACAATGG + Intergenic
1152201534 17:78949769-78949791 CTAAAAATACAAAAATACATGGG + Intergenic
1152860558 17:82694364-82694386 CTAAAAATACAAAAACAAATTGG + Intronic
1153106454 18:1533799-1533821 CTAAAAATACAAAAACTCATGGG + Intergenic
1153807885 18:8725469-8725491 CTCAATATACAACTATACAAAGG + Intronic
1153861970 18:9220683-9220705 CCAAACATTCAAATACTCACTGG - Intronic
1154936973 18:21070614-21070636 CTAAAGAAACAAACAAACAATGG + Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155730865 18:29156528-29156550 CTAGAAATACAAAGACAAAAAGG + Intergenic
1155914249 18:31540342-31540364 CTACATATACAGATACATAACGG + Intronic
1156402649 18:36753880-36753902 CTAAAAAGACAAATAAAAAATGG - Intronic
1156766201 18:40659244-40659266 CAAAACAAACAAATAAACAGAGG - Intergenic
1156820019 18:41361045-41361067 CAAAACACACATATAAACAATGG - Intergenic
1156973769 18:43191257-43191279 CTAAACAAATTAATACAAAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158013216 18:52752959-52752981 ATATACATACACACACACAATGG - Intronic
1158280083 18:55814771-55814793 AAAAACAAACAAATAAACAAAGG + Intergenic
1158403941 18:57144827-57144849 CTACACACACAGATACACACAGG - Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159096771 18:63911220-63911242 GTAAACAGACAACTACAGAATGG - Intronic
1159159688 18:64627843-64627865 CCAAACAAACAAACAAACAAAGG - Intergenic
1159255730 18:65943029-65943051 CTAAACATTTCAATTCACAAAGG - Intergenic
1159598301 18:70404424-70404446 TTAAAAATACAAACACAAAAAGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1163229545 19:15991218-15991240 GTAGACATAGAAATAGACAAAGG + Intergenic
1164021647 19:21312463-21312485 CAAAACAAACAAATACAACATGG + Intronic
1164177268 19:22786239-22786261 ACAAACAAACAAATAAACAAAGG - Intergenic
1164190275 19:22909528-22909550 ATAAACATACACACACAGAATGG - Intergenic
1164428117 19:28161997-28162019 ATATACATACAGACACACAAGGG - Intergenic
1167065736 19:47184570-47184592 CTAAAAATACAAAAACTAAATGG - Intronic
1167121151 19:47517588-47517610 CAAAACAAACAAAAACACTAAGG + Intergenic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925364260 2:3300736-3300758 CCAATCATACAAATACCTAATGG + Intronic
925463522 2:4085964-4085986 CTAAACCTTCAAAAACATAAAGG + Intergenic
925539111 2:4947372-4947394 CTAAAAATACAAATAATAAATGG - Intergenic
926712597 2:15893666-15893688 CTACACACACACACACACAAAGG + Intergenic
927016814 2:18972238-18972260 CTGAACTTACAATTACACACAGG + Intergenic
927516292 2:23673648-23673670 CTACACAGACACATACACAGGGG + Intronic
928593335 2:32838821-32838843 AGAAACATACATATACACAGTGG - Intergenic
928729074 2:34210039-34210061 GTAAACAGACAACTACAGAATGG + Intergenic
929442432 2:41974653-41974675 CTATACATACACATACGGAATGG - Intergenic
930132975 2:47871642-47871664 CCTAATATAAAAATACACAAAGG - Intronic
930673783 2:54178657-54178679 CTAGAATTACAAGTACACAAGGG - Intronic
930949711 2:57125739-57125761 CAAAAAATACAAGTATACAAAGG + Intergenic
931002307 2:57800377-57800399 CTATACACACACATACACATGGG - Intergenic
931076147 2:58715170-58715192 CTAAAAATAAAATTACTCAAAGG - Intergenic
931496685 2:62814705-62814727 CTAAACAGACAAAACAACAAAGG + Intronic
932062371 2:68516795-68516817 ATATATATACAAATACACCATGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933448211 2:82409805-82409827 CTAAGTATACAAATATAAAAGGG + Intergenic
934126835 2:88902133-88902155 CTGAACAGACAACTACAGAATGG - Intergenic
935093010 2:99914998-99915020 TTATACATACATATACAGAAAGG + Intronic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935683955 2:105667413-105667435 CTAAACTTACTAAGACAAAAAGG + Intergenic
937497976 2:122444640-122444662 CAATACATACAAATAGCCAATGG - Intergenic
937715310 2:125025454-125025476 CTAAAGACTCAGATACACAATGG - Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938265382 2:129924325-129924347 CTAAAAATACAAAAAGAAAACGG + Intergenic
938963661 2:136365901-136365923 CAAAACATACAATGAGACAAAGG - Intergenic
939059784 2:137407370-137407392 GTAGACATAAAGATACACAAAGG - Intronic
939093898 2:137810524-137810546 AAAAACAAACAAATTCACAAGGG - Intergenic
939584482 2:143989985-143990007 TTAAAAATACCAATACACACTGG + Intronic
939745179 2:145958685-145958707 CTCCAAATACAAATCCACAATGG - Intergenic
940217774 2:151317601-151317623 CTAGACATCCAAATACAAGAAGG + Intergenic
940298552 2:152155393-152155415 CTGAGCATACAAATATTCAACGG + Intronic
940632205 2:156254391-156254413 CTAAACAGACAACTACAGAATGG + Intergenic
940646942 2:156401562-156401584 CTATTCAGACAAATACATAATGG + Intergenic
941060745 2:160843866-160843888 CCAAACAGACAAAGACAAAAAGG + Intergenic
941300901 2:163799935-163799957 CAAAACACATACATACACAAAGG - Intergenic
941385545 2:164846304-164846326 CTGAAGTTAGAAATACACAAAGG + Intergenic
941947516 2:171116018-171116040 ATAAATATAAAAATACAAAAAGG + Intronic
943266128 2:185735433-185735455 ATAAAGATACAGATACACTAAGG - Intergenic
943339144 2:186656502-186656524 AAAAACAGAAAAATACACAAAGG + Intronic
943485982 2:188482391-188482413 TGAAACATACAAATACAAACTGG - Intronic
943780224 2:191815476-191815498 CTACACAGCCATATACACAATGG - Intergenic
943814828 2:192239263-192239285 CTACACATACACACACACACAGG + Intergenic
943860675 2:192858206-192858228 CCAAACAAACAAAAAAACAATGG + Intergenic
943881238 2:193147141-193147163 CAATACATACACATACACACTGG + Intergenic
943941093 2:193998206-193998228 AAAAACATACAAACACACACTGG - Intergenic
944043457 2:195381806-195381828 ATAAAGAAACACATACACAATGG + Intergenic
944200027 2:197096864-197096886 CCACACACACAAACACACAAAGG + Intronic
944974764 2:205036803-205036825 CAAAAAATATATATACACAACGG + Intronic
945424795 2:209687629-209687651 CGAAACAAACACCTACACAAGGG - Intronic
947458436 2:230280532-230280554 CGAAAGATACAAATAGAGAATGG - Intronic
947485671 2:230546322-230546344 TTACACATGCAAATACACCAGGG - Intergenic
947513187 2:230777833-230777855 GGAAACAGACAAGTACACAAAGG - Intronic
948215857 2:236230295-236230317 TCAAACATACAAATACTGAAAGG + Intronic
948275779 2:236707009-236707031 ACACACATACACATACACAATGG + Intergenic
949066671 2:241995063-241995085 CAATACATACACATACACACAGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169280448 20:4262680-4262702 CTTAACATACAAATCCACAATGG - Intergenic
1169960843 20:11158598-11158620 CTAAACATATAAAAATAAAAAGG - Intergenic
1170683881 20:18551379-18551401 ATAAATATACAAATACTCCAGGG - Intronic
1171820827 20:29836330-29836352 CCAAACACACAGATACACAGGGG - Intergenic
1171952202 20:31430403-31430425 CAAAACAAACAAACAAACAAAGG - Intergenic
1172711427 20:36927673-36927695 CTAAAAATACAATCACAAAAAGG + Intronic
1172856269 20:38005466-38005488 CAAAGCATATAAATAGACAATGG + Intronic
1173413766 20:42838185-42838207 CTAAAAATACAAAAACAGCAGGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1175078339 20:56394670-56394692 CCAAACATACACATACATAAAGG + Intronic
1175169702 20:57071548-57071570 GTAAATAAATAAATACACAAAGG + Intergenic
1176314978 21:5233684-5233706 AGAAACGTACAAAAACACAACGG + Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177068945 21:16477691-16477713 GTACATATACATATACACAATGG - Intergenic
1177312853 21:19419782-19419804 TCAAACATACACATAAACAAAGG + Intergenic
1177325822 21:19587272-19587294 CTCTAAATAAAAATACACAAAGG - Intergenic
1177447394 21:21215789-21215811 CAACACATACACATACACACAGG - Intronic
1177503649 21:21992756-21992778 GAAAACATAGAAATTCACAAAGG + Intergenic
1177911200 21:27034710-27034732 ATAAACAGATATATACACAAGGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1181454042 22:23045200-23045222 ATAGACATACAAACACACAAAGG + Intergenic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1184481198 22:44748434-44748456 CGAAGCATAGAAATACACATTGG + Intronic
1185124412 22:48999284-48999306 GAAAACAGACAAATACACCATGG - Intergenic
951485847 3:23209094-23209116 ATAAACACACAAACACACTATGG - Intronic
952000116 3:28775339-28775361 TTAAAGATACATATACACCATGG - Intergenic
952019930 3:29006282-29006304 TTAAAATTACTAATACACAATGG + Intergenic
952087004 3:29835592-29835614 CACAACATACAAAAACACATGGG + Intronic
952996486 3:38887945-38887967 ACAAACATACACATACAAAAAGG + Intronic
953022529 3:39124709-39124731 AAAAACACACACATACACAAAGG - Intronic
953070218 3:39513084-39513106 TGAAACATAGAAAAACACAAAGG - Intronic
953081264 3:39620843-39620865 CAAAACAGACTAATACACTATGG - Intergenic
953764306 3:45723925-45723947 ATATGCATACACATACACAATGG - Intronic
954512955 3:51143677-51143699 ATAAACATTCAAATAAAAAATGG - Intronic
954982952 3:54762472-54762494 GTAAACAGACAATTACAAAATGG - Intronic
955355554 3:58228697-58228719 ATAAACACACACATACACCATGG + Intergenic
955416151 3:58693878-58693900 CTTAACATAAATGTACACAAAGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956248825 3:67214424-67214446 CTAAAAATACAAAAACTCACCGG - Intergenic
956439077 3:69262310-69262332 CATAACATACATATACACTATGG + Intronic
956443614 3:69304320-69304342 CTAAACATACAAAAATTCACTGG + Intronic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
957465700 3:80588002-80588024 ATAAACATATATATACACAGAGG - Intergenic
958008717 3:87847039-87847061 CCAAACATTTAAATACAAAATGG + Intergenic
958041841 3:88235236-88235258 GGAAACATACATATACACACAGG + Intergenic
959343950 3:105168798-105168820 TGAAACCTACAAATACACAAGGG + Intergenic
959394677 3:105822557-105822579 CTAAACAAACAAATCTAAAATGG + Intronic
959728215 3:109569741-109569763 TTAAATAAACAAATACACAGAGG - Intergenic
959956319 3:112242311-112242333 GAAAATATACATATACACAATGG + Intronic
960038701 3:113127618-113127640 CTAAAAATACAAAAAAAAAAAGG - Intergenic
961576342 3:127839862-127839884 CTAAAAATACAAAAACTAAATGG + Intergenic
962665867 3:137653023-137653045 TTAAACAGAGAAATACAGAAAGG + Intergenic
963388394 3:144626311-144626333 TTAAACACCAAAATACACAATGG - Intergenic
963416862 3:145007529-145007551 CTTAACATAAATATTCACAAAGG - Intergenic
963727502 3:148938466-148938488 ATAAATATACAAATATACACTGG + Intergenic
963918435 3:150882543-150882565 ACACACATACACATACACAAAGG - Intronic
964199902 3:154107469-154107491 CCCAACATAAAAATGCACAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964578419 3:158201956-158201978 CTAAACAAAAAAATAAACAAAGG - Intronic
964629134 3:158790545-158790567 CTAAATACACAAATATAGAAGGG + Intronic
964857326 3:161160567-161160589 AGAAACACACAAAGACACAAAGG - Intronic
965426968 3:168537991-168538013 ATATACATACACACACACAATGG + Intergenic
965581961 3:170278331-170278353 CAAAACAGACTAACACACAAGGG - Intronic
965771924 3:172190646-172190668 CAAAACAAAAAAAGACACAATGG - Intronic
966555286 3:181252123-181252145 CTAAACATACAAACAGGCAGAGG - Intergenic
966586708 3:181634497-181634519 CTAAACACACAAACATACACAGG + Intergenic
966641372 3:182194500-182194522 GGAAACAAACAAATAAACAAAGG - Intergenic
966663382 3:182441662-182441684 CTAAACATGCAAAGAAAAAAAGG - Intergenic
966673625 3:182560221-182560243 TTCAGCATACAAATACTCAAGGG + Intergenic
967454742 3:189671670-189671692 CTTATGATACATATACACAATGG + Intronic
967551673 3:190802073-190802095 GCAAACAGACTAATACACAAAGG + Intergenic
969971074 4:11048857-11048879 CTTATCACACACATACACAAGGG + Intergenic
970106217 4:12588180-12588202 CAAACCATACAAATCCACTAGGG + Intergenic
970821024 4:20214051-20214073 CTACACATACACAAACAAAAAGG + Intergenic
970962990 4:21895156-21895178 CAAAACAAACAAATACTCTAGGG - Intronic
971868123 4:32199406-32199428 AAAAACATACAAATAAATAAGGG + Intergenic
972139859 4:35944805-35944827 ATACACACACACATACACAAGGG + Intergenic
972175200 4:36396282-36396304 GTAAACATAGAGATACATAAGGG - Intergenic
972910078 4:43804370-43804392 GTACATATATAAATACACAATGG + Intergenic
972929882 4:44059073-44059095 CCACACAAACAAAGACACAAAGG + Intergenic
973128746 4:46622321-46622343 CTGAACACACAAAAATACAAAGG - Intergenic
973692925 4:53457773-53457795 CTAAACATAAAAAAAGAAAAAGG + Intronic
974099010 4:57396519-57396541 CCAGACACACAAACACACAATGG - Intergenic
974314610 4:60262767-60262789 CTAAAAATAGATGTACACAAAGG + Intergenic
974592003 4:63963698-63963720 ATAAATATACAAATATAGAAAGG + Intergenic
974617670 4:64310477-64310499 CAACACAAACAAACACACAAAGG - Intronic
975585619 4:75945358-75945380 ATATACATACAAATATACAAGGG + Intronic
976772374 4:88667354-88667376 CTAAACAAACAAAATCAAAAAGG - Intronic
977143826 4:93410576-93410598 ACAAACAAACAAATAAACAAAGG - Intronic
977283761 4:95075497-95075519 ATAAACACTCAAGTACACAATGG - Intronic
977309592 4:95369158-95369180 GTATACATAAAAATACACACTGG - Intronic
977338560 4:95728934-95728956 CAAAAGAGACAATTACACAAAGG + Intergenic
977365216 4:96059224-96059246 CTACACATACAAATACAGCCTGG - Intergenic
977436042 4:96995799-96995821 CTTCACATACAAAGACAGAAAGG - Intergenic
977523267 4:98112281-98112303 ACAAAGATACAGATACACAATGG - Intronic
977633854 4:99272816-99272838 ATATAAATACAAATACACAGTGG - Intergenic
977763467 4:100769852-100769874 CCACATATACAAACACACAAAGG - Intronic
977766324 4:100802481-100802503 ACAAACACACACATACACAAAGG + Intronic
978283835 4:107051140-107051162 CTAAACATATTAATAGAAAAGGG + Intronic
979325355 4:119372682-119372704 CTCAAAATAGAAATACACATGGG + Intergenic
979623060 4:122817447-122817469 CTAAACAAAGTAATAGACAAAGG - Intergenic
980221558 4:129923523-129923545 TTAGAAATACAAATACAAAATGG + Intergenic
980491717 4:133535907-133535929 ATATACATCCAAATACAGAATGG + Intergenic
980572751 4:134642255-134642277 ATATACACACATATACACAATGG - Intergenic
980629852 4:135417004-135417026 GCATACATACATATACACAAAGG - Intergenic
980681704 4:136170951-136170973 TTAAAGATACTAATGCACAATGG - Intergenic
980771217 4:137375891-137375913 CTAAGCATACAAGTAAACAAAGG + Intergenic
981159501 4:141480894-141480916 ATAAATATCCAAATACAGAAAGG - Intergenic
981175160 4:141674098-141674120 GTAAGCATACAAAAGCACAAGGG - Intronic
981224358 4:142275498-142275520 CCAAACATAAAAATAAACAAGGG + Intronic
981962481 4:150557896-150557918 CAAAACAAACAAAAAAACAAAGG - Intronic
982624301 4:157746225-157746247 ACACACATACACATACACAAAGG + Intergenic
983243255 4:165257703-165257725 CTCAAAATAGAAATACACATGGG + Intronic
983445007 4:167839135-167839157 CAAAACAGACATATACAGAAAGG - Intergenic
983638647 4:169924118-169924140 TCAAACAAACAAACACACAAGGG - Intergenic
983679268 4:170333508-170333530 CTAACCACACAGATACACACAGG - Intergenic
984235368 4:177151009-177151031 ATACACACACAAACACACAATGG + Intergenic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
984672198 4:182503414-182503436 CTATACACACAAATAAGCAAGGG - Intronic
984738690 4:183137909-183137931 CTAAACATACAAGGAAACAAAGG - Intronic
985184331 4:187299272-187299294 TTAAACATACAGAGAAACAAAGG + Intergenic
986096839 5:4565103-4565125 CTAAAATTACTGATACACAAAGG + Intergenic
986248779 5:6035946-6035968 GTAAACACACATCTACACAAAGG - Intergenic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
986926781 5:12764193-12764215 TTATACATAAAAATTCACAATGG - Intergenic
987071724 5:14343265-14343287 CTAAACACACACATACACATGGG - Intronic
987195880 5:15525646-15525668 CCATACATACATATACACACAGG + Intronic
987843296 5:23248875-23248897 TTATATATACATATACACAATGG - Intergenic
987872116 5:23633783-23633805 ATATACACACAAACACACAATGG + Intergenic
988131521 5:27112813-27112835 CAAAACAGACACATAGACAATGG + Intronic
988516637 5:31910689-31910711 CTAAAAATACAAAAAAAAAAAGG - Intronic
989032061 5:37129129-37129151 CAAAACAAACAAAAACATAAAGG + Intronic
989267421 5:39492972-39492994 CAAAATACAAAAATACACAAAGG + Intergenic
989988299 5:50729806-50729828 TTAAACATAAAAATACTCATTGG + Intronic
990288175 5:54321611-54321633 CAGAACATACACACACACAAAGG - Intergenic
990474590 5:56150001-56150023 CTAAAAATACAAAAATTCAACGG - Intronic
990811343 5:59727552-59727574 ATAAACAAACAAATAAAAAAGGG + Intronic
991554230 5:67877216-67877238 CTAAACGTACTAAGACACCAAGG + Intergenic
992336780 5:75778924-75778946 AAAAACTGACAAATACACAAGGG + Intergenic
993019839 5:82578886-82578908 ATATACACACACATACACAAAGG - Intergenic
993371108 5:87093000-87093022 AAAAACCTAGAAATACACAAAGG + Intergenic
994120804 5:96110668-96110690 TTAACCATACAATTACAGAATGG + Intergenic
994522785 5:100862561-100862583 CTAAAAATACAAAAAAAAAATGG - Intronic
994540310 5:101086815-101086837 ATACACATATATATACACAATGG + Intergenic
994661329 5:102657917-102657939 ATAATCATCCAAATACTCAATGG - Intergenic
994817731 5:104605828-104605850 ATGAACCTACAAATACTCAAAGG + Intergenic
994912729 5:105933510-105933532 ATATACATACACATACACATAGG - Intergenic
994935828 5:106252452-106252474 CTAAACATACTAAAATGCAAAGG + Intergenic
995516273 5:112957147-112957169 CTAAACAAACATATATACATAGG - Intergenic
995684564 5:114758209-114758231 CTAAACATACCGATACAGTATGG + Intergenic
995955826 5:117775212-117775234 GTAAACAGACAACTACACAGTGG + Intergenic
995962411 5:117858456-117858478 CCACACACACACATACACAAGGG + Intergenic
996040279 5:118801447-118801469 ATAAACATATAAATACAAAAGGG - Intergenic
996632478 5:125651031-125651053 CTAAAAACAAAAATAGACAATGG + Intergenic
996851969 5:127963243-127963265 CAAATTATACAAATACAAAATGG - Intergenic
997301905 5:132812750-132812772 ATAAACATACATACACACATGGG + Intergenic
997420672 5:133764354-133764376 CTCAGCCTACAAATACACAGCGG + Intergenic
997480645 5:134181917-134181939 CTAAACATACATGTACCCAGTGG + Intronic
997802586 5:136880818-136880840 ATATACATATATATACACAATGG + Intergenic
998058730 5:139102421-139102443 GAAAACATAGAAAAACACAAAGG - Intronic
998902292 5:146869077-146869099 ATTAACATTCAAATCCACAATGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999292195 5:150433229-150433251 CTAAAAAAACAAAAACAAAAAGG + Intergenic
1000151570 5:158506667-158506689 ACAAACATATAAATACATAATGG + Intergenic
1000719363 5:164687746-164687768 CTATACATACAAGTACCCATAGG + Intergenic
1000721657 5:164715526-164715548 CAAAACATACAAATAGGGAATGG - Intergenic
1000750454 5:165089231-165089253 CTAAACATCCTATAACACAAAGG - Intergenic
1001010553 5:168094007-168094029 ATAGACATACACATACACACAGG + Intronic
1001288508 5:170440293-170440315 CTGAGCAAACCAATACACAAGGG + Intronic
1002657600 5:180763306-180763328 TTAGCCTTACAAATACACAAAGG + Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1004024035 6:11801646-11801668 CTAAAAATACATATACACACAGG - Intronic
1004073238 6:12321345-12321367 CAAAACAAACAAATAAACATTGG + Intergenic
1004093868 6:12533315-12533337 CTAAACATAAAACAGCACAACGG - Intergenic
1004099575 6:12594987-12595009 CTATACAAAGAAACACACAATGG + Intergenic
1004189259 6:13449865-13449887 GAAAACATACTAATACACTAAGG + Intronic
1004245224 6:13968757-13968779 TTACATATATAAATACACAAAGG - Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004510650 6:16281669-16281691 CTAAAAATACAAAAAAAAAATGG - Intronic
1005759599 6:28955834-28955856 CTAAAAATACAAAAAATCAACGG + Intergenic
1006087475 6:31606663-31606685 CTAAAAATACAAAAAAATAATGG + Intergenic
1006150749 6:31986841-31986863 CTAAGCCTACAAATACTCATGGG - Intronic
1006157050 6:32019579-32019601 CTAAGCCTACAAATACTCATGGG - Intronic
1006270716 6:32964842-32964864 CAAAACAAACAAACAAACAAAGG + Intronic
1007490389 6:42216647-42216669 CTAAACATACAAATACTAGCTGG + Intronic
1007519371 6:42439617-42439639 CAAAACAAACAAACAAACAAAGG + Intronic
1008150581 6:47946562-47946584 CTAAACATAATGATAGACAAAGG - Intronic
1008200357 6:48580222-48580244 GTAAACATGTAAAAACACAATGG + Intergenic
1008296112 6:49779906-49779928 TTAAACATACACATATATAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008951267 6:57162231-57162253 CTAAACACACACAAACAGAATGG + Intronic
1009327707 6:62374336-62374358 CGAAACAAACAAAAACACTAAGG - Intergenic
1009709018 6:67293431-67293453 TTAAAAATACAAAAACAAAATGG - Intergenic
1009857083 6:69278518-69278540 CTATTCATAAAAATACACATTGG - Intronic
1009971925 6:70633940-70633962 GTAAAAATAGAAATAAACAAAGG + Intergenic
1010313882 6:74421983-74422005 ATCAACATTCAAATACAAAAAGG + Intergenic
1010350046 6:74862669-74862691 CTAAAAATACAAAAAAACAGCGG + Intergenic
1010689114 6:78888346-78888368 GTTATCATACACATACACAAAGG + Intronic
1011013864 6:82733150-82733172 CTAAACACACAAATATACATGGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011721389 6:90160321-90160343 CCACACATGCACATACACAAAGG - Intronic
1012057442 6:94431390-94431412 CTAAAGATAAAAATATACATAGG - Intergenic
1012124739 6:95414079-95414101 CTAACCAAACAAAAACACAAAGG - Intergenic
1012204525 6:96443834-96443856 CTAGACATCCAAATACAAGAAGG + Intergenic
1012208217 6:96488267-96488289 CTAGACATCCAAATATAAAAAGG - Intergenic
1012918197 6:105193592-105193614 CAAAACAGACTAATACACAAAGG + Intergenic
1013034447 6:106366948-106366970 ATGAACATCCAAATACTCAAAGG - Intergenic
1013274399 6:108570299-108570321 TTTAAAATAAAAATACACAAGGG - Intronic
1013871854 6:114773130-114773152 CTAAACATACAAGAATATAATGG + Intergenic
1014062514 6:117089460-117089482 CTAAATATGCAAATACAATATGG + Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014423664 6:121275142-121275164 CCAAACATACAAATACATATAGG - Intronic
1014925947 6:127270242-127270264 TAAAACTTAAAAATACACAAAGG - Intronic
1015030485 6:128588263-128588285 ATAAATATCCAAGTACACAAAGG + Intergenic
1015041251 6:128722604-128722626 CTAAACATTCAACTGCAAAAGGG - Intergenic
1015105877 6:129536266-129536288 TTAATCATACAATTACAGAATGG - Intergenic
1015592535 6:134836119-134836141 CAAAACACAAAAACACACAATGG + Intergenic
1016144998 6:140659735-140659757 ATAAATATACAAATACACTAAGG + Intergenic
1016710542 6:147166348-147166370 CTCAGTATACAAATACACAATGG + Intergenic
1016968465 6:149740642-149740664 CAAAACACACACATACAAAATGG + Intronic
1017679729 6:156851362-156851384 CTAAATATACAATTAAACATTGG - Intronic
1018162342 6:161057855-161057877 TTAAACATACAAACATACAAAGG + Intronic
1018596870 6:165490064-165490086 CTAGACATCCAAATACAAGAAGG + Intronic
1020155633 7:5721773-5721795 CAAAGCATTCAAATATACAAGGG + Intronic
1020594581 7:10189990-10190012 CCAAACAAACAAAAAAACAAGGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020929945 7:14380253-14380275 ATAAAAATAAAAATAAACAATGG + Intronic
1020966098 7:14870632-14870654 CTAAAAATACAAAAACACCCGGG + Intronic
1021222334 7:17988646-17988668 CTCAACATATAAATACACCAGGG + Intergenic
1021626432 7:22597830-22597852 ATAAACACACAAATGCAAAAAGG - Intronic
1021634493 7:22678348-22678370 CAAAACATTCAAATAAACAATGG - Intergenic
1021913305 7:25407489-25407511 TTATACAAATAAATACACAATGG - Intergenic
1022249708 7:28594989-28595011 CTAAAGTTAGAAATACCCAAAGG - Intronic
1022304490 7:29133852-29133874 CAAACCATACAACTACAGAAAGG + Intronic
1023539068 7:41245467-41245489 GGAAACATACCAATAGACAATGG - Intergenic
1023765441 7:43506192-43506214 ATAAACATACCTGTACACAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1025616949 7:63128183-63128205 GAAAACATACATATACACCATGG + Intergenic
1026574256 7:71559172-71559194 CTATACATATAAATACCAAAAGG - Intronic
1027362433 7:77423027-77423049 TTGAACATCAAAATACACAACGG + Intergenic
1027575024 7:79921296-79921318 CAAAACATAAAAATACAGATGGG + Intergenic
1028200344 7:87954281-87954303 CTAAACATGGAAAGGCACAACGG - Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029129650 7:98320331-98320353 CAAAACAAAAAAATACGCAATGG - Intronic
1029209575 7:98895615-98895637 CTCAAGATACAAATAGGCAATGG - Intronic
1030374600 7:108740563-108740585 GTAAACAGACAAGTACAGAATGG - Intergenic
1030476597 7:110042295-110042317 GTAAATATTCAAATACAAAAAGG - Intergenic
1030522376 7:110614087-110614109 ATATATATACATATACACAATGG + Intergenic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031711686 7:125055091-125055113 CTAAACAGAAAAATACAAAAGGG - Intergenic
1031846885 7:126815973-126815995 CTAAACATACAAATACACAAAGG + Intronic
1032009450 7:128333734-128333756 ATAAAAATAAAAATAGACAAAGG + Intronic
1032136606 7:129285159-129285181 CTACATATATAAATACACGAGGG - Intronic
1032331498 7:130985152-130985174 CAAAACAAACAAACAAACAAAGG - Intergenic
1032549053 7:132767246-132767268 CCAAACAGACTAATACACCAGGG + Intergenic
1033669122 7:143472871-143472893 GTAAACAAATATATACACAATGG + Intergenic
1034011874 7:147537250-147537272 TTAAAAATGCAAATACACAGTGG + Intronic
1034128340 7:148694127-148694149 CTATGTAAACAAATACACAAAGG - Intergenic
1036820988 8:11939696-11939718 CTAAAAATACAAATATAAGATGG - Intergenic
1037049773 8:14358114-14358136 ACAAACACACAAATACATAAGGG - Intronic
1038605662 8:29001153-29001175 ACAAACATACAAACATACAAGGG + Intronic
1038614208 8:29077576-29077598 CTAAAAATGCAAATACCCCAAGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038795668 8:30707132-30707154 AAAAACAAACAAACACACAATGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039294059 8:36129536-36129558 ATACACATACACACACACAATGG + Intergenic
1039653611 8:39373712-39373734 ATACACATACACATATACAATGG + Intergenic
1039874510 8:41574203-41574225 ATAAACATACATACATACAATGG + Intergenic
1040037583 8:42885740-42885762 AAAAAAATAAAAATACACAAAGG - Intronic
1040849615 8:51885648-51885670 CTAAAAATACAAATTCACAAAGG + Intronic
1041401969 8:57455768-57455790 ATAAACATAAAAGTAAACAAGGG - Intergenic
1041584899 8:59505065-59505087 GTAAACATACAACCACAGAATGG + Intergenic
1041602289 8:59734008-59734030 CGTAACATAAAAATACCCAAAGG + Intergenic
1042150046 8:65772057-65772079 GTAAGCATACAAAAACCCAAAGG + Intronic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1042260990 8:66859005-66859027 ATAAACACACAAATTCATAAAGG + Intronic
1042305743 8:67329947-67329969 CTAAAAATAAAAAAAAACAAAGG + Intronic
1042366449 8:67942400-67942422 CTAGACATACAATAACAGAAGGG + Intergenic
1042896984 8:73681084-73681106 CTAGACATCCAAATACAAGAAGG + Intronic
1043300268 8:78721136-78721158 CTAAACAGACAATTACAACATGG + Intronic
1043411299 8:79999263-79999285 CTAAACGTACAGGTACAAAAAGG + Intronic
1043725345 8:83603711-83603733 ATAAACATAGAAAGAAACAATGG + Intergenic
1043824289 8:84906595-84906617 CTCAACAGACAAAATCACAATGG + Intronic
1044003974 8:86919167-86919189 GTAAACAAAGAAATACACATAGG + Intronic
1044032726 8:87258363-87258385 CTACACACACAAATAAAGAAGGG - Intronic
1044470444 8:92560953-92560975 CTAAACATGGAAAGAAACAACGG - Intergenic
1044641935 8:94392053-94392075 CTAAACATATAAATAGATCATGG - Intronic
1045381621 8:101633400-101633422 CTAAGCATGCAAACACTCAATGG + Intronic
1045716768 8:105056154-105056176 ATAAACCTACAAATAAGCAATGG + Intronic
1045727441 8:105190981-105191003 CTAATAATACAATTAAACAATGG - Intronic
1046090100 8:109492283-109492305 CTAAAAATGAAAATAGACAATGG + Intronic
1046174776 8:110560996-110561018 CTAAACAGACAACTACAGAATGG - Intergenic
1046228487 8:111318954-111318976 CTAAACATAGAAATTCACTAGGG - Intergenic
1047101481 8:121680890-121680912 CTAAAAATAAAAATAAAAAAAGG + Intergenic
1047500011 8:125433092-125433114 CTAGACTTGCAAATACCCAAAGG - Intronic
1047721593 8:127645098-127645120 TTAAACAAACAAATACAAATTGG - Intergenic
1047771636 8:128034596-128034618 CTAAACATACATGTGCAAAATGG + Intergenic
1049837628 8:144748485-144748507 TTAAACATAAAAACACAAAAGGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050538056 9:6646919-6646941 CTAAAAATAAAAATAAAAAATGG - Intergenic
1050824292 9:9925825-9925847 CAAAACAAACAAACAAACAAAGG - Intronic
1050856669 9:10365972-10365994 CTAAACAGTCAAATGCAGAATGG + Intronic
1050889449 9:10805809-10805831 TTAAAAAAACAAATAAACAATGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051042969 9:12836813-12836835 CTGAATATACAAATACACTCTGG + Intergenic
1051409336 9:16772864-16772886 AGAAACATACAACAACACAAGGG + Intronic
1052254335 9:26436556-26436578 CTCAACATACAAGTAAACTACGG + Intergenic
1052439080 9:28470029-28470051 CTATATATACATATACATAAAGG - Intronic
1052590940 9:30493879-30493901 ATACACATACACACACACAATGG + Intergenic
1052666426 9:31500487-31500509 CTGTACACACACATACACAATGG + Intergenic
1054778490 9:69144432-69144454 CTAAACAAACCCATACATAAAGG - Intronic
1055100144 9:72455851-72455873 GTCAACATACAACTCCACAAAGG - Intergenic
1055482640 9:76724858-76724880 ATAAACATACAGAAACAAAAAGG - Intronic
1055699572 9:78928424-78928446 CTGAACATACCAACAAACAATGG + Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055819970 9:80250749-80250771 CTAAACACAGAATGACACAAAGG + Intergenic
1056562680 9:87746134-87746156 GAAAATATACATATACACAATGG - Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056882023 9:90403971-90403993 CTAATGATAGAAAAACACAATGG - Intergenic
1056906516 9:90654992-90655014 CTAAAAATACAAAAACTCACTGG + Intergenic
1057233466 9:93339667-93339689 GAAAACAGACAAATACACTAGGG + Intronic
1057482267 9:95454462-95454484 GAAAAAATACAAATATACAAAGG + Intronic
1057594741 9:96405567-96405589 ATATACATATACATACACAATGG + Intronic
1057809553 9:98247163-98247185 CTAAAAATACAAAAACAAACTGG + Intronic
1058356395 9:104088500-104088522 ATACACATAGAAATACACAAGGG + Intergenic
1058481584 9:105401231-105401253 TTAAATATACAAATAAGCAAAGG - Intronic
1058728363 9:107825575-107825597 CTAAATTTATAGATACACAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059791953 9:117649720-117649742 CTAAACAAACAAAAAAATAATGG + Intergenic
1060265020 9:122106988-122107010 GTAAAAATAAAAATAAACAAAGG + Intergenic
1061044647 9:128158498-128158520 CAAAACAAACAAACAAACAAAGG + Intergenic
1061379659 9:130246611-130246633 CTTAATACACACATACACAAAGG - Intergenic
1062515892 9:136935514-136935536 CTAAAAATACAAAAAAAAAAAGG - Intronic
1062553851 9:137105014-137105036 CTAAAAATACAAAAAAATAACGG - Intronic
1202799675 9_KI270719v1_random:163752-163774 CTAAAATTTAAAATACACAATGG + Intergenic
1203451112 Un_GL000219v1:117668-117690 ATAAACATACAAAGAAGCAATGG - Intergenic
1185574004 X:1155977-1155999 CTAAAAATACAAAAAAAAAATGG - Intergenic
1185574029 X:1156115-1156137 CTAAAGATACAAAAAAAAAATGG - Intergenic
1185574055 X:1156253-1156275 CTAAAAATACAAAAAAAAAATGG - Intergenic
1185653345 X:1665244-1665266 CCAAAGACACAAAGACACAAAGG - Intergenic
1186107569 X:6224293-6224315 CTAAACATTCAAGTGCACGAGGG - Intronic
1186366541 X:8900544-8900566 CTAAAAAGACAAATAGAGAAAGG + Intergenic
1187671984 X:21676861-21676883 ATAAACATACAGATACAGATAGG + Intergenic
1187797329 X:23018468-23018490 GTAAAAATAAAAATACACATGGG - Intergenic
1188998228 X:36912489-36912511 CTACACATACATACACACAGAGG + Intergenic
1189189178 X:39082816-39082838 CTAATCATAGAAACACAAAAAGG + Intergenic
1189630906 X:42952333-42952355 CTAAACATATAAATAAAAGAGGG + Intergenic
1189829538 X:44956803-44956825 CCAACCATACGCATACACAATGG - Intronic
1190046835 X:47118772-47118794 ATAAACAAACAAAAACACGAAGG - Intergenic
1190309627 X:49107668-49107690 ATAAACAAACAAATAAATAAAGG + Intergenic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191819662 X:65290634-65290656 GAAAATATACATATACACAATGG + Intergenic
1191845091 X:65541141-65541163 CAAAACAAACAAAAAAACAAAGG - Intergenic
1192333080 X:70195105-70195127 GAAAACATACAAATAGCCAAAGG + Intronic
1192942185 X:75924331-75924353 AAAAACAGACAAATAGACAAAGG + Intergenic
1193062884 X:77224629-77224651 CTAGACATCCAAATACAAGAGGG + Intergenic
1193550867 X:82891155-82891177 ATATATATACATATACACAATGG + Intergenic
1193634992 X:83938840-83938862 GTAAACAGACACCTACACAATGG - Intergenic
1193686969 X:84589085-84589107 CTAAATAAAAAAAGACACAATGG + Intergenic
1193924709 X:87469474-87469496 CTATACAAACATATACACACTGG + Intergenic
1194076265 X:89398613-89398635 CTAGACATCCAAATACAAGAAGG - Intergenic
1194172092 X:90600292-90600314 CTAAACATTAAAATTCCCAAAGG + Intergenic
1194758400 X:97765001-97765023 TTAAACATACAAATAAGCATGGG - Intergenic
1194972761 X:100362439-100362461 TTAAAAATACCTATACACAAAGG - Intronic
1195302944 X:103549750-103549772 CTAAACATACAAAAATTCACTGG + Intergenic
1195649445 X:107269571-107269593 ATACACACACATATACACAATGG + Intergenic
1195726427 X:107922173-107922195 AGGAACATACAAATACAGAATGG - Intronic
1195800027 X:108698334-108698356 CAAAACAAACAAACAAACAAAGG - Intergenic
1195825733 X:108998446-108998468 ATATACATATATATACACAATGG - Intergenic
1195847762 X:109247139-109247161 CTAAACATGGAAAGAAACAACGG - Intergenic
1196210669 X:112992574-112992596 CTAAAAATACAAAAACCCACCGG - Intergenic
1196796076 X:119502945-119502967 CGACACGTACAAACACACAAAGG - Intergenic
1196963500 X:121030007-121030029 CCAAACCTACAAATAAATAAGGG - Intergenic
1197204109 X:123774854-123774876 CTAAAAATACAAATAGCCAGGGG + Intergenic
1197393161 X:125894114-125894136 CTAGACATCCAAATACAAGAAGG - Intergenic
1197497695 X:127206179-127206201 ATACACATACAAATTCAAAATGG + Intergenic
1198424243 X:136498668-136498690 ATATATATACAAATACAGAATGG - Intronic
1198848334 X:140937728-140937750 CAAAACAGAGAAATACAAAAAGG + Intergenic
1198874447 X:141207919-141207941 CTAAAAAAACAAGTACATAATGG + Intergenic
1198986961 X:142465642-142465664 CTAGGAATACAAACACACAAGGG + Intergenic
1199945541 X:152663323-152663345 GAAAACATACATATACACCATGG - Intergenic
1200305406 X:155021215-155021237 ATACACATACACACACACAAAGG - Intronic
1200428905 Y:3054136-3054158 CTAGACATCCAAATACAAGAAGG - Intergenic
1201282239 Y:12352176-12352198 CAAAACATACAAACAAAAAAAGG + Intergenic
1201295347 Y:12458490-12458512 ATAAGCATGCAGATACACAAAGG + Intergenic
1201347066 Y:12996513-12996535 CTAAGCCTACAAATACTCATAGG - Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic