ID: 1031846980

View in Genome Browser
Species Human (GRCh38)
Location 7:126817359-126817381
Sequence AGCTCCTTCTAGTACAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031846979_1031846980 8 Left 1031846979 7:126817328-126817350 CCTAGAGTAGGCTGTGTAATATT 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1031846980 7:126817359-126817381 AGCTCCTTCTAGTACAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031846980 Original CRISPR AGCTCCTTCTAGTACAGTGA AGG Intronic
No off target data available for this crispr