ID: 1031850662

View in Genome Browser
Species Human (GRCh38)
Location 7:126858870-126858892
Sequence CTCCTTTCTGTTCCTTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 2, 2: 14, 3: 56, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031850661_1031850662 20 Left 1031850661 7:126858827-126858849 CCAATTGAGGTCTTTAAATTTGT 0: 2
1: 0
2: 14
3: 35
4: 270
Right 1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG 0: 1
1: 2
2: 14
3: 56
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031850662 Original CRISPR CTCCTTTCTGTTCCTTGAAC AGG Intronic
900357966 1:2273813-2273835 CTCCTGTCTGTTCTGTGGACCGG + Intronic
901259366 1:7860373-7860395 CTCCTGGCTGTTCCTCAAACAGG - Intergenic
901485646 1:9559007-9559029 CTCCTTTTTGTTCCTTTAAAAGG + Intronic
901853982 1:12032340-12032362 CTCCTTCCTGGTCCCAGAACCGG + Intergenic
902927465 1:19705697-19705719 CACCTGACTGTTCCTAGAACGGG + Intronic
903638396 1:24837495-24837517 CTCTTTTCTGTTCCCTGGAAAGG - Intronic
904477339 1:30773814-30773836 CTCCTTTCCTTTCCTTGATGGGG - Intergenic
905471303 1:38194113-38194135 CTCGTTTCTCTTCCTTGAGTTGG - Intergenic
906085596 1:43130975-43130997 CTTCTTTCTGTTCCTTGCACAGG + Intergenic
907518319 1:55007307-55007329 CTCCTTTTTAACCCTTGAACTGG - Intronic
907740747 1:57163399-57163421 CTCCTTTCTGTTTTATAAACAGG - Intronic
907937432 1:59055308-59055330 GCTCTTTTTGTTCCTTGAACTGG - Intergenic
907955047 1:59220374-59220396 TTCCTTCCTCTTCCTTGCACAGG - Intergenic
908727552 1:67193076-67193098 CTCCTTGCTGCTCTTTGAACAGG + Intronic
909531382 1:76685385-76685407 CACCTTGCTATTCCTTGAACAGG + Intergenic
910874646 1:91867228-91867250 CTCCTTTCTTTTCCTGCCACTGG - Intronic
911305563 1:96228031-96228053 CTCCTTCCTGTCCCTAGAAGTGG + Intergenic
911480643 1:98435804-98435826 CTCCATTCTCTGCCTTAAACTGG - Intergenic
912576958 1:110680849-110680871 CTACTTGCTGGTCCTTGGACAGG + Intergenic
915030397 1:152875287-152875309 CTCCTTGCTGTTCCTGCAGCAGG - Intergenic
915473197 1:156137892-156137914 CTCCTCCCTATACCTTGAACAGG + Intronic
916804355 1:168244022-168244044 TGCCTTTCTGTTCTTTGCACAGG + Exonic
916950001 1:169770277-169770299 CTTCTTTTTGGTCCTTGAACAGG - Intronic
917255131 1:173107490-173107512 TTTCTTTCTGTTGCTAGAACAGG + Intergenic
918706648 1:187671069-187671091 CTCCTATCTATTGCTGGAACAGG - Intergenic
918996934 1:191773673-191773695 CTCCTGTCAGTTCCCTGCACAGG - Intergenic
919004875 1:191884498-191884520 CTCCTTTCTGGTACTTGAGCGGG - Intergenic
919658865 1:200223678-200223700 CTTCTTTCTGCTCCTTGAACAGG - Intergenic
919764407 1:201116925-201116947 CTCCTTTCTGTCTCTTGGAGAGG - Intronic
920390813 1:205599575-205599597 TGCCTTTCAGTTCCCTGAACAGG - Intronic
920919695 1:210288285-210288307 CTCCTTGCTCTTCCTTGAACAGG - Intergenic
922221773 1:223613774-223613796 CTCCCTTCTCTTGCTTTAACTGG - Intronic
922639889 1:227219171-227219193 CTCCTTTCAGACCCTAGAACTGG + Intronic
924262283 1:242244340-242244362 CTCCTATTTGTCCCATGAACAGG - Intronic
1064073442 10:12249559-12249581 CTCCTTTTTCTTCTTTGTACAGG + Exonic
1065253528 10:23841334-23841356 GGCCTTGCTGTTTCTTGAACAGG - Intronic
1065294024 10:24257924-24257946 CTCCTTTCTCTTCCTTCAGTGGG + Intronic
1065719389 10:28611524-28611546 CTCCTTTATGTGGCTGGAACAGG - Intronic
1066276775 10:33876615-33876637 CTCCATTGTGTTCTTTGACCTGG + Intergenic
1067677735 10:48399547-48399569 CTCCTTTCTGTTCTCAGAACAGG - Intronic
1068397089 10:56476878-56476900 CTCCTTTATGTTACTTGAATAGG + Intergenic
1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG + Intronic
1068658998 10:59604027-59604049 CTTCTTTCAGTTCCTTGAACAGG - Intergenic
1070062869 10:73002087-73002109 CTCATTTCCCTCCCTTGAACGGG - Intergenic
1072739569 10:97901347-97901369 TTCCTTTCTGTTTCTTCATCAGG + Intronic
1073045337 10:100634415-100634437 GTCCTTACTGTTCCTGGGACTGG - Intergenic
1073123495 10:101135668-101135690 CTCCTTTTTTTTCCTTGAGCGGG - Intronic
1073499351 10:103921919-103921941 CTCTCTTCTGTTCCTTGAACAGG - Intergenic
1073732199 10:106302535-106302557 CTCTTTTCTGTTATTTGAAAGGG + Intergenic
1073846351 10:107559978-107560000 CTGCTTAATGATCCTTGAACTGG - Intergenic
1075220648 10:120581606-120581628 CTTCTTGCTACTCCTTGAACAGG + Intronic
1076586160 10:131549090-131549112 TTCCTTTCTTCTCCTTTAACAGG - Intergenic
1079140056 11:17802641-17802663 CTCCTTGCTCTTCCTCCAACTGG + Intronic
1083409840 11:62484577-62484599 CTCCTTGCTGTTCCTTGATCTGG - Intronic
1083530541 11:63417887-63417909 CTCCCAGCTGTTCCTTGTACAGG - Intergenic
1083615958 11:64026729-64026751 CTCTTTTCTCTTCCTTCAATAGG + Intronic
1083770183 11:64862936-64862958 CTCCTTACTCTTCCTAGACCGGG - Intronic
1084277649 11:68062788-68062810 TCTCTTTCTGTTTCTTGAACTGG - Intronic
1085151143 11:74253736-74253758 CTCCTTTCCCTTCCCTGTACTGG + Exonic
1085809085 11:79664430-79664452 CTCCTTCCATTTCCTTGAAAAGG - Intergenic
1085984348 11:81767358-81767380 CTCACCTCTGTTCCTTGACCTGG - Intergenic
1086367721 11:86124670-86124692 CTCCTTTCTCTTCTTCCAACAGG - Intergenic
1086499354 11:87436353-87436375 CTCTTTTCACTTCCTTGACCTGG + Intergenic
1087559597 11:99770063-99770085 TCTCTTTCTGTTCCTGGAACAGG + Intronic
1087605829 11:100376816-100376838 ATCCTTTCTGTTTCCTGAACTGG - Intergenic
1087824716 11:102752127-102752149 CTCCTTTGTCTTCCCTGAAAGGG - Intergenic
1088591971 11:111411318-111411340 CCCCTTGCCGCTCCTTGAACAGG + Intronic
1089523478 11:119081266-119081288 CTCGTTTCTGTTCCTGGGCCCGG - Exonic
1091174872 11:133548845-133548867 CTTCTTTCAGTTCCTTAAATGGG - Intergenic
1094669408 12:32554814-32554836 CTCCTTGCTATTCCTCCAACAGG - Intronic
1095203572 12:39413403-39413425 ATCCTTTGCGTTCCTTGACCAGG + Intronic
1096249139 12:50016034-50016056 CTATTTTCTGTGCCATGAACTGG - Intronic
1097625329 12:61993136-61993158 CTCATTACTGTTCCCTAAACTGG + Intronic
1098445745 12:70564049-70564071 CTCTTTACTGTTCCTCCAACAGG + Intronic
1098859119 12:75687976-75687998 CTTCTTTCAGTTCTTTGAACAGG - Intergenic
1098908865 12:76188975-76188997 CTCCTTAATGTTCTTTAAACAGG + Intergenic
1099918546 12:88927438-88927460 CTCTTTTCTGTTTCTTCAATAGG + Intergenic
1100465622 12:94842242-94842264 CTCCTTTCTCTTCCTTGTTGGGG - Intergenic
1100699979 12:97137139-97137161 CTGCTTTCTGACCCCTGAACAGG + Intergenic
1100815039 12:98378703-98378725 CTCTTTGCTGTTCCTTAAACTGG + Intergenic
1101641368 12:106587455-106587477 CTCCTCTCTCTTCCTCGCACTGG - Intronic
1102091264 12:110190286-110190308 CTCCTTACTGTTTCTTGAACTGG + Intronic
1102174072 12:110863159-110863181 GTCCCTTCTGTTCCGTGCACAGG - Intronic
1102789296 12:115631046-115631068 TTCATTTCTGTTTCCTGAACAGG - Intergenic
1103478187 12:121233579-121233601 CTCCTCTCTGTTCTTTGATGGGG - Exonic
1103619253 12:122176301-122176323 CTCGATGCTGTTCCTAGAACGGG + Intronic
1104412845 12:128573653-128573675 CTACTTTCTGTCCCATGAATTGG - Intronic
1104426660 12:128683408-128683430 CTTCTTTCTCTTTCTAGAACAGG + Intronic
1107513485 13:41107521-41107543 CTCCTGCCTGTTCCTGGAGCCGG - Intergenic
1107594244 13:41945713-41945735 CTTCTTTCTGTTCCTTAGATTGG - Intronic
1109119688 13:58438947-58438969 CTCCTTTCTGTTAATAGATCAGG + Intergenic
1109848834 13:68034239-68034261 CTCTTTTCTGTACATTCAACGGG + Intergenic
1112691820 13:101905100-101905122 CTCCTTTCTGTTCAATGCATGGG - Intronic
1113323730 13:109263939-109263961 GGCCTTTCTGTTCCTTTATCTGG - Intergenic
1113568199 13:111333414-111333436 TTCCCTTCTGTTACTTAAACTGG + Intronic
1114948891 14:27721675-27721697 TTTCTTTCTTTTCCTTGAGCAGG + Intergenic
1115616836 14:35103281-35103303 CTTCCTTCTGTTCCTAGAACAGG + Intronic
1117301646 14:54435486-54435508 CTACTTTCTGTTTCTAAAACAGG - Intronic
1117874039 14:60232733-60232755 TTTCTTTCTGTTCCTTAGACTGG + Intergenic
1121169203 14:91838819-91838841 TTCCTTTGTTTTCCTTGAAATGG + Intronic
1123890675 15:24775348-24775370 CTCCTTTCTGTTCTCAGAACAGG - Intergenic
1125600278 15:40911865-40911887 TTCCTGCCTGTTCCTTGACCTGG + Intergenic
1127806352 15:62524518-62524540 CTCCTTTCTGAACCTTGGATAGG + Intronic
1128680900 15:69650619-69650641 CTTCTTTCTGTTCCCTGAATGGG + Intergenic
1130410293 15:83642002-83642024 TTTCTTTTTGTTCCTTGAACTGG + Intergenic
1130704172 15:86216883-86216905 CATCTCACTGTTCCTTGAACAGG + Intronic
1130769242 15:86907605-86907627 CTCCATTCTTGTGCTTGAACTGG + Intronic
1131168860 15:90162236-90162258 CTTCTTTAAGTTCCTTGAATAGG + Intronic
1131400900 15:92124881-92124903 CTCCTTTCTCTCCCTAGGACAGG - Intronic
1131473915 15:92719943-92719965 CTGTTCTCTGTTCCTGGAACAGG - Intronic
1132251770 15:100340546-100340568 CTTCTCTCTGTACCTGGAACAGG - Intronic
1132710288 16:1263324-1263346 CTGCTTTCTCTTCCTTGCAAAGG + Intergenic
1134349182 16:13420601-13420623 CTCCCTTCTGTGCTTTGAAATGG - Intergenic
1135118575 16:19745365-19745387 CTCCTTTTTGTCCCTGGAATAGG - Intronic
1135955714 16:26954860-26954882 CTTCTGTCTGTCCCTTGAAGGGG + Intergenic
1136057417 16:27700705-27700727 CTTCTTCCTGCTCCTTGATCAGG - Intronic
1137064126 16:35820027-35820049 CTCCTTTTTTTTCCTTAAAAAGG + Intergenic
1137554316 16:49461098-49461120 TTCCTGTCTGTGCCTTGAAAGGG - Intergenic
1137755247 16:50896334-50896356 CCCCTTTCTGTGCCATAAACTGG - Intergenic
1138405043 16:56785408-56785430 CTCCTTTCTGGTACTTGTAGGGG + Intronic
1138522517 16:57578878-57578900 CAGCTTTCGGTTCCCTGAACAGG + Intronic
1138729439 16:59178621-59178643 CTTCTTTCTGTTCCATGATATGG + Intergenic
1138928368 16:61619845-61619867 CTTCTCTTTGTTCCTGGAACAGG - Intergenic
1139113849 16:63925268-63925290 ATCCTTTCTCTTCCTTGAATTGG + Intergenic
1141091523 16:81133587-81133609 ATGCTTTCTGTTCCTTGAGGTGG + Intergenic
1144198801 17:12920577-12920599 CTTCCTTCTGTGCCTTGAAGAGG - Intronic
1144470085 17:15531491-15531513 TTTCTTTCTGTTCCTCGGACTGG + Intronic
1144926256 17:18812161-18812183 TTTCTTTCTGTTCCTCGGACTGG - Intergenic
1146486613 17:33248256-33248278 CTTCTCACTGTTCCTTGAACAGG - Intronic
1146832717 17:36083637-36083659 CTCCCTTCTGTTCCTTAATATGG + Intergenic
1146847197 17:36189940-36189962 CTCCCTTCTGTTCCTTAATATGG + Intronic
1150485265 17:65538736-65538758 CTACTTTCTATTCCTTGAGTTGG - Intronic
1151862476 17:76775131-76775153 CTGCTGTCAGTTCCTTTAACAGG - Exonic
1151963620 17:77420015-77420037 TTCCTGTCTGTCCCCTGAACTGG + Intronic
1152039154 17:77892025-77892047 CTCCCTCCTCTTCCTTGACCAGG - Intergenic
1153912620 18:9717473-9717495 CTATTTTCTCTTCTTTGAACAGG + Intronic
1153943645 18:9998443-9998465 CTCCTTTTTGTTCCTCTGACTGG - Intergenic
1156649434 18:39207124-39207146 CTCATTACTGTTCTTTGAAGTGG - Intergenic
1157086814 18:44588830-44588852 GTTCTTTCAGTTCCTTGAACTGG + Intergenic
1157160112 18:45306249-45306271 ATCCTTTCTGTGCTTTGAATGGG - Intronic
1157436420 18:47673565-47673587 CTTCTTGCTCTTCCTTGAAGGGG - Intergenic
1157572859 18:48724421-48724443 CTTCTCGCTGTTCTTTGAACAGG + Intronic
1157661260 18:49447191-49447213 CTTCTTTCAGGTCCTTGAACAGG - Intronic
1157778056 18:50412427-50412449 CTCCATTCTGTTTCTGGAACAGG + Intergenic
1158118471 18:54023176-54023198 CTCCTTTCTCTATCTTAAACTGG - Intergenic
1158131582 18:54158266-54158288 CTCCTTGCTGTTCCTTCTAATGG + Intronic
1158178561 18:54685759-54685781 CTCTTTTTTGTTCTTTGAAATGG - Intergenic
1159566478 18:70056653-70056675 CTCCTTGCTGTTTCTTGGATAGG + Intronic
1160938173 19:1607498-1607520 TTCCTTTTTGTTTCTTGAGCCGG + Intergenic
1161243343 19:3235102-3235124 CTCCTTGCTGTTTCTGCAACAGG + Intronic
1161250566 19:3277830-3277852 CTCCATTCTGACCCTTGATCTGG + Intronic
1161257290 19:3316455-3316477 CTCCTCGCTGTTCCTCCAACAGG - Intergenic
1161321505 19:3643718-3643740 CTCCTTGCTGTTCCCTCAGCAGG + Intronic
1161466681 19:4434820-4434842 CTCCTGTCTGTGCCTTACACCGG - Intronic
1161492150 19:4567928-4567950 CTCCTTGCTGTTCCTCCAACAGG + Intergenic
1162575571 19:11496974-11496996 CTCCTCGCTGTTCCTGGAGCGGG + Intronic
1163429929 19:17261241-17261263 CTCCTTCGGGTTTCTTGAACAGG + Intronic
1163999187 19:21081818-21081840 CTTCTTTCTGGTCTTTGAGCAGG - Intergenic
1164187052 19:22879585-22879607 CTCCTTCCTTTCCCTTGAAGTGG - Intergenic
1164691974 19:30217919-30217941 CTCCAGTCTGTTCCCTGTACAGG + Intergenic
1165369196 19:35392140-35392162 CTTCTCTCTGTCCCTTGAGCAGG + Intergenic
1166605861 19:44141966-44141988 CTCCTTGCTGTTCTTTAAAATGG + Intronic
1168102954 19:54150660-54150682 GTCCTTTCTGTGCCTTCATCTGG + Intronic
925994953 2:9284679-9284701 CTCCTGTGTGTTCCTTGCAGTGG + Intronic
926056174 2:9775453-9775475 TTCCTTTCTCTTCCTTGGCCAGG + Intergenic
926887055 2:17607427-17607449 CTTCATTCTGTCCCTTGAACAGG - Intronic
927647199 2:24885530-24885552 CTCCTTTCTGTGCCTCCAGCAGG + Intronic
928036298 2:27827106-27827128 CTCCTTGCTGTTCATTTCACTGG + Intronic
928086075 2:28347252-28347274 ATCCTCTCTGTTCCTGGCACTGG + Intergenic
928104714 2:28461335-28461357 CTCGTTTCTTTTCCTTGATAAGG + Intronic
931341376 2:61404435-61404457 CTGCTTTCTGTTACTTGAAGCGG - Intronic
932213845 2:69953435-69953457 CTGCTTTCTGTGCCATGCACGGG - Intergenic
932837584 2:75051571-75051593 ATCCTTTCTCCTCCTTGAAGGGG - Intronic
933784041 2:85824154-85824176 GTCCTTTCTGCTGCTTGACCAGG - Intergenic
934020322 2:87944085-87944107 CTCATTTGTTTTCCTTGAAGTGG - Intergenic
934489334 2:94749038-94749060 GTCCTTGTTGTTCCTAGAACAGG + Intergenic
934944444 2:98528345-98528367 TTCCTTTCTGTTCCTCAGACTGG - Intronic
935617706 2:105102983-105103005 TTCCTTTCTGTTCCCTGCACTGG - Intergenic
936577154 2:113666658-113666680 CTGGTTTCTGTTCCTTGCAATGG + Intergenic
937162414 2:119777147-119777169 CTCCTTTTTGTTCCTGGCACTGG + Intronic
937181667 2:120001920-120001942 TTCCTTTCTGTTCCTCAGACCGG + Intergenic
937463437 2:122109371-122109393 CTCCTTTCTTTACCTTGCTCTGG + Intergenic
940025992 2:149209044-149209066 CTCCTTCCTGTTCATTGAAGAGG - Intronic
941278019 2:163515356-163515378 CTCTTTTCAGTGCCTTGCACTGG - Intergenic
942284589 2:174402681-174402703 CTCTTTTCTTTTCTTTCAACAGG - Intronic
942310881 2:174655558-174655580 CTTCTTTCAGTTCCATGAAAGGG + Intronic
942611190 2:177744106-177744128 CTCCCCTCTGTTTCCTGAACTGG - Intronic
942810917 2:179999997-180000019 CTCCTATTTGTTCCCTGAAAAGG - Intronic
942961301 2:181832453-181832475 CTTCTGTCTGTTCCCTGAACTGG + Intergenic
943631289 2:190255278-190255300 CTCCATTTGGTTCCTTTAACAGG + Intronic
943786821 2:191886484-191886506 CACCTTTCGGTTCCTAGAATGGG + Intergenic
944600474 2:201297992-201298014 CTCCTTGCTGTTCCCTTAACAGG - Intronic
945443202 2:209904944-209904966 CTTCTTTCTGTTTCTTGCCCCGG - Exonic
945614753 2:212053743-212053765 CTCCGATCTGTTCCTTTACCTGG + Intronic
945665397 2:212735051-212735073 CTCCAATCTGTTCCTGGGACAGG - Intergenic
946740522 2:222796626-222796648 TGCCTTTCTGTTCCTGGGACTGG - Intergenic
947230054 2:227875497-227875519 CTCCTTGGTGTTCCTTGAATGGG + Intronic
947364311 2:229378453-229378475 CTGCTTTCCCTTCCTTGAGCAGG - Intronic
947808137 2:232982454-232982476 TTCCTTCCTGGTCCTTGAATTGG + Intronic
948313754 2:237010812-237010834 CTACTTTCTGTTCCCTGTAATGG + Intergenic
948782210 2:240328837-240328859 CTCCTCTCCCTTCCTTGTACAGG + Intergenic
1168967831 20:1909982-1910004 CTCCTTTCTCTTCTTTGAATTGG - Intronic
1169375002 20:5059468-5059490 CTCACTTCTATTCCTTCAACTGG - Intergenic
1170474787 20:16704100-16704122 AACCTTTCTGTTCCTTGAGTGGG - Intergenic
1171109042 20:22463598-22463620 CTCCTTTCTCTTCCAGGATCTGG - Intergenic
1171147188 20:22795147-22795169 CTATTTTCTGTTTCTTGAATTGG - Intergenic
1172140114 20:32716791-32716813 CTCCTTACTGCTCTCTGAACTGG - Intronic
1172498376 20:35406017-35406039 TTTCTTTCTGTTCCTTGGACTGG - Intronic
1172581449 20:36051587-36051609 CTCTTTGCTGTTCCTGGAACAGG - Intergenic
1172969816 20:38865146-38865168 CTCCTTCCAGTTCCCTCAACCGG - Intronic
1174160644 20:48547939-48547961 CTCCTGGCTGGTCTTTGAACTGG + Intergenic
1174417764 20:50378847-50378869 CCCTTCTCTGTTCCTTGAACTGG - Intergenic
1179442697 21:41406455-41406477 CAGCTTTCTGCTCCTTCAACAGG - Intronic
1181570350 22:23764883-23764905 CACCTTTCTGGGCCTTGAAGTGG - Exonic
1184224650 22:43122371-43122393 CTCCTTCATGTACTTTGAACAGG - Intronic
1184284260 22:43459521-43459543 TTCCTTTCTGTTCCTCAAACTGG + Intronic
1185423084 22:50746006-50746028 CTGGTTTCTGTTCCTTGCAATGG - Intergenic
949102666 3:164799-164821 CGCCTTGCTATTCCTTGAATAGG - Intergenic
950271192 3:11616453-11616475 CTCCTTTCCTTTCCTAGAGCAGG + Intronic
950683109 3:14598772-14598794 CTTCTTTCTCTTCCTCCAACAGG + Intergenic
950792708 3:15486160-15486182 GTTCTTTCTGTTTCTTGAAGTGG + Intronic
953006206 3:38981700-38981722 CTCCCTTATGTTTTTTGAACTGG - Intergenic
953067856 3:39491081-39491103 TTCCATTCTGTTCCTTAAAGTGG + Intronic
953455708 3:43040317-43040339 CTCTTTTCTGTTCCAGGAAAGGG + Intronic
953491321 3:43354440-43354462 CTCCTTGCTAGTCCTTGAACAGG + Intronic
954680553 3:52343743-52343765 GGCCTTTCTGTTCCTTGAGTTGG - Intronic
955458500 3:59152258-59152280 CTTCTTTCCGTTCCTAGAAGAGG + Intergenic
955939208 3:64132007-64132029 CTCCTTTAAGCTCCTAGAACTGG + Intronic
956167990 3:66410740-66410762 CTCCTTTCTATTCCTTTAATGGG - Intronic
956853921 3:73257392-73257414 CTCCTTTCTGTTCTTCCAACAGG + Intergenic
957011997 3:75017027-75017049 CTCATGACTCTTCCTTGAACTGG - Intergenic
957247217 3:77730894-77730916 CTCCTTTCTTTTCCATGATATGG - Intergenic
959795830 3:110427362-110427384 CTTCTTTCTTTTCCTTCAGCTGG + Intergenic
960434598 3:117610285-117610307 GTCCTTTTTCTTCCTAGAACAGG + Intergenic
961410038 3:126713658-126713680 TTCCTTTCTGCCCCATGAACAGG + Intronic
962308561 3:134310175-134310197 CTCCTTTCTGTTACAGGAATTGG - Intergenic
964123440 3:153210429-153210451 CTCCTTTCTGTTTTTTAACCTGG + Intergenic
964776791 3:160287882-160287904 CTAGTGCCTGTTCCTTGAACTGG - Intronic
965936953 3:174126145-174126167 CACCTTTCCCTTTCTTGAACTGG + Intronic
967377977 3:188826913-188826935 CTCCTGTCTCTTCCCTGATCAGG + Intronic
967856299 3:194120002-194120024 CTCCTGGCTGTTCCTAGAGCAGG + Intergenic
968899242 4:3423173-3423195 CTCCTCCCTGTCCCGTGAACAGG + Intronic
969330041 4:6469343-6469365 CTACCTCCTGTTCCTTGAGCAGG - Intronic
969359537 4:6653841-6653863 CTACTTTCTGTCCCATGAATTGG - Intergenic
970890021 4:21032983-21033005 CTCCTCTCTCCTCTTTGAACTGG + Intronic
971256577 4:25019633-25019655 CTCCTTGCTATTCCTCCAACAGG + Intronic
971374659 4:26047272-26047294 CTCCTTGCCTTTCCTTGAACAGG - Intergenic
971582475 4:28360143-28360165 ATCCATTCTGTTCCTTCAAAAGG + Intergenic
971694590 4:29882982-29883004 CTCACTGCTGTTCCTTGAGCCGG + Intergenic
972668344 4:41189809-41189831 CTCCTCTGTGTTACATGAACAGG + Intronic
972999308 4:44925994-44926016 CTCCTTGCTGTCACTTGAATAGG - Intergenic
973024094 4:45245371-45245393 CTCCTTTCTGTTCCTCAAACAGG - Intergenic
973180182 4:47257287-47257309 AGCCCTTCTGTTCCTAGAACTGG + Intronic
974004070 4:56538251-56538273 TTCCTTTCTGTTCCTCCAAAAGG + Intronic
975771247 4:77725216-77725238 CTCCTATTTGTTTCTTGGACAGG + Intronic
976988664 4:91335374-91335396 CTGTTTTCTCTTCCTGGAACAGG - Intronic
977420348 4:96791846-96791868 TGCCTTTCAGTTCCTTGAACAGG - Intergenic
977899757 4:102406382-102406404 CTCCTTTCTTTTCTTTGAGCAGG - Intronic
978163886 4:105583413-105583435 CTGCTTCCTGTTCCTTAAATAGG + Intronic
978309223 4:107367562-107367584 CTCCTTTCACTTTCCTGAACTGG - Intergenic
979028105 4:115603052-115603074 CCCCTTTCAGTTCCTTCCACTGG - Intergenic
979611781 4:122697269-122697291 CTTCTTTCTCTTTCTTGCACTGG + Intergenic
979757314 4:124357911-124357933 CTCCATTCTGTTCCATTAATTGG - Intergenic
981256335 4:142664393-142664415 GTCCCTTCTGTGCCTAGAACAGG + Intronic
982312935 4:154004450-154004472 CTCCTTTCTGCTCCTCGAGGCGG + Intergenic
982971356 4:161992015-161992037 CTCCTTGATGCTTCTTGAACAGG - Intronic
983102798 4:163645781-163645803 ATTCTTTTTGTTCCTTGAATTGG - Intronic
984483270 4:180333429-180333451 CTCCTTGCTGTTCCTTGAACAGG - Intergenic
985001719 4:185491629-185491651 CTGTTTTCTGTTCCTTGTAAAGG + Intergenic
985007008 4:185544135-185544157 CTCCTTATAGTTCCTTGAAAAGG + Intergenic
985244304 4:187964602-187964624 TTCCATTCTATTGCTTGAACTGG - Intergenic
985713483 5:1443080-1443102 CTCCGTTCTGCTCCTTGACAAGG + Exonic
986493941 5:8322708-8322730 CTCCTTTCTCTCCCTTGCAAAGG - Intergenic
988986190 5:36621273-36621295 CCCCTTTATGGTCCTTGCACTGG - Intronic
989151045 5:38300205-38300227 GGCCTTTATGTTCCTGGAACAGG - Intronic
989814092 5:45714351-45714373 CTTCTTCCTGTTGCTTGAAGAGG - Intergenic
991292790 5:65048923-65048945 CTCCTTCCTGCTCCTTGGAATGG + Intergenic
991998553 5:72412947-72412969 CTTCTTGCTGCTCCTTGGACAGG - Intergenic
992220450 5:74566810-74566832 CTCCTTTATGATCCTTGAGTTGG - Intergenic
993360341 5:86967327-86967349 CTGCTTTCTGTTCCCTGATCAGG + Intergenic
995724104 5:115166863-115166885 CTCCTTGCTGTGGCTGGAACAGG - Intronic
996277897 5:121690278-121690300 CTCATTTCTGTGACTTGATCAGG - Intergenic
998615302 5:143733898-143733920 CTCATTCCTGTTACTTAAACTGG - Intergenic
999448072 5:151657288-151657310 CTCCTTTCTGTTCCTGAAACAGG - Intergenic
999597714 5:153223527-153223549 CTCCTCTATGTTCATTTAACAGG + Intergenic
999619604 5:153459271-153459293 GCCCTTTCTGTTCCTTAAATAGG + Intergenic
999625705 5:153517988-153518010 CTTCCTTCAGTTCCTTAAACAGG + Intronic
1000196560 5:158964717-158964739 ATCCTTTGAGTTCCTTAAACAGG + Intronic
1000652945 5:163839697-163839719 CTCTATTCTGTTCCTTGATTTGG + Intergenic
1000980956 5:167816182-167816204 CTCCCTTCTGTTCCGGAAACAGG - Intronic
1000998227 5:167980499-167980521 CTCTTTGCTGTTCCTTAAAGAGG - Intronic
1001170234 5:169412500-169412522 CCCCTTTCTTTCCCTTGAAGTGG - Intergenic
1002089925 5:176798458-176798480 CTCCTTTCCCTTCCTTCAAGGGG - Intergenic
1002554078 5:180020601-180020623 CTCTTCTTTCTTCCTTGAACAGG + Intronic
1004177609 6:13353803-13353825 CTACTTCCTCTTCCTTGAATGGG - Intergenic
1005385753 6:25282432-25282454 CTCCTTGCTGTTCCTTGAACAGG + Intronic
1006817867 6:36865364-36865386 CTCCTTACTGTCCCCTAAACAGG + Intronic
1007768676 6:44176723-44176745 CTCCTCTCTGTGCCTTGGATGGG + Intronic
1008023814 6:46610912-46610934 CTCCTTCCTATTCATTTAACTGG - Intronic
1009993508 6:70873741-70873763 CTTTTTTCTGTTCCTTAAACTGG + Intronic
1010144410 6:72650216-72650238 CTATTTTCTTTTCTTTGAACTGG + Intronic
1011370152 6:86628333-86628355 CTCCTTTCTGTCCCCTGCTCTGG + Intergenic
1012982802 6:105847533-105847555 CTCCTTTCTTTTCCTTGCTGTGG - Intergenic
1015864248 6:137711684-137711706 CTCCTTCCTGTTGCTGGAGCTGG - Intergenic
1016365302 6:143309595-143309617 CTGCTTTCTATTCATTGCACTGG - Intronic
1016380759 6:143476232-143476254 CTCCTTGCTATTCCTTGAACAGG - Intronic
1016584741 6:145671945-145671967 GTAATTTCTGTTCCTTGAAAAGG - Intronic
1016839600 6:148513248-148513270 CTTCCTACTGTTCCATGAACTGG + Intronic
1017026958 6:150189878-150189900 CACCTTTCTGTTCTTTTAAATGG + Intronic
1017114121 6:150960783-150960805 CTTCCTTCTGTTCCTTGGAAAGG - Intronic
1017174073 6:151485423-151485445 CTCCTTTCAATTCCCTTAACTGG + Intergenic
1017361142 6:153573215-153573237 CTGTTTTCTTTTCCTTGAAGAGG - Intergenic
1018395691 6:163376513-163376535 CTCCTCCTTGTTCCTAGAACAGG - Intergenic
1018505366 6:164462023-164462045 ATCTTCTCTGTTCCTTGAACAGG - Intergenic
1018914607 6:168125403-168125425 CCCCTTTCTCTTCCCTGAGCAGG + Intergenic
1020110970 7:5447599-5447621 GTGCTTTCTGTCCCTTGACCTGG + Intronic
1020543941 7:9499728-9499750 CTCCTAGCTATTTCTTGAACTGG + Intergenic
1020863968 7:13532681-13532703 CATCTCTCTATTCCTTGAACTGG + Intergenic
1021455885 7:20829293-20829315 CTTCTTTCTGTTACTTAAATAGG + Intergenic
1021464047 7:20921639-20921661 CTTCTTTCTGTTGTTTGAAAGGG + Intergenic
1022146491 7:27547166-27547188 CTCCTTGCTGTTCTTGAAACAGG + Intronic
1022843471 7:34187608-34187630 TTCCTTTCTCTTCCTAGAAAAGG + Intergenic
1023911257 7:44558492-44558514 CTCCTTTCCTTTCCTTGACAGGG + Intergenic
1024005486 7:45222403-45222425 CTTCTTGTTGTTCCTTGAACAGG + Intergenic
1025252885 7:57363707-57363729 CCCTTCTCTGTTCCTTGAACTGG + Intergenic
1026243898 7:68601181-68601203 CTCCTTTCTGACCCTTCAACTGG + Intergenic
1027345373 7:77254181-77254203 CTCCTTTATGTTACTTGGAATGG - Intronic
1028581725 7:92416054-92416076 CTCCTCTCAGTTCATGGAACAGG + Intergenic
1028611512 7:92717333-92717355 CCCCTTTCCTTTCCTTGACCAGG - Intronic
1028680422 7:93522685-93522707 TTCCTGCCTGTGCCTTGAACTGG - Intronic
1028703820 7:93814925-93814947 CTGCTTTCTCTTCCTTAACCAGG - Intronic
1029045724 7:97626148-97626170 CTTCACTCTGGTCCTTGAACAGG + Intergenic
1030215364 7:107039609-107039631 CTCCTTTTTTTTCCTTGAGTGGG + Intergenic
1030298521 7:107952810-107952832 CTTCTTTCTCTTCCTTAAGCTGG + Intronic
1030555868 7:111022947-111022969 CTCATTTCTGAGCCATGAACCGG + Intronic
1030631249 7:111898210-111898232 CTCCTTGCTATTCCTTGAAAAGG + Intronic
1031012985 7:116542963-116542985 CTCTTTTCTGTGCCAGGAACTGG - Intronic
1031071387 7:117165865-117165887 CAGCTTTCAGTTCCTTAAACAGG - Intronic
1031850662 7:126858870-126858892 CTCCTTTCTGTTCCTTGAACAGG + Intronic
1032474644 7:132203676-132203698 CTCCCATCTGCTCCTTGAGCTGG - Intronic
1032856538 7:135838310-135838332 CTCCTTTCTATTTCTTAAACGGG - Intergenic
1034326035 7:150234270-150234292 ATCCTTCCTGTTCCTTGTAAGGG - Intergenic
1034364888 7:150537627-150537649 CTTCTTTTTGTTCCTCGTACTGG - Intergenic
1034767170 7:153734986-153735008 ATCCTTCCTGTTCCTTGTAAGGG + Intergenic
1034933028 7:155178650-155178672 TTCCTTTCTGTTGTTGGAACAGG + Intergenic
1035818734 8:2568526-2568548 CACCTTTTTGTTTCTTAAACTGG + Intergenic
1036762064 8:11516209-11516231 CTACTTTCTGTTCTCTGAATGGG - Intronic
1037710855 8:21354412-21354434 CTACTTTCTGTTCCTTAAAAAGG - Intergenic
1037760518 8:21738662-21738684 CTTCTCTCTGTTCCTTGCAGAGG - Intronic
1038835112 8:31112023-31112045 CCCCATTCTGTTGCTTAAACAGG + Intronic
1039148287 8:34474741-34474763 CTCCTTGCTGTTCCTCACACAGG - Intergenic
1039263749 8:35802268-35802290 CTCCTTGCTGCTCCTTGAATAGG - Intergenic
1039707779 8:40024815-40024837 CCCCTGTTTGATCCTTGAACCGG + Intergenic
1040033861 8:42850143-42850165 CTCCTTGCTGTCCTTTGAGCAGG - Intronic
1042080765 8:65048228-65048250 TGGCTTCCTGTTCCTTGAACTGG + Intergenic
1043732029 8:83694609-83694631 CTCCTTGCTGTGCCTGAAACAGG - Intergenic
1044902541 8:96963051-96963073 CTACTTACTGTTACTTAAACTGG - Intronic
1046705016 8:117440041-117440063 CTCCCCTCTGTTTCTTCAACAGG + Intergenic
1046902169 8:119535388-119535410 CTCCTTTCTGAGCCTTGGAGAGG - Intergenic
1048382726 8:133881884-133881906 CATCTTTCTGTTCAATGAACAGG - Intergenic
1049690599 8:143957277-143957299 CTCCTTTGTGATCCATGAATTGG - Intronic
1050398948 9:5230520-5230542 CCCCTTTCTGTTCTTTGCATCGG - Intergenic
1051448661 9:17170509-17170531 ATTCTTTCTGTTCCTCTAACTGG + Intronic
1051728728 9:20115556-20115578 CTTCTTTCTGTTCATTGTACAGG - Intergenic
1053668450 9:40335245-40335267 GTCCTTGTTGTTCCTAGAACAGG - Intergenic
1053729710 9:41041043-41041065 CTCCATAATGTTCATTGAACTGG - Intergenic
1053918250 9:42961542-42961564 GTCCTTATTGTTCCTAGAACAGG - Intergenic
1054379590 9:64475297-64475319 GTCCTTGTTGTTCCTAGAACAGG - Intergenic
1054698795 9:68391019-68391041 CTCCATAATGTTCATTGAACTGG + Intronic
1054718064 9:68577268-68577290 ATCCTTTCTCTTCAGTGAACAGG - Intergenic
1055198785 9:73630257-73630279 TTCCTTTCTGATCCTTTAGCAGG - Intergenic
1055421022 9:76142467-76142489 CTCCTTGCTTTTCTTTGAACAGG - Intronic
1055434260 9:76276543-76276565 CTTCTTGATGTTCCTTGAAGGGG + Intronic
1055493326 9:76828286-76828308 TTGCTTTCTGTTCCTTGAACTGG - Intronic
1056976417 9:91259403-91259425 CACCTTTCATTTCCTTGATCAGG + Intronic
1059134914 9:111795585-111795607 CTCCTGTCTTTTCCATGAAACGG + Intergenic
1059180490 9:112208067-112208089 CTCCTTTTAGTTCTCTGAACAGG + Intergenic
1060633604 9:125182082-125182104 CTACTTTCTAATCCTTGAACAGG + Intronic
1060647873 9:125297561-125297583 CTTCTTGCTGTTCCTTGAACAGG - Intronic
1186253693 X:7697385-7697407 CCCTTCTCTTTTCCTTGAACTGG + Intergenic
1186751156 X:12622275-12622297 TTACTTTCTGTTCCTCTAACTGG - Intronic
1186751284 X:12623459-12623481 TTACTTTCTGTTCCTCTAACTGG - Intronic
1187038455 X:15567065-15567087 CTCCTTGCTGTTCCTTTAACAGG + Intronic
1189394848 X:40611895-40611917 CTCCTGCCTGTTCATTGTACTGG + Intergenic
1189518051 X:41735682-41735704 CTCCTTGCTGTTCCTCGAGCAGG + Intronic
1189540557 X:41983408-41983430 CTCCTTGCTTGTCCATGAACAGG - Intergenic
1190457921 X:50643508-50643530 CTCCTTCCTGTTCTTAGAACTGG - Intronic
1190810914 X:53882447-53882469 CTCCTTGCTGGTTCTTGCACAGG + Intergenic
1193322570 X:80139906-80139928 TTCTTTTCTGTTACTTAAACTGG - Intergenic
1194585337 X:95726300-95726322 CTGCTTTCTGCTACTTGAAAAGG - Intergenic
1194759641 X:97780017-97780039 TTTCTTTCTGTTCCTTAGACTGG - Intergenic
1196592900 X:117508662-117508684 ATCCTTTTTGATCCTTAAACTGG + Intergenic
1197249789 X:124203199-124203221 TTTCTTTCTGGTCCTTGGACTGG - Intronic
1197448617 X:126582256-126582278 CTCTTTTTTGTTCCTCTAACTGG - Intergenic
1197712903 X:129684875-129684897 CTTCTTCCTGTTCCTCTAACAGG - Intergenic
1197935622 X:131737301-131737323 CCCCTTTCTTTTCCTTGAGAGGG - Intergenic
1199124199 X:144095043-144095065 CTCATTTGTTTTCCTTGAAGTGG + Intergenic
1199408708 X:147494117-147494139 TTCCTTGCTGTTCCTTGAGCAGG - Intergenic
1199614627 X:149647172-149647194 CTCCTGTCTGCTCCATGAAGCGG - Intergenic
1199614642 X:149647253-149647275 CTCCTGTCTGCTCCATGAAGCGG - Intergenic