ID: 1031851659

View in Genome Browser
Species Human (GRCh38)
Location 7:126872128-126872150
Sequence TTGCATGTGCATAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031851656_1031851659 -9 Left 1031851656 7:126872114-126872136 CCTGCTCTTGATCTTTGCATGTG 0: 1
1: 0
2: 1
3: 16
4: 224
Right 1031851659 7:126872128-126872150 TTGCATGTGCATAGGATGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031851659 Original CRISPR TTGCATGTGCATAGGATGGA AGG Intronic
901000621 1:6147152-6147174 TGCCATGTGCATAGGACAGAGGG + Intronic
901550012 1:9989148-9989170 TTTCATGGGCACAGGATGGGGGG - Intergenic
904323558 1:29712236-29712258 TTGTCTGTGCAGAGGATGCAGGG + Intergenic
904663765 1:32104386-32104408 TCCTATGGGCATAGGATGGAGGG + Intergenic
906977404 1:50590264-50590286 TTTCATGTACATGGGTTGGAAGG - Intronic
909799814 1:79792446-79792468 TTGCATGTGCAGATTCTGGAGGG - Intergenic
910375801 1:86568706-86568728 TTGCATGTGCAAAGGTTTGGAGG - Intronic
912200677 1:107454329-107454351 TTGCTTGTGCAAAGTATGCATGG - Intronic
914437995 1:147677636-147677658 TTGCATGATCATATGATGAAAGG + Intergenic
915879879 1:159658181-159658203 TTGCATGTGTTTAAGATGGATGG + Intergenic
916217447 1:162409539-162409561 TTACATGTAAATGGGATGGAGGG - Intronic
919385043 1:196911035-196911057 TTCCATGTACAGAGGATGAATGG + Intronic
920615832 1:207491870-207491892 GTGGATGTAGATAGGATGGAAGG - Intergenic
921882467 1:220270983-220271005 TAGCATGTGCAGAGGAAGGGAGG - Intronic
922549669 1:226484741-226484763 TGGCATGTGGATATGATGGCTGG + Intergenic
923213187 1:231824918-231824940 ATGCTTGTGGAAAGGATGGATGG - Intronic
924305626 1:242685850-242685872 TTGCAAGTGAATATGATGGTGGG + Intergenic
924740280 1:246790860-246790882 TCTCATGTGCACAGGAGGGAAGG + Intergenic
1064538837 10:16385995-16386017 TTGCTTGTGAATGGGAGGGAAGG - Intergenic
1067333037 10:45339333-45339355 TGGCATGTGCATAAGACAGATGG + Intergenic
1067969896 10:50958024-50958046 TTGGATGGGCAGAGGATGGCGGG + Intergenic
1068536100 10:58243293-58243315 ATGCATATGCATTGCATGGATGG + Intronic
1069366425 10:67699014-67699036 TTGCATTTTAATAGGAGGGAGGG - Intergenic
1074831022 10:117249185-117249207 CTGCATGTGGTTAGGATGGTAGG + Intronic
1076867529 10:133175370-133175392 TTGTATGTGTGGAGGATGGATGG + Intronic
1078332714 11:10439067-10439089 TTGCTTTGGAATAGGATGGATGG - Intronic
1079496310 11:21048735-21048757 TTCCATGTGCATGGAAGGGAAGG - Intronic
1080314784 11:30936503-30936525 CTGCATGAGCTTAGGAAGGAAGG - Intronic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1083102706 11:60326624-60326646 GTTTATGAGCATAGGATGGAGGG + Intergenic
1085201206 11:74703403-74703425 TCACAGGTGCATAGGATGCAGGG + Exonic
1087229811 11:95647885-95647907 TTTCATGTGCATTAGAAGGAGGG - Intergenic
1088943221 11:114481894-114481916 TTGCAAGTGTATAGGAAGGGTGG - Intergenic
1089059902 11:115617999-115618021 GTGCATGAGCAGAGGATGTAAGG + Intergenic
1089193577 11:116676519-116676541 TTCCATGTTCATAGATTGGAAGG + Intergenic
1089242017 11:117089541-117089563 TTGCACGTTTATTGGATGGATGG + Intronic
1090616413 11:128519625-128519647 TTGCAGGTGCAAAGCAAGGATGG - Intronic
1091395053 12:149306-149328 TTGCATGTGCAGTGGGAGGAAGG + Intronic
1092164857 12:6336524-6336546 TTGCATGGGGAGGGGATGGATGG - Intronic
1092787129 12:12037107-12037129 TTGAATGTGGATGGGATGGATGG - Intergenic
1093683492 12:22030274-22030296 TTATATGGGCATAGGATGGGGGG - Intergenic
1093858561 12:24135666-24135688 CTGGATGTTCAGAGGATGGAGGG + Intergenic
1094173406 12:27518335-27518357 GTGCATGTTGATAGGAAGGATGG + Intergenic
1101015449 12:100495863-100495885 CTTCATGTGCGTAGGGTGGAAGG + Intronic
1101515978 12:105435519-105435541 TTGCAACTGCATAGCAAGGATGG + Intergenic
1105370573 13:19798413-19798435 TTCCATGTTCATAGATTGGAAGG + Intergenic
1109459199 13:62632417-62632439 TCCCATGTGCATTGGATGGATGG - Intergenic
1109589720 13:64462672-64462694 TTATATGTGTATAGGATGGAGGG - Intergenic
1110661783 13:78065943-78065965 TTACATGGGCACAGGATGGGGGG - Intergenic
1111557479 13:89900317-89900339 GTGCATGTGCAAAGGTTGGGAGG - Intergenic
1111864090 13:93746143-93746165 TTGCATGTGCATAAGATCATTGG - Intronic
1112123700 13:96441073-96441095 TTGAATCTGCATATGGTGGAGGG - Intronic
1112899216 13:104338804-104338826 GTGCATGTGCATAGTGTGCATGG - Intergenic
1116102888 14:40464661-40464683 AGGCATGTGCATGGGATGGATGG + Intergenic
1120681846 14:87489467-87489489 TTGCATATGCACAGAATAGATGG - Intergenic
1125459869 15:39895337-39895359 TTGCATGTGTATTGGCTGGTGGG - Intronic
1125785364 15:42312052-42312074 TCCCATGTTCATAGGTTGGAAGG + Intronic
1126389971 15:48137386-48137408 CAGTATGTGCATAGGAAGGAAGG + Exonic
1127298323 15:57629431-57629453 TTGCCACTGCTTAGGATGGATGG - Intronic
1128431517 15:67599638-67599660 TTGCATGGGCAGAAAATGGATGG - Intronic
1129110316 15:73333348-73333370 TTGCCTGGGAATAGTATGGAGGG - Intronic
1131761861 15:95632315-95632337 TGGCATATACATAGAATGGAAGG - Intergenic
1133093317 16:3422603-3422625 TTGTATGTGCATAGGAATGCCGG + Intronic
1133253994 16:4505098-4505120 GTGCATGTGCATATGCTGCAGGG - Intronic
1135958310 16:26975071-26975093 TTGCTGGTGGATTGGATGGATGG - Intergenic
1136849290 16:33601076-33601098 TTCCATCTGCACAGGAGGGAAGG + Intergenic
1139380866 16:66529823-66529845 ATGGATGGGCAGAGGATGGATGG - Intronic
1139537402 16:67585971-67585993 TTGCATGGGGGTAGGGTGGAGGG - Intronic
1140770382 16:78198337-78198359 TTGCATGTGTATCGGATGCGGGG - Intronic
1203110997 16_KI270728v1_random:1449726-1449748 TTCCATCTGCACAGGAGGGAAGG + Intergenic
1142688768 17:1592490-1592512 CTGCAAGTCCATAGGATGGCTGG + Intronic
1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG + Intergenic
1144412853 17:15018356-15018378 TTGCATGTGATCAGGATGGCTGG + Intergenic
1144996270 17:19271354-19271376 TGGCAGGTGCATAGAATGCAAGG + Intronic
1145288196 17:21522187-21522209 GTGCCTGTGCATAGCCTGGATGG + Intergenic
1146454959 17:33002225-33002247 CTGCATGTGGATAGAAAGGAGGG - Intergenic
1153582887 18:6593150-6593172 TTGCAAATGCATAGAGTGGAAGG + Intergenic
1154398527 18:14012043-14012065 TTCCATGTGCATGGATTGGAAGG - Intergenic
1155351667 18:24913564-24913586 TTGCATGTGCTTAGGATGATTGG + Intergenic
1156553887 18:38046037-38046059 GTCCATGTGCATAGGCTAGAAGG + Intergenic
1158525190 18:58206949-58206971 TTCCTTGTGCACAGGATGGGTGG - Intronic
1159249516 18:65856088-65856110 TGGCATGTGCATGGCATGGATGG - Intronic
1161258377 19:3322245-3322267 CTGCTTGTGAATTGGATGGAGGG + Intergenic
1163302501 19:16456879-16456901 GGGCATGTGCATAGGATGCCAGG + Intronic
1164711550 19:30360273-30360295 TTGCATGTGAACAGGATGAAGGG - Intronic
1165031479 19:33000778-33000800 TTCCATCTGCACAGGAGGGAAGG - Intronic
1165300819 19:34967661-34967683 TTTTATGGGCATAGGATGGGGGG - Intergenic
1166335717 19:42105736-42105758 TTGCAGATGGATTGGATGGATGG - Intronic
1168069092 19:53939441-53939463 TTGCCAGGGAATAGGATGGAGGG - Intronic
926303758 2:11622413-11622435 GTGCATGTCCATAGGAAGGCAGG - Intronic
927440311 2:23111414-23111436 TTGCATGCCCAGAGGGTGGAAGG - Intergenic
928535146 2:32232903-32232925 TTGCATGCTCATAGAATGAATGG + Intronic
935146463 2:100398858-100398880 TTGTGTGTGCATGGGTTGGAGGG + Intronic
940043929 2:149389601-149389623 CTGCATCTGAATAGCATGGAAGG + Intronic
942211986 2:173680476-173680498 ATCCATGTACATAGGATGGGGGG + Intergenic
943588054 2:189763524-189763546 TTTCATGTACATAGTAAGGAAGG - Intergenic
946215981 2:218183947-218183969 TTCCATGGGCACAGGATGGGGGG + Intergenic
946471382 2:219964241-219964263 TTTTATGGGCATAGGATGGAGGG - Intergenic
946496313 2:220199392-220199414 TTGCATGGGCACATGATGAAAGG + Intergenic
948343898 2:237279269-237279291 TTTGCTGTGAATAGGATGGAAGG + Intergenic
948361128 2:237421404-237421426 TTCCATGTGTAAAGGATGGGTGG + Exonic
1171217621 20:23363274-23363296 AGGCATGTGCTTTGGATGGATGG + Intronic
1171459973 20:25292772-25292794 TTCCAGGTGCATGGAATGGACGG + Intronic
1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG + Intronic
1174617095 20:51843968-51843990 TTGCCTGTGCAAGGGAGGGAAGG - Intergenic
1175817413 20:61890569-61890591 ATGGATGTGCAGATGATGGATGG + Intronic
1177584700 21:23074920-23074942 TTGCTTGGGCCTAGGATGGAGGG + Intergenic
1181766618 22:25096778-25096800 TTGCTTGAGGACAGGATGGAAGG - Intronic
1183668106 22:39256641-39256663 TTGCTTGGGCACAGGACGGACGG - Intergenic
949956684 3:9274922-9274944 TTTTATGGGCACAGGATGGAGGG + Intronic
950436395 3:12983028-12983050 GTGCTTGTGCGTGGGATGGAGGG + Intronic
951014471 3:17714983-17715005 TTAAATGTGCAAAGGAAGGAAGG + Intronic
953780835 3:45869122-45869144 GTGCATGTGCATGGGCAGGAAGG + Intronic
955073676 3:55592924-55592946 TTACATTTGCATAGGATGACAGG + Intronic
956009195 3:64812577-64812599 TTGCAGGAACATGGGATGGATGG - Intergenic
957515899 3:81250638-81250660 TTGCATGTGCATAAGAGGCTGGG - Intergenic
958672091 3:97218835-97218857 TTACAGGTGCATAGGTTGAAGGG - Intronic
958974948 3:100657240-100657262 TGGCATGTGTGTAGGGTGGAAGG - Intronic
959241826 3:103806921-103806943 TTGTATGTGTATATGATGAAAGG + Intergenic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
960313225 3:116142434-116142456 TTGCACCTGCACAGGCTGGATGG - Intronic
962711495 3:138090418-138090440 TTGCATGTGCTTGGGAAGGATGG + Intronic
963757996 3:149256115-149256137 TTACATGTGAAGAGGGTGGAGGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965469108 3:169068208-169068230 TTACTTTTGCATAGGAGGGAAGG - Intergenic
965689805 3:171343489-171343511 TTAAATGTGCCCAGGATGGAGGG + Intronic
966888866 3:184391798-184391820 TTGAATGGGCATTGAATGGATGG - Intronic
968435182 4:581717-581739 TTGCCTGTGCCCAGAATGGAGGG - Intergenic
968986180 4:3875723-3875745 TAGCATTTGCATAGAATGGAGGG + Intergenic
969294226 4:6259996-6260018 TGGCAAGTGCAGAGCATGGACGG - Intergenic
971192332 4:24439438-24439460 TAGCAAGTGCAGAGAATGGAAGG - Intergenic
971359825 4:25926946-25926968 TTACATGTCTATAGGATGGTGGG + Intronic
973614649 4:52666249-52666271 TTGCTTGAGCCTAGGAGGGAGGG + Intergenic
973995182 4:56451316-56451338 TTCCATTAGCATGGGATGGATGG + Intronic
974056657 4:56990103-56990125 TTTCATTTGAATAGGACGGAGGG - Intronic
974629992 4:64476595-64476617 TTTAATGGGCAAAGGATGGAAGG + Intergenic
974892935 4:67903351-67903373 TTCCATGTTCATAGATTGGAAGG - Intergenic
976009073 4:80465566-80465588 TAGAATGTGCACAAGATGGAAGG - Intronic
976031390 4:80758430-80758452 TTTTATGGGCATAGGATGGGGGG + Intronic
977174435 4:93803067-93803089 CTGCATGTACATAGGATGTGAGG - Intergenic
979014644 4:115418451-115418473 CTGCATGTACACTGGATGGATGG + Intergenic
979140465 4:117166255-117166277 CTACATGTGCATATGTTGGAGGG + Intergenic
980731684 4:136832265-136832287 TTTTATGGGCATAGGATGGGGGG + Intergenic
980831758 4:138138006-138138028 CTGAAAGTGCATGGGATGGAAGG - Intergenic
981373471 4:143987153-143987175 TTACATGGGTATAGGATGGGGGG - Intergenic
981884868 4:149662380-149662402 TTCCATGTGCAGATGTTGGATGG + Intergenic
982949359 4:161670184-161670206 TTGCATATACATATGAAGGAAGG + Intronic
983457067 4:167978532-167978554 TTGCATGTTCATGGATTGGAAGG + Intergenic
983864180 4:172743870-172743892 TTGCCTGTGCAGAAGATAGATGG - Intronic
984134294 4:175916264-175916286 TTGTATTTGTATAGCATGGATGG - Intronic
986247371 5:6022487-6022509 TTGCATCTTCACACGATGGAAGG + Intergenic
986812804 5:11377964-11377986 TAGCATGTATAAAGGATGGAAGG + Intronic
987700845 5:21396209-21396231 TTTAATGTGCATAGGACAGAGGG - Intergenic
988909757 5:35827358-35827380 TAGCATGTGTGTAGGGTGGAGGG - Intergenic
993998803 5:94753846-94753868 TTGCCAGTGCATGGGGTGGAAGG + Intronic
994539431 5:101076002-101076024 TGGCTTGTGCAAAGGATGGATGG + Intergenic
998790783 5:145764360-145764382 TGCCATGGGCACAGGATGGAAGG - Intronic
998902344 5:146869674-146869696 TGGGATGGGCATGGGATGGAGGG + Intronic
998933776 5:147211894-147211916 TTGCATATGGATAGCTTGGATGG + Intergenic
1000015904 5:157275768-157275790 TCCCATGTCCATAGGTTGGAAGG - Intronic
1002674684 5:180901270-180901292 CTGCATGTGCATCAGAGGGAAGG - Intronic
1003545928 6:7058356-7058378 TTGCTTTTGTATATGATGGACGG + Intergenic
1005405512 6:25483643-25483665 CTGAATCTGCATAGGATGCATGG - Intronic
1007527834 6:42512165-42512187 TGCCATGTGCATAGGAGTGAGGG + Intergenic
1008180375 6:48320732-48320754 TTTCATGGGGAAAGGATGGAGGG + Intergenic
1011140942 6:84155754-84155776 TCCCATGTGCATAGACTGGAAGG + Intronic
1011159437 6:84371792-84371814 GTGCACGCGCATATGATGGAGGG + Intergenic
1013356641 6:109351127-109351149 TTCCATGTTCACAGGAGGGAAGG - Intergenic
1016759579 6:147722432-147722454 TTGCTTGTGCAAAGTGTGGATGG - Intronic
1016808378 6:148236078-148236100 TTGCATTTGCATGGCAAGGAGGG + Intergenic
1017649597 6:156568805-156568827 TTACATGTGCACAGGATTGCTGG - Intergenic
1021348266 7:19555093-19555115 TAGCATGTGCAAAGCAAGGAGGG - Intergenic
1021820745 7:24495161-24495183 TTATATGAGCACAGGATGGAGGG + Intergenic
1022222844 7:28331243-28331265 TTGAATTTTCATGGGATGGATGG - Intronic
1023204673 7:37735088-37735110 CTGCATCTTCATGGGATGGAAGG + Intronic
1026239547 7:68560690-68560712 TGGCATGTGCCAGGGATGGATGG - Intergenic
1027794390 7:82674282-82674304 TTACATGTGGATAGGATGGCAGG + Intergenic
1031134247 7:117868828-117868850 TTGAATGTGCCTAGGAAGGATGG - Intronic
1031851659 7:126872128-126872150 TTGCATGTGCATAGGATGGAAGG + Intronic
1031949882 7:127881303-127881325 TTTAATGTGCATAGCATGGAGGG - Intronic
1034230873 7:149527520-149527542 TTGCATGTTCATAGAAAGGGAGG - Intergenic
1038183768 8:25253417-25253439 ATGTGTGTGCATGGGATGGAAGG - Intronic
1041729322 8:61048866-61048888 ATTCAGGTGCATAGGATTGATGG - Intergenic
1042518644 8:69686179-69686201 TGGCATGAGCATAGTATGTATGG - Intronic
1042818533 8:72904868-72904890 ATTCTTGTGCAAAGGATGGAGGG - Intronic
1043793971 8:84511846-84511868 TTGCATTTGCACAGCATGGATGG - Intronic
1043880389 8:85535793-85535815 TTGAATGGGAAGAGGATGGATGG + Intergenic
1047370258 8:124250352-124250374 GGGCAGGTGAATAGGATGGATGG - Intergenic
1048800374 8:138189064-138189086 TTTTATGGGCATAGGATGGGGGG - Intronic
1049350636 8:142162657-142162679 ATGGATGGGCAGAGGATGGATGG + Intergenic
1050193850 9:3058967-3058989 TTGCATTTGTATAGGCTGAAAGG - Intergenic
1050309880 9:4341717-4341739 TTGCTTGTTCATAGGAGGGAAGG - Intronic
1050741836 9:8829295-8829317 TTGCCTTGGCATAGGATGGAAGG - Intronic
1053132315 9:35623193-35623215 TTGCATAAGCATAGGATGGAGGG + Intronic
1055153657 9:73034877-73034899 GTGCATGTGATCAGGATGGAGGG + Intronic
1058306358 9:103446154-103446176 TTCCACGTGCATCTGATGGATGG - Intergenic
1058944848 9:109846589-109846611 TTGAATGTCCAGAGCATGGAGGG - Intronic
1058947108 9:109867787-109867809 GTGCATGTGGACAGGGTGGAGGG + Intronic
1059422204 9:114199329-114199351 TTGTATGTGTATGGGAGGGAAGG - Intronic
1062577536 9:137215563-137215585 TTGCATGAGCATGGGAGAGAAGG - Intronic
1186858089 X:13644866-13644888 TTACATATGCATAAGATAGAGGG + Intergenic
1189917830 X:45874428-45874450 TTGCATCTGAATTGGATGAATGG + Intergenic
1190271511 X:48867447-48867469 TTCCATGTGCATAACAGGGATGG - Intergenic
1191939537 X:66463239-66463261 TTTTATGGGCACAGGATGGAGGG - Intergenic
1192781921 X:74303260-74303282 GTGCAAGTGCATAGGGTGGGTGG + Intergenic
1194319558 X:92427199-92427221 GTGCATGTGCATAGGCATGAAGG - Intronic
1196324220 X:114383177-114383199 TTGCATGAGCAAAGGATCAAGGG + Intergenic
1197016876 X:121635582-121635604 TTGCCTGTGCATAAGATGAATGG + Intergenic
1197044334 X:121977590-121977612 TGGCCTGTGCAGAAGATGGATGG + Intergenic
1197533160 X:127655593-127655615 TTGGGCGTGAATAGGATGGAAGG + Intergenic
1198434117 X:136598660-136598682 GAGCATATGCATTGGATGGAAGG + Intergenic
1199559501 X:149147404-149147426 TTTCATGTGCTCAGAATGGAGGG - Intergenic
1199561867 X:149171982-149172004 TTACATGTTCATAGGCTGAAGGG - Intergenic
1200627682 Y:5540275-5540297 GTGCATGTGCATAGGCATGAAGG - Intronic