ID: 1031855103

View in Genome Browser
Species Human (GRCh38)
Location 7:126912611-126912633
Sequence CTGGCTACAGAGAGCTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031855103_1031855107 -6 Left 1031855103 7:126912611-126912633 CCAAGGCAGCTCTCTGTAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 244
Right 1031855107 7:126912628-126912650 AGCCAGGGCATTCCCTCACAGGG 0: 2
1: 0
2: 0
3: 15
4: 221
1031855103_1031855106 -7 Left 1031855103 7:126912611-126912633 CCAAGGCAGCTCTCTGTAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 244
Right 1031855106 7:126912627-126912649 TAGCCAGGGCATTCCCTCACAGG 0: 2
1: 0
2: 1
3: 6
4: 94
1031855103_1031855111 8 Left 1031855103 7:126912611-126912633 CCAAGGCAGCTCTCTGTAGCCAG 0: 1
1: 0
2: 1
3: 26
4: 244
Right 1031855111 7:126912642-126912664 CTCACAGGGTTCAGAGCTGAAGG 0: 2
1: 0
2: 6
3: 35
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031855103 Original CRISPR CTGGCTACAGAGAGCTGCCT TGG (reversed) Intronic
900164306 1:1238615-1238637 CTGCCTGCAGAGCGCTGCCCTGG - Intergenic
902331494 1:15733113-15733135 CTGGCAGGAGAGAGCTGTCTGGG + Intronic
902332015 1:15735360-15735382 CTGGCAGGAGAGAGCTGTCTGGG + Intergenic
902413652 1:16226606-16226628 CTGGCCACAGAGCGCAGCCTGGG + Intergenic
902690996 1:18110038-18110060 CCGGCTGCAGAGAGCTGACCCGG + Intronic
903003433 1:20282632-20282654 CTGCCATCAGTGAGCTGCCTGGG + Intergenic
904895447 1:33813965-33813987 TTGACTACAGAGGGCTGCATAGG - Intronic
904983871 1:34528476-34528498 CTGGCTGCAGGGAGATGCCTTGG + Intergenic
906208713 1:44000575-44000597 GTGGCGACTCAGAGCTGCCTGGG - Intronic
906676557 1:47697698-47697720 CTATCTCCAGAGAACTGCCTGGG + Intergenic
906953989 1:50357577-50357599 CTGCCTGCAGAGAGCTGCAGGGG + Intergenic
907248505 1:53122854-53122876 GTGGCTCCAGAGGGCTGGCTGGG - Intronic
907260797 1:53217027-53217049 CTGTCTACAGAAAGCTTCATAGG - Intronic
907824842 1:58005559-58005581 CTGGCCACAGCCAGCTGTCTGGG - Intronic
908139556 1:61170120-61170142 CTGGCTATATAGAGCTACCCTGG + Intronic
908194316 1:61734219-61734241 AAGGCTACAGTGAGCTGCATTGG - Intergenic
911124463 1:94327647-94327669 ATGGATAAAGATAGCTGCCTTGG - Intergenic
911574616 1:99560479-99560501 CAGGCTACAGAGAGATGATTAGG + Intergenic
912403605 1:109417682-109417704 CTGGCTTCTGAGAGCTGAGTAGG - Intronic
915568655 1:156731817-156731839 CAGGCTTCAGAGAACTGACTCGG + Intronic
915736645 1:158089479-158089501 CTGGGCAGAGAGAGCAGCCTCGG - Intronic
917585871 1:176425945-176425967 CTGGCTCCATAGCCCTGCCTGGG + Intergenic
918055645 1:181019483-181019505 CTGACTCCAGAAAGCTGCGTGGG + Intronic
918177976 1:182061759-182061781 CTGCATCCAGAGAGCAGCCTGGG + Intergenic
921174124 1:212578986-212579008 AAGTCTCCAGAGAGCTGCCTGGG - Intronic
922887313 1:229030059-229030081 CTGACCACACAGAGGTGCCTGGG - Intergenic
924451299 1:244181486-244181508 CTGGCTTCAGAGAGGTGACAGGG - Intergenic
924794550 1:247283897-247283919 CTGGATGCAGAGGGCTGGCTGGG - Intergenic
1066962814 10:42236335-42236357 CTGGGTGCAGAGGGCTGGCTGGG - Intergenic
1067432180 10:46251933-46251955 CTGGCCACAGAGAGCTGGCCTGG - Intergenic
1067441049 10:46309411-46309433 CTGGCCACAGAGAGCTGGCCTGG + Intronic
1067684146 10:48457144-48457166 CTGGGTACAGAGAGGTGACGAGG - Intronic
1069235529 10:66067133-66067155 CTGGCTTCTGTGACCTGCCTTGG - Intronic
1069800877 10:71080777-71080799 CTGGGAACAGAGCGCTACCTTGG - Intergenic
1072118078 10:92382678-92382700 CTGGGTTCAGAGAGCTTCCGGGG - Intergenic
1074151621 10:110764426-110764448 CTGTCTCCATAGAGCTGGCTTGG + Intronic
1074225033 10:111476451-111476473 CTGGTTACAGAGAGAAGGCTTGG + Intergenic
1074870213 10:117570191-117570213 CTGGCTGCAGAGAGCTCAGTGGG + Intergenic
1075845614 10:125542763-125542785 CGGGCTGCAGAGAGATCCCTGGG + Intergenic
1076350862 10:129814356-129814378 AAGGCCTCAGAGAGCTGCCTTGG + Intergenic
1076854263 10:133108235-133108257 CTGGCCCCAGAGCTCTGCCTCGG + Intronic
1077159158 11:1104843-1104865 CTGGGCACAGAGGGCTGCGTAGG - Intergenic
1077350794 11:2092324-2092346 ATGGTTACTGAGAGCTGCCAGGG + Intergenic
1081301865 11:41462443-41462465 ATGGATACAGAGGGCTGACTGGG - Intergenic
1081744175 11:45461529-45461551 CTAGATAGAGAGAGCTGCCATGG - Intergenic
1081769975 11:45643895-45643917 CTGGCGAGAAAGAGGTGCCTTGG + Intergenic
1084957996 11:72701773-72701795 CCGCCTACAAAGAGGTGCCTCGG - Exonic
1086421935 11:86645468-86645490 CTGGCTACAACGAGCTGCAGTGG - Intronic
1087158213 11:94924830-94924852 CTGCCTGCACAGGGCTGCCTAGG - Intergenic
1089618737 11:119710031-119710053 GTGGGTAGAGAAAGCTGCCTGGG + Intronic
1089684426 11:120137845-120137867 CTGGCTTCAGGGCGCTGCCCAGG + Exonic
1090395128 11:126413903-126413925 CTGGGGACAGAGAGGTCCCTGGG + Intronic
1090412261 11:126517481-126517503 CTGGCTACAGAGGGGTGGTTGGG + Intronic
1092394543 12:8114082-8114104 CTTGCTACAGAAACCAGCCTCGG - Intergenic
1092996917 12:13959363-13959385 CAGGCTGCAGAGGGCTTCCTGGG + Intronic
1095968751 12:47886910-47886932 ATGGCTACAAAGAGCTATCTAGG - Intronic
1096054229 12:48637592-48637614 GAGGCTTCAGAGAGCTGCCTGGG + Intergenic
1097065817 12:56319697-56319719 CTGGCTACTGACATCTGGCTTGG + Exonic
1097202347 12:57289882-57289904 CTGGCTAAAGGGAGCTGATTAGG - Intronic
1098812966 12:75119633-75119655 CTTGCCCCAGAGAGCTGCATAGG + Intronic
1102798226 12:115708053-115708075 CTGGAGACAGACTGCTGCCTGGG + Intergenic
1102817682 12:115880948-115880970 GAGGCCCCAGAGAGCTGCCTTGG + Intergenic
1103405442 12:120671702-120671724 CTGGCTACCCTCAGCTGCCTGGG - Intergenic
1104203115 12:126611105-126611127 CTGGCCAAAGGGAGCAGCCTTGG + Intergenic
1105781629 13:23709713-23709735 CTTGCTGCCTAGAGCTGCCTTGG - Intergenic
1106603681 13:31208740-31208762 CTGCCTCCAGAAAGCTGTCTTGG + Intronic
1107083271 13:36397738-36397760 GAGGCTACAGTGAGCAGCCTGGG + Intergenic
1110134503 13:72048678-72048700 CATGCTTCTGAGAGCTGCCTTGG + Intergenic
1112975256 13:105309549-105309571 CTGGCTACAGTGTATTGCCTGGG - Intergenic
1113510232 13:110848258-110848280 CAGTCTACAAAGAACTGCCTGGG + Intergenic
1113970311 13:114183671-114183693 GAGGCTTTAGAGAGCTGCCTGGG - Intergenic
1114189640 14:20430531-20430553 AGGGCTACTGAGAGCTGCCCAGG - Exonic
1114333124 14:21658109-21658131 TTGGCTGCAGAGAGCTGAGTTGG - Intergenic
1114364471 14:22012227-22012249 CTGGCTCCAGAGAGCTGTCATGG - Intergenic
1116111460 14:40590653-40590675 CAGGATTCAGAGAGCTTCCTGGG + Intergenic
1118812599 14:69286093-69286115 CTGGCCACAGTGAGTTGCCCAGG - Intronic
1118884832 14:69857904-69857926 CTAGTTACAGTGAGCTACCTGGG - Intronic
1119930863 14:78544869-78544891 GTGGCAACAGAGAGGTGACTGGG + Intronic
1121817199 14:96937924-96937946 CTGGTTAAAGAGAGATTCCTGGG + Intergenic
1122459687 14:101884683-101884705 CTGGCTACAGAGCCCTGGCGTGG - Intronic
1122543731 14:102511086-102511108 CTGGGGACAGAGGCCTGCCTAGG - Intergenic
1122773515 14:104107357-104107379 AGGGCTGCACAGAGCTGCCTTGG + Intronic
1123422753 15:20145219-20145241 CTGGGTGCAGAGGGCTGGCTGGG - Intergenic
1123531977 15:21151759-21151781 CTGGGTGCAGAGGGCTGGCTGGG - Intergenic
1124203785 15:27700044-27700066 CTGGGAACAGAGTGCTGCCCTGG + Intergenic
1127377478 15:58398237-58398259 CTCTAGACAGAGAGCTGCCTGGG + Intronic
1129385559 15:75194281-75194303 GTGGATACAGAGAGCTGTGTGGG - Intergenic
1131680599 15:94718368-94718390 CTGACTTCAGAAAGATGCCTAGG + Intergenic
1132273815 15:100548990-100549012 CTGGCTACAGAGTTGAGCCTTGG + Intergenic
1133436521 16:5784762-5784784 GAGGCCCCAGAGAGCTGCCTTGG + Intergenic
1136361846 16:29785673-29785695 CCCTCTACAGAGAGCTACCTGGG + Intergenic
1136723984 16:32342776-32342798 CTGGGTGCAGAGGGCTGGCTGGG - Intergenic
1137708338 16:50549747-50549769 CTGGAGGCAGAGGGCTGCCTGGG + Intronic
1141524024 16:84599811-84599833 CTCGCTCCAGGGAGCTCCCTCGG - Intronic
1141743097 16:85907377-85907399 CTGGCTAAAGACAGCTACCTGGG + Intronic
1141779702 16:86151336-86151358 CTGGCTACAGAGCGCCTCTTTGG + Intergenic
1142146146 16:88493613-88493635 CGGGGTACAGAGAGCTGTCCCGG + Intronic
1203002447 16_KI270728v1_random:174989-175011 CTGGGTGCAGAGGGCTGGCTGGG + Intergenic
1203123487 16_KI270728v1_random:1558305-1558327 CTGGGTGCAGAGGGCTGGCTGGG + Intergenic
1203134052 16_KI270728v1_random:1711395-1711417 CTGGGTGCAGAGGGCTGGCTGGG + Intergenic
1142760747 17:2040718-2040740 CTGTTTACAGAGACCTCCCTGGG + Intronic
1143334238 17:6160314-6160336 CAGACTACAGAGAGCGGACTGGG - Intergenic
1145762684 17:27435132-27435154 CTGGCTGAACGGAGCTGCCTGGG + Intergenic
1146271457 17:31488250-31488272 CTGGCTCCCGAGAGCTGGCGGGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148104551 17:45112443-45112465 CTGGGTGCTGAGGGCTGCCTGGG - Exonic
1149167061 17:53764785-53764807 CTGGTTACAGAGACCTCTCTTGG - Intergenic
1149866476 17:60153939-60153961 CTGGCCACGAAGAGCTGCTTTGG - Intronic
1151534437 17:74730684-74730706 CTGGCTGCTGAGAGCAGACTGGG - Intronic
1151829237 17:76540052-76540074 GTGGCTCCTGAGAGCTGGCTGGG + Intronic
1152419490 17:80184418-80184440 CAGGCTACACAGAGGGGCCTGGG - Intronic
1152653858 17:81510876-81510898 CTGGCTCGGGAGAGCTGACTGGG - Intronic
1153778638 18:8475709-8475731 CAGGCTGCAGAGAGAAGCCTAGG + Intergenic
1155544285 18:26899555-26899577 CTGGAGACTGAGAGCTGTCTTGG + Intergenic
1157666801 18:49494006-49494028 TTGGTTACAGAAGGCTGCCTTGG - Intergenic
1160560129 18:79750954-79750976 CTGGGTACAGAGGGCAGGCTTGG + Intronic
1160560200 18:79751159-79751181 CTGGGTACAGAGGGCAGGCTTGG + Intronic
1161357118 19:3825331-3825353 CTGGCCACAGAGAGCCCCCCCGG - Exonic
1161571527 19:5033254-5033276 CTGGCTCCAGGGAGCTGGCAGGG + Intronic
1161847690 19:6721025-6721047 CAGCCTACAGAGAGATTCCTAGG - Intronic
1164037766 19:21468977-21468999 GTGGGGACAGAGAGCAGCCTGGG - Intronic
1164144906 19:22506036-22506058 CTGGGCACAGGGAGCTGTCTTGG + Intronic
1164601906 19:29567983-29568005 CTGGGTCCAGAGATTTGCCTTGG - Intergenic
1164930518 19:32172228-32172250 GTGGCTGCAGAAAGCTGGCTCGG + Intergenic
1166566835 19:43770588-43770610 CTGGCTCCAGGGGACTGCCTGGG + Intronic
1166664782 19:44672629-44672651 CTGGATGTAGAGAGCTGCCTGGG - Exonic
1167243991 19:48363197-48363219 GTTGCTGCAGAGAGCTGCCCTGG - Intronic
1167308806 19:48724417-48724439 CTGGCTACAGGGAGCTGGGCTGG - Exonic
1167602941 19:50465107-50465129 CTGGATAGAGAGAGCTCTCTGGG - Intronic
1168292548 19:55363572-55363594 CTGCCTCCACAGAGCTGTCTGGG - Intergenic
1168292827 19:55365404-55365426 CTGCCTCCACAGAGCTGTCTGGG + Exonic
926795325 2:16614482-16614504 GTGGCCACAGACAGCAGCCTGGG - Intronic
928164814 2:28962885-28962907 CGGGCTTCAGAGAGCTGTCTGGG - Intronic
928229725 2:29487346-29487368 GTGGCCACAGACAGCTGTCTGGG - Intronic
929414812 2:41736698-41736720 CTGGCTTCAGGCTGCTGCCTAGG - Intergenic
931629960 2:64289886-64289908 TTGGCTCCCCAGAGCTGCCTTGG + Intergenic
933688651 2:85162387-85162409 CTGGATCCACAGAGCAGCCTGGG - Intronic
934768205 2:96892345-96892367 AAGGCTTCTGAGAGCTGCCTGGG + Intronic
937530075 2:122817568-122817590 CTGAGGACAGAGAGCTGACTTGG + Intergenic
937863525 2:126731533-126731555 TTGGGTACAGGGGGCTGCCTCGG + Intergenic
938108386 2:128548629-128548651 CTGGCCCCAGAAAGCTTCCTGGG + Intergenic
938288908 2:130139183-130139205 CTGTCTGCAGGGACCTGCCTGGG - Intergenic
938467625 2:131533748-131533770 CTGTCTGCAGGGACCTGCCTGGG + Intergenic
939861965 2:147431737-147431759 CTGGCTCCACTCAGCTGCCTGGG - Intergenic
940958919 2:159760512-159760534 CCAGCTACAGAGAACTCCCTGGG - Intronic
940961355 2:159789920-159789942 CTGGCATCAGAGAGCTGCTAAGG - Intronic
943200299 2:184814628-184814650 CTGGCTTTCAAGAGCTGCCTGGG + Intronic
944671691 2:201999517-201999539 CTGGCAGCAGAGAGCTGACCAGG + Intergenic
944736045 2:202566836-202566858 CTGGTTACAGATAACTTCCTAGG - Exonic
945283463 2:208059513-208059535 CTGGGAATAAAGAGCTGCCTAGG + Intergenic
946013758 2:216587776-216587798 ATGACTTCAAAGAGCTGCCTAGG + Intergenic
948247240 2:236496777-236496799 CAGGCTACAGAGAGATTCCATGG + Intronic
948585261 2:239015264-239015286 CTGGCAACCGAGAGGTGCCTGGG + Intergenic
1168897390 20:1333190-1333212 ATGGCCACATAGAGCTGCATGGG + Intronic
1168957779 20:1846584-1846606 CTGGCCACAGTGAGGTGCCATGG + Intergenic
1169803535 20:9535951-9535973 CTGGCTGTAGTCAGCTGCCTTGG + Intergenic
1170547326 20:17445576-17445598 CAGGGGACAGAGAGCTGCCTGGG + Intronic
1171192050 20:23165681-23165703 ATGCCTGCAGAGAGCTGCCCAGG + Intergenic
1174474420 20:50786264-50786286 CTGGGTACAGAGAGTGGCTTCGG - Intergenic
1175659612 20:60801502-60801524 CTGGCCTCTGACAGCTGCCTTGG + Intergenic
1175876936 20:62234707-62234729 CTGGGCACTGAGACCTGCCTGGG - Intronic
1179038950 21:37784652-37784674 GTGGTAAGAGAGAGCTGCCTGGG - Intronic
1179930747 21:44569421-44569443 CTGGCTGCAGGACGCTGCCTGGG + Intronic
1182028432 22:27138307-27138329 CAGGCTGCAGAGAGGGGCCTCGG - Intergenic
1182295608 22:29309920-29309942 CTGGGTCCAGGGAGCTGCCCAGG - Intronic
1182675459 22:32035783-32035805 CTGGCTTCAGAGAGGAGCCATGG - Intergenic
1183070464 22:35392585-35392607 CTGGCTCCAGAGACCTGCCCTGG + Intronic
1184004869 22:41700280-41700302 CTGGCCAAAGCGGGCTGCCTGGG + Intronic
1184340849 22:43885156-43885178 GGGGCACCAGAGAGCTGCCTCGG - Intronic
1184455937 22:44609439-44609461 CTGGGGACACAGAGATGCCTGGG + Intergenic
1185010330 22:48309277-48309299 GGGGCTACAGAGAGGTGCCACGG - Intergenic
1185010339 22:48309316-48309338 GGGGCTACAGAGAGGTGCCACGG - Intergenic
1185130827 22:49037662-49037684 TGGCCTTCAGAGAGCTGCCTGGG - Intergenic
950286952 3:11752505-11752527 CTAGCTACAGAGTGCTGATTAGG + Intergenic
951673865 3:25215211-25215233 CTGGCTACAGAGAACCACCTGGG - Intronic
956536302 3:70280687-70280709 CTGGCTTTGGAGACCTGCCTTGG - Intergenic
959934917 3:112019293-112019315 GGGGCTTCAGAGAGCTGCCTAGG - Intergenic
961521634 3:127470417-127470439 CTGGCTAGAGAGAACTGCCTTGG - Intergenic
961748995 3:129084706-129084728 CCGGCTCCAGGGAGCTCCCTCGG + Intergenic
961880560 3:130058674-130058696 CTGGCTCCTGCAAGCTGCCTGGG - Intergenic
962589269 3:136872543-136872565 CTGGCTACAGAAATTTGCATAGG + Intronic
962697520 3:137965030-137965052 CTGGGCAAGGAGAGCTGCCTTGG + Intergenic
966830379 3:184002879-184002901 CTGGCAACAGAGAGGTACCTCGG + Intronic
969076042 4:4578594-4578616 CTGACTAAAGACAGCTGTCTGGG + Intergenic
970142407 4:12996730-12996752 CTGACAACTGAGAGGTGCCTTGG - Intergenic
970697706 4:18697235-18697257 CTGGTTTCAGTGATCTGCCTTGG + Intergenic
972263900 4:37440297-37440319 CAGGCTACAGTGAGCTGACAAGG - Intronic
974409174 4:61517213-61517235 CCGGCGGCAGAGAGCAGCCTTGG + Intronic
978571725 4:110145258-110145280 CTGGCTCCAGAAGGCTGGCTAGG - Intronic
979500544 4:121434780-121434802 CTGGCTACAGAAATTTGCATAGG - Intergenic
981138468 4:141239205-141239227 CCAGCTTCAGAGAGCTGCCTTGG + Intergenic
983559122 4:169083754-169083776 AAGGCTGCAGTGAGCTGCCTGGG + Intergenic
985694405 5:1331738-1331760 CAGGCTCCAGTGAGCTCCCTGGG + Intronic
986320413 5:6627701-6627723 CTGGGTACAGAGAACAGCCTGGG + Intronic
986481176 5:8189698-8189720 CTTGCTGCACATAGCTGCCTGGG - Intergenic
986557380 5:9025365-9025387 ATGGCTGGAGAGATCTGCCTGGG + Intergenic
986730392 5:10631124-10631146 CTGGTTTCAAAGATCTGCCTTGG + Intronic
987203958 5:15605608-15605630 ATGGTTACAGAGAGCTTCTTTGG + Intronic
989268152 5:39501560-39501582 CTGGCTGCGGAGAGCTCGCTGGG - Intergenic
992656453 5:78914892-78914914 CTGGCTCAAGTGACCTGCCTTGG + Intronic
998800515 5:145864352-145864374 CAGGCTACACAGAGCTTTCTGGG + Intronic
999127251 5:149254750-149254772 CTGGCTTCACTGAGCTGCCCTGG - Intronic
999284990 5:150389375-150389397 ATGGCTACAGAGAAATCCCTTGG + Intronic
999829215 5:155303246-155303268 GTGGCTACAGGAAGCTGCCCAGG - Intergenic
1001436637 5:171704415-171704437 CAGGCTGCAGAGAGCTGCTAGGG + Intergenic
1002171697 5:177378329-177378351 CTGTCTCCAGAGAACTGGCTTGG + Intergenic
1002419773 5:179139511-179139533 CTGGCTGCAAACAGCTGCCCAGG + Intronic
1002533900 5:179865630-179865652 CTGGCAAGAGAGGGCTGGCTGGG + Intronic
1002534305 5:179867727-179867749 GTGGCTGCAGAGTGCTGGCTGGG + Intronic
1004058355 6:12164051-12164073 CTGGCTACAGAAGTCTGCTTGGG - Exonic
1004290268 6:14360680-14360702 ATGGCTAAAGAAAGCTGCCGAGG - Intergenic
1006442504 6:34061063-34061085 CTGGGTACACGGAGCAGCCTTGG + Intronic
1013457232 6:110341317-110341339 CTGGTTACAGAGAGTTGTTTTGG - Intronic
1015265224 6:131284962-131284984 TTGGCAACAGAGTGCTGGCTTGG + Intergenic
1016433826 6:144014713-144014735 CGGACTACAGAGAGATGCCACGG + Intronic
1018131509 6:160736212-160736234 CTGGCTACAGAGAGAAGGCAGGG + Intronic
1019644915 7:2124004-2124026 CTGGCTACAGGGGGCTTCCCAGG - Intronic
1022025741 7:26446057-26446079 CTGTCTACAGAGGGCCCCCTAGG - Intergenic
1022703129 7:32779904-32779926 CTAGGCACAGAGAGCAGCCTGGG - Intergenic
1023145902 7:37151038-37151060 CTGACTGCAGAGGGCTGACTTGG - Intronic
1023276273 7:38522032-38522054 CTGGTTACAATGAGCTGCTTGGG + Intronic
1024103498 7:46058045-46058067 CAGGACACAGAGAGATGCCTGGG - Intergenic
1024948796 7:54837257-54837279 CTGGCTTCTCAGACCTGCCTGGG + Intergenic
1024964645 7:55013176-55013198 GAGACCACAGAGAGCTGCCTTGG + Intergenic
1028360079 7:89956361-89956383 CTGACTGCAGAGATTTGCCTAGG - Intergenic
1030153411 7:106427856-106427878 CAGGCTAGAGAGAACAGCCTGGG - Intergenic
1030722447 7:112885314-112885336 CTGGCTACAGAAATTTGCATAGG - Intronic
1031297649 7:120023779-120023801 CTGGTTATACAGAGTTGCCTGGG - Intergenic
1031400765 7:121323995-121324017 CTGCCTGCAGAGATATGCCTTGG - Intergenic
1031855103 7:126912611-126912633 CTGGCTACAGAGAGCTGCCTTGG - Intronic
1032154765 7:129458800-129458822 CTGGCTACAGAGTGGTTCCTAGG + Intronic
1034194914 7:149239214-149239236 CAGGCTACAGAGGGCTGGCCTGG + Intergenic
1034977304 7:155456046-155456068 CAGGCTTCAGAGTGCTGGCTGGG - Intergenic
1035035040 7:155889339-155889361 CTGTCCACTGAGGGCTGCCTGGG + Intergenic
1035065866 7:156104876-156104898 CTGGCACCAGAGAGGTGACTTGG + Intergenic
1035123705 7:156591642-156591664 ATGACTCCAGAGAACTGCCTGGG - Intergenic
1038282766 8:26180950-26180972 GAGGCCCCAGAGAGCTGCCTTGG + Intergenic
1039496376 8:37983703-37983725 CTGGCTAAAGATTGATGCCTGGG - Intergenic
1040278930 8:46028040-46028062 ATGGCCACAGAGAGGTGCCATGG + Intergenic
1041135195 8:54750579-54750601 CTAGCTACAGAGTGCTGATTAGG - Intergenic
1042941740 8:74115014-74115036 CTGGCCACAGGGAGCTCCCTAGG + Intergenic
1044715422 8:95095398-95095420 CTGGGCACAGAGAGCGGCCAAGG - Intronic
1046044967 8:108953984-108954006 TCAGCTGCAGAGAGCTGCCTTGG - Intergenic
1046774845 8:118153033-118153055 CTGGCTAAAGAGAGCTGGCAAGG + Intergenic
1048883908 8:138893094-138893116 CTGTCTTAAGAGGGCTGCCTTGG + Intronic
1049233809 8:141497972-141497994 ATGGCCACAGCCAGCTGCCTGGG + Intergenic
1049290836 8:141800862-141800884 CTGGCTACAGAATGCTGCTTAGG - Intergenic
1051017959 9:12503896-12503918 GGAGCAACAGAGAGCTGCCTGGG + Intergenic
1051097627 9:13484487-13484509 CTGGCTACAGGGACCTGACAAGG + Intergenic
1051920361 9:22257454-22257476 CTGGAGACAGATACCTGCCTGGG + Intergenic
1055785213 9:79863748-79863770 CTGGCTGCAGGGAGCAGCCCGGG - Intergenic
1056117910 9:83459522-83459544 GAGGCTACTGAGAGATGCCTAGG + Intronic
1057382779 9:94584004-94584026 CTAGCAACAGAGAGCTGGGTGGG - Intronic
1057547628 9:96030092-96030114 CTAACTACAGAGTGCTGACTGGG - Intergenic
1057598460 9:96436801-96436823 GTGGCTACTGAGAGGTGACTTGG - Intergenic
1057795829 9:98157420-98157442 CTGCCTCCAGAGAGCTGTTTGGG + Intronic
1058038766 9:100281893-100281915 CTGGCTACAGAGAGGCTTCTTGG + Intronic
1058467483 9:105244344-105244366 CTCGAGGCAGAGAGCTGCCTCGG + Intergenic
1058759769 9:108119628-108119650 AGGGCCACAGAGAGCTGCCCAGG + Intergenic
1061177317 9:129005581-129005603 CTGTGTACCGAGAGCTACCTGGG + Intronic
1062725870 9:138073173-138073195 CTGGCAGCAGAGAGATGCCTGGG + Intronic
1185863902 X:3605456-3605478 CTGGCTACAGAGTGGAGCCTTGG + Exonic
1186909086 X:14142362-14142384 CTGGCAACAGCGAGCAGCCAGGG - Intergenic
1187929381 X:24279888-24279910 CTGGCTACAGAAAATTGCCTGGG + Intergenic
1190359348 X:49634550-49634572 TCAGCTTCAGAGAGCTGCCTGGG - Intergenic
1193812041 X:86063426-86063448 GTGGAGACAGAGAGGTGCCTTGG - Intergenic
1197931747 X:131703496-131703518 CTTGGTCCGGAGAGCTGCCTTGG - Intergenic
1199933925 X:152552979-152553001 CTGGCTCCAGAGCTCTGCCCTGG + Intergenic
1200124296 X:153805996-153806018 CTGGCTAAAGAGAGGTGGCTGGG + Intronic
1200149696 X:153945115-153945137 AAGGCTGCAGTGAGCTGCCTGGG - Intergenic
1200800257 Y:7380477-7380499 CTGGCTACAGAGTGGAGCCTTGG - Intergenic
1202584004 Y:26406017-26406039 CTGGGTGCAGAGGGCTGGCTGGG - Intergenic