ID: 1031859442

View in Genome Browser
Species Human (GRCh38)
Location 7:126961169-126961191
Sequence CTATGTAAAAAGGTTAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031859442 Original CRISPR CTATGTAAAAAGGTTAAGCT TGG Intronic
903792178 1:25901456-25901478 CTTTGTAAAAGGGTTGAGCTTGG - Intronic
904742027 1:32685143-32685165 TAATGAAAAAAGGATAAGCTGGG - Exonic
907027889 1:51139435-51139457 CTTTGTATCAAGGTTATGCTAGG + Intronic
907688796 1:56642073-56642095 CTATGTAAAAAAGTTGAGGAGGG + Intronic
908136946 1:61143019-61143041 TTATGTAAACAGGTGAAGCCAGG - Intronic
908715013 1:67060604-67060626 CTAAGTAAAAAGGTTTTGTTTGG + Intergenic
908803629 1:67907082-67907104 CAAAGTAAAAAGAATAAGCTGGG - Intergenic
910814237 1:91272940-91272962 GTATGTAGAAATGGTAAGCTTGG - Intronic
910938350 1:92505600-92505622 CTATGGAGAAAAGTAAAGCTAGG + Intergenic
913229863 1:116732815-116732837 ATATGTCAAAAGGTGAAGCAGGG + Intergenic
914340582 1:146756417-146756439 CTATTTAAAAAGAATGAGCTAGG + Intergenic
914730160 1:150363082-150363104 TTCTGTAAAAAGGTGAAGCAGGG - Intronic
915918532 1:159956817-159956839 ATGTATAAAAAGGTTAAACTAGG + Intergenic
916964321 1:169919512-169919534 GTATGTAAAAATATTAGGCTGGG + Intergenic
917169841 1:172159180-172159202 CTATGCAAAAAAGTTATGGTTGG + Intronic
917349812 1:174065107-174065129 CTTTGGAAAAAGGTTAAGGTGGG + Intergenic
917652588 1:177093586-177093608 TTGTGTAAAAAGGGTAAGCCTGG + Intronic
918454036 1:184688647-184688669 AAATGTAAAAAGGTGAAGCCAGG + Intergenic
919890399 1:201968673-201968695 CTGGGTAAAAAAGATAAGCTGGG - Intronic
1064112148 10:12548763-12548785 CTCTGTAAAATGGTTAAAATAGG - Intronic
1064251777 10:13711356-13711378 CTTTGTAAACAGGGTAAGGTGGG + Intronic
1071000962 10:80830003-80830025 CTATTTAAAAAATTTAAGATAGG + Intergenic
1071379891 10:85048021-85048043 CTCTGTATAAAGCTGAAGCTAGG + Intergenic
1074694840 10:116040894-116040916 TTATGTAAAAAGATTCAGTTCGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1081341195 11:41929587-41929609 TTATATAAAAAGGTAAGGCTGGG - Intergenic
1085828988 11:79879483-79879505 ATGTGTAAAGATGTTAAGCTTGG + Intergenic
1086130693 11:83399005-83399027 CTATGTAAAAAGGTATATTTAGG + Intergenic
1087528184 11:99345389-99345411 CTGTGTACAAAGGTGAAGATAGG - Intronic
1087647659 11:100827301-100827323 CTATGTAAAGATGTAAGGCTTGG - Intronic
1087734916 11:101820985-101821007 CTATTTAAAAATGTTAACATGGG - Intronic
1088036313 11:105320446-105320468 CGATATAAAAAGTTTAAGCAAGG + Intergenic
1092132965 12:6125183-6125205 CTTTGTAAAATGGTGAAGGTGGG + Intergenic
1092222221 12:6722406-6722428 CTCTCTAAAAATGATAAGCTTGG + Intergenic
1092737576 12:11597565-11597587 CAGTGGAAAAAGGTTAATCTTGG + Intergenic
1093612311 12:21176471-21176493 CTTTTTAAAAAGGTGAAACTAGG + Intronic
1094351776 12:29534148-29534170 CTACCAAAAAATGTTAAGCTAGG + Intronic
1098609413 12:72436219-72436241 ATATTTTCAAAGGTTAAGCTAGG - Intronic
1099141611 12:78983525-78983547 AAATGTAGAATGGTTAAGCTAGG - Intronic
1099318057 12:81109243-81109265 CTATGTAAAAAGGCTGATTTTGG + Intronic
1099898974 12:88683610-88683632 CTATTTAAAAATCCTAAGCTTGG - Intergenic
1100894687 12:99168219-99168241 CTACTTTAAAAAGTTAAGCTGGG + Intronic
1102145470 12:110651872-110651894 CTTGTTAAAAAGATTAAGCTGGG + Intronic
1104192685 12:126498413-126498435 CTATGTAAAGAAGTTATGCAAGG + Intergenic
1104243590 12:127015484-127015506 CTATATAAAAATGTTAAGAAGGG - Intergenic
1105295940 13:19088030-19088052 CTTTGTAAAATAGTTAAGGTTGG - Intergenic
1105718511 13:23091283-23091305 CTGTGTAAAAAATTTAGGCTGGG - Intergenic
1107243326 13:38264286-38264308 ATATATAAAAAGGTTAACTTTGG + Intergenic
1107683693 13:42875814-42875836 ATATGTCAAAAGGTGAAGCAGGG + Intergenic
1107921269 13:45210803-45210825 ATATGGAAAAATTTTAAGCTGGG + Intronic
1109722371 13:66291719-66291741 CTGTTTAAAAATGTTAAGCTTGG - Intergenic
1110702193 13:78562095-78562117 CAATGTATAATGGTTAATCTAGG - Intergenic
1111332459 13:86777667-86777689 CTAAGTAAAATGATTAAGTTTGG - Intergenic
1111724380 13:91986497-91986519 CTATATGAAAATGTAAAGCTGGG - Intronic
1112215414 13:97425885-97425907 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
1112243514 13:97705976-97705998 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
1113606553 13:111611706-111611728 CTGTTTAAAAAGGTTAAAGTGGG + Intronic
1122181186 14:99956009-99956031 CTCTGTAATAAGGTTAAGAATGG + Intergenic
1125917891 15:43505717-43505739 ATATCTAAAAAGGTTGAGATGGG - Intronic
1125997824 15:44181331-44181353 AAATGTAAAAAGGTTAGGATGGG - Intronic
1129497308 15:75996940-75996962 CTTTGTAAAAAGGATGAGGTAGG + Intronic
1131685527 15:94763495-94763517 CTATATAACAAGGTGCAGCTAGG + Intergenic
1133134872 16:3703718-3703740 CTATTTACAAAAGTTAGGCTGGG + Intronic
1137616078 16:49847820-49847842 CTCTGAAAAATGGTTAAGATGGG + Intronic
1139589213 16:67924118-67924140 CTGTGTACAAGGGTTAGGCTGGG + Intronic
1139993703 16:70960989-70961011 CTATTTAAAAAGAATGAGCTAGG - Intronic
1144358047 17:14464443-14464465 ATATGAAAAAAGGTTTAACTTGG - Intergenic
1146269873 17:31477736-31477758 CTATGTAAAAAAGAGAGGCTCGG - Intronic
1203172848 17_GL000205v2_random:166771-166793 TTATGTAAAAAATTTAACCTAGG - Intergenic
1156377674 18:36529516-36529538 AGATGTAAAAAGGTTAAGGTGGG + Intronic
1156894697 18:42232376-42232398 ATAAGTAAAATTGTTAAGCTTGG + Intergenic
1157025849 18:43841612-43841634 GTACATAAAAAGGTTAGGCTGGG + Intergenic
927161272 2:20264907-20264929 CAATGAAAAAAAGTAAAGCTAGG - Intronic
930273375 2:49282626-49282648 CTGGGTTAAAATGTTAAGCTGGG + Intergenic
931882247 2:66579304-66579326 CTCTGTAAAAAGGAGAAGCAAGG - Intergenic
935566227 2:104610457-104610479 CCATGTAAAAAGGATAATGTGGG + Intergenic
935619210 2:105113946-105113968 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
935822334 2:106906677-106906699 CTATATAAAGAGATTAAGCGTGG - Intergenic
936249506 2:110857022-110857044 CTATCTAAAATAGTTAAGCCAGG - Intronic
936375410 2:111937141-111937163 CTTTATAAAAATGTTAAGTTGGG + Intronic
936591571 2:113809380-113809402 TTATGTCAAAAGGTGAAGCACGG - Intergenic
938363301 2:130711117-130711139 AGATGTAAAAAGGTTAACATAGG + Intergenic
939881280 2:147634136-147634158 CTATGAAAGAAGGCCAAGCTTGG - Intergenic
941644330 2:168024054-168024076 CCTTTTAAAAAGGCTAAGCTAGG + Intronic
943800488 2:192051423-192051445 CTAAGTAAAAAGGTCAGACTTGG - Intronic
945637070 2:212368682-212368704 CTTTGTAAAATGATCAAGCTAGG + Intronic
946991185 2:225331417-225331439 GTATATAAAAAGGTCAAGCGGGG - Intergenic
947042912 2:225944258-225944280 CTATGTAAGACAGATAAGCTTGG + Intergenic
949055141 2:241923687-241923709 CTATGTGCAGAGGTAAAGCTGGG + Intergenic
1169408307 20:5344866-5344888 CTGTGTAAAAGATTTAAGCTTGG - Intergenic
1171449953 20:25228542-25228564 GTATTTAAAAATGTTAAGGTAGG - Intergenic
1174005493 20:47407632-47407654 TTAAGTAAAAAGGTAAGGCTGGG + Intergenic
1174808022 20:53621386-53621408 CTATGTAAAAATATTCAGCCAGG - Intergenic
1176328843 21:5528552-5528574 TTATGTAAAAAATTTAACCTAGG - Intergenic
1176398914 21:6292399-6292421 TTATGTAAAAAATTTAACCTAGG + Intergenic
1176438243 21:6696705-6696727 TTATGTAAAAAATTTAACCTAGG - Intergenic
1176462505 21:7023775-7023797 TTATGTAAAAAATTTAACCTAGG - Intergenic
1176486066 21:7405553-7405575 TTATGTAAAAAATTTAACCTAGG - Intergenic
1178063969 21:28883351-28883373 GTATGGAAAAATGTTAATCTAGG + Intronic
1178733517 21:35128426-35128448 ACATGTGAAAAGATTAAGCTTGG - Intronic
1179259116 21:39742714-39742736 CTCTGTAAAAGGGAAAAGCTGGG - Intergenic
1181678638 22:24475327-24475349 CTATGTAAAAAAGTTGAGGGGGG - Intergenic
950371590 3:12535397-12535419 ATTTGTAAAATGGTTAAACTAGG + Intronic
950719507 3:14872686-14872708 ATATGTCAAAAGATGAAGCTGGG + Intronic
952224447 3:31360741-31360763 CTATGGAAAAAAATTAAGCAGGG + Intergenic
956270981 3:67446246-67446268 CTAAGTAAAAAGGATAATTTAGG + Intronic
956561958 3:70588340-70588362 CCCTGTAAAAATGTTCAGCTTGG + Intergenic
958798244 3:98729388-98729410 GTATGTAAAAACGATTAGCTTGG + Intergenic
958953529 3:100441964-100441986 CTATATAAAAATATAAAGCTAGG - Intronic
959250307 3:103933419-103933441 CTATGTAGAAAGCTGAAACTGGG + Intergenic
962019533 3:131483373-131483395 CTATGTAAAAATGTTCTGCTAGG + Intronic
963508042 3:146212616-146212638 ATATGTAAAAAGTCTAAGCTGGG - Intronic
966046255 3:175553985-175554007 CTATGTAGAAAATTTAAGCAAGG + Intronic
966537993 3:181055481-181055503 CCGTATAAAAAGCTTAAGCTCGG + Intergenic
971619470 4:28836667-28836689 CCATGTAAATACCTTAAGCTAGG - Intergenic
974571800 4:63661290-63661312 CTATGTAAATATGTTAAAATGGG - Intergenic
975779810 4:77826157-77826179 TTATGTGAAAAGGTGCAGCTGGG - Intergenic
977205319 4:94159072-94159094 CTAAGTATACAGGTTAAGCAGGG + Intergenic
977439499 4:97045122-97045144 CTATGTAACTAGGTTAAACCAGG - Intergenic
978630817 4:110742171-110742193 CTATGTTAAATGGTAAAGTTAGG + Intergenic
978941412 4:114440348-114440370 CCATGGAAAAAGGTTGAACTGGG - Intergenic
979000845 4:115216959-115216981 CTATGTAATATGGTTGAGGTAGG + Intergenic
979467800 4:121060474-121060496 TAATGTAAAAAAGGTAAGCTGGG - Intronic
979536451 4:121826310-121826332 CTATGTCAAAATGGTCAGCTTGG - Intronic
982575376 4:157102863-157102885 CTATGTCAAAAGGTGAAGTAGGG + Intronic
984223385 4:177005323-177005345 CTATTAAAAAAAGTTATGCTGGG - Intergenic
984380937 4:178991889-178991911 TTATGTAAAAAGAATATGCTAGG - Intergenic
985239847 4:187918576-187918598 CTATGAAGAAAAGTAAAGCTGGG + Intergenic
989079234 5:37599588-37599610 ATATGTAAAAAGGTGAATTTGGG + Intronic
989229610 5:39071866-39071888 GTATGTAAAAAGATAAAGTTTGG - Intronic
989235812 5:39147427-39147449 ATATGTACAAAAGTTTAGCTGGG - Intronic
993350536 5:86844487-86844509 ATATTTAAAAAGGTTAACATAGG + Intergenic
996119089 5:119651042-119651064 CTCTTTAAAAATGTTAAACTTGG + Intergenic
996998378 5:129726836-129726858 CTATGGAAAAAATTAAAGCTGGG - Intronic
998298419 5:140994245-140994267 CTAGGTAAATAAGGTAAGCTAGG + Intronic
999694900 5:154180082-154180104 CTGTTTAAAAAGGTGAGGCTGGG - Intronic
1000951104 5:167484370-167484392 CTTTATAAAAAGGATAATCTTGG + Intronic
1001377816 5:171279463-171279485 CTTTATAAAAAGGTTGAGTTTGG - Intronic
1002128279 5:177063199-177063221 CTATCTCAGAAGGTTATGCTGGG - Intronic
1003223468 6:4182879-4182901 TTATGGAAAAAGATTAACCTGGG - Intergenic
1003914440 6:10772636-10772658 TTTTTTAAAAAGGTTAGGCTGGG - Intronic
1005591013 6:27327337-27327359 ATATGTCAAAAGGTGAAGCAGGG - Intergenic
1010233776 6:73558133-73558155 CTATTTAAAATATTTAAGCTGGG - Intergenic
1011883659 6:92063380-92063402 CTAGTTAAAAATGTTAGGCTGGG - Intergenic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1017183450 6:151576540-151576562 TGATGTAAATTGGTTAAGCTGGG + Intronic
1020933143 7:14426263-14426285 TTATGTATAAAGGATAAGATTGG + Intronic
1024868112 7:53927093-53927115 TTATGTAAACAAGTTCAGCTTGG + Intergenic
1028576793 7:92361029-92361051 TTATTTACAAAGGTTAGGCTTGG - Intronic
1030266422 7:107626514-107626536 CTAGGTAGAAAGGAGAAGCTAGG - Intronic
1031859442 7:126961169-126961191 CTATGTAAAAAGGTTAAGCTTGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035887270 8:3305517-3305539 CCCTGATAAAAGGTTAAGCTTGG + Intronic
1035984897 8:4417391-4417413 CTATGTAAACATGATAACCTTGG - Intronic
1038926394 8:32144687-32144709 TTATCTAAAAACGTCAAGCTGGG + Intronic
1041148163 8:54901948-54901970 CTATGAAAAAAGATTAAAGTAGG + Intergenic
1041326551 8:56672349-56672371 CCATGTAAAATGGTAAACCTGGG - Intergenic
1041435778 8:57839978-57840000 CTATGAAAAAATGTTTATCTAGG - Intergenic
1043487698 8:80714626-80714648 CAATGTAAATATGTGAAGCTAGG - Intronic
1045334542 8:101187679-101187701 TTAAGTAAAAAAGTTAAGCCTGG + Intronic
1047872675 8:129102541-129102563 TTATGTCAAAAGGTTAAGAAAGG + Intergenic
1047967627 8:130058141-130058163 CTTTGTAAAATGGTTGACCTTGG + Intronic
1048739013 8:137533378-137533400 TTATGAAAAAAGGTAAAGCAGGG + Intergenic
1051463451 9:17350362-17350384 CTATGTAAAATGCTTTAGATGGG + Intronic
1052766184 9:32643814-32643836 GTAGTTAAAAAAGTTAAGCTAGG + Intergenic
1052976842 9:34417347-34417369 CTATGTAAGAATATAAAGCTAGG - Intronic
1056959007 9:91105467-91105489 CTAATTAAAAAGATTAATCTTGG + Intergenic
1060284801 9:122240364-122240386 ATATTTAAAAAGATTAACCTTGG + Exonic
1203433267 Un_GL000195v1:111908-111930 TTATGTAAAAAATTTAACCTAGG + Intergenic
1186879493 X:13850861-13850883 CTTTGAAAAAAAGTTAATCTAGG + Intronic
1187454693 X:19430917-19430939 CTATGGGGAAAGGTTAAGCAGGG - Intronic
1188130701 X:26428081-26428103 CTATGTTAGAATGTTAAGTTAGG - Intergenic
1192806009 X:74509860-74509882 ATATCTAAAAAGGATAGGCTGGG - Intronic
1193469804 X:81886898-81886920 CTATGTAAGAAGGAAAATCTGGG + Intergenic
1193602256 X:83521737-83521759 TTATTTATAAAGGTTAAGCTGGG - Intergenic
1194667923 X:96696084-96696106 TTATTTAAAAAGGTTGGGCTGGG + Intronic
1195035803 X:100971097-100971119 CTAAGTAAAAAGGATAATTTAGG - Intronic
1196110394 X:111940953-111940975 ATATGTCAAAAGGTGAAGCGGGG - Intronic
1196116584 X:112005716-112005738 CCATGCAAAAAGCTTAAGCTGGG + Intronic
1198913574 X:141640092-141640114 CTAAAGAAAAAAGTTAAGCTGGG + Intronic
1199430589 X:147755169-147755191 CTATGGAGAAAGGTTTTGCTTGG - Intergenic
1200883342 Y:8243479-8243501 CTCTGTAGAAAGGTGAAACTGGG + Intergenic