ID: 1031865481

View in Genome Browser
Species Human (GRCh38)
Location 7:127034535-127034557
Sequence CTGGATATGAAGAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 656
Summary {0: 1, 1: 1, 2: 2, 3: 56, 4: 596}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031865481 Original CRISPR CTGGATATGAAGAGGGAAAA GGG (reversed) Intronic
900898570 1:5501639-5501661 CTGGATATTAACAGGGGAGAAGG - Intergenic
901461610 1:9395250-9395272 CTGGCTTTGAAGAGGGAGGATGG - Intergenic
901718822 1:11178629-11178651 CTGGATGTGAAGAAGCAGAAAGG - Intronic
902389713 1:16095970-16095992 TTGGAGGGGAAGAGGGAAAAGGG + Intergenic
902782528 1:18713774-18713796 CTGGATTTGCACAGGGATAAAGG + Intronic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
903934523 1:26885973-26885995 CTGGATGTTGAGAGGGATAAAGG + Exonic
904416931 1:30368728-30368750 TGGGATGTGAAGAGGGAGAAGGG - Intergenic
905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG + Intergenic
905384858 1:37595608-37595630 TTGGGGATGAAAAGGGAAAAAGG - Intronic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905766652 1:40607323-40607345 CTGGACATGAAGTAGGAAGAGGG - Intergenic
906091566 1:43183993-43184015 CTAGAGAGGAAGAGGGAAAATGG - Intronic
907366627 1:53966201-53966223 GTGTTTATGGAGAGGGAAAAAGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
908189859 1:61691084-61691106 GAGGATATGTGGAGGGAAAATGG - Intronic
908440089 1:64144582-64144604 CTGGATATGAAGATTGAATGAGG - Intronic
909500405 1:76328908-76328930 CTGGAGATGATGAGGGCAATTGG - Intronic
909540962 1:76791002-76791024 GTGGATTTGAAGAGGCAAGAGGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
910205272 1:84743286-84743308 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
910541943 1:88369536-88369558 CGGGATAAGAAGGGGGAAATGGG - Intergenic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
911839862 1:102667591-102667613 CTGAATATCAGGAGGGAAATAGG - Intergenic
911978188 1:104529961-104529983 CTGGCTTTGAAGACGAAAAAAGG - Intergenic
912170340 1:107092105-107092127 CTGGTTGTAAAGACGGAAAAGGG + Intergenic
912465638 1:109871579-109871601 CTGGTTTTGAAGACGGAGAAAGG + Intergenic
912938348 1:114023393-114023415 CTGGAAAGGAAAAGGGAAGATGG - Intergenic
913387639 1:118277238-118277260 CTGGATTTGAAGATGGAGGATGG - Intergenic
913647199 1:120869515-120869537 ATGGATATGAAGGGAAAAAAAGG + Intergenic
914079443 1:144393347-144393369 ATGGATATGAAGGGAAAAAAAGG - Intergenic
914099736 1:144573155-144573177 ATGGATATGAAGGGAAAAAAAGG + Intergenic
914174342 1:145261893-145261915 ATGGATATGAAGGGAAAAAAAGG - Intergenic
914299253 1:146364526-146364548 ATGGATATGAAGGGAAAAAAAGG - Intergenic
914637382 1:149564031-149564053 ATGGATATGAAGGGAAAAAAAGG + Intergenic
916073467 1:161186059-161186081 CTGGAGATGAAAAGAGGAAATGG - Exonic
916086591 1:161274807-161274829 CTGGCTAGAAAGAGGGAAGAGGG + Intronic
916807949 1:168278560-168278582 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
918134240 1:181657266-181657288 CTGAATATGAGGAGGGGAAAGGG + Intronic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919532056 1:198734403-198734425 CTCGATGTGAAGAAGGAAACAGG + Exonic
919588882 1:199474274-199474296 ATGGTTTTGAAGATGGAAAAAGG - Intergenic
919662108 1:200257388-200257410 CTGGCTTTGAAGATGGAGAACGG + Intergenic
919834569 1:201564864-201564886 CTGACTTTGAAGATGGAAAAAGG - Intergenic
921931347 1:220756820-220756842 CTGGATGGAAAGAGGGAAAGAGG + Intronic
923488025 1:234455018-234455040 CTGGTTTTGAAGATGGAGAAAGG + Intronic
923850094 1:237784856-237784878 CTGGATCTGAAGAGAGAAGGAGG + Exonic
924743517 1:246812145-246812167 CTGGAGATCAAGAGTGACAATGG + Intergenic
1064698726 10:17995451-17995473 CTAAATATGAAGAGTGCAAAAGG + Intronic
1065645469 10:27829427-27829449 CTTGATATCAACAGGGTAAATGG - Intronic
1065783359 10:29190871-29190893 TTGGAAAGGAAGAGGTAAAATGG - Intergenic
1066028556 10:31392266-31392288 CAGAATTTGAAGAGAGAAAAAGG - Intronic
1066703664 10:38156386-38156408 CTAGATATGAAGAAAAAAAAGGG + Intergenic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068245763 10:54364999-54365021 CTGGATAAGATGAGGCATAAGGG - Intronic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1069671847 10:70212689-70212711 CTGGAGAGGAGGAGGGAATAGGG + Intronic
1070612554 10:77943572-77943594 CAGGGAAGGAAGAGGGAAAAAGG + Intergenic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1071614874 10:87066246-87066268 GGGGATATGAAGAGGGAAGCAGG - Intronic
1071755460 10:88533745-88533767 CTGAACATGAAGAGAGAAACAGG + Intronic
1072000863 10:91194387-91194409 CTGGATTTGAAGATGGAGGAAGG + Intronic
1072959733 10:99918484-99918506 CTGGATATGAAAAGGGGAAAGGG - Intronic
1074423840 10:113333455-113333477 CTGGCTTTGAAGACAGAAAAAGG + Intergenic
1075079735 10:119375332-119375354 CAGGTGAAGAAGAGGGAAAAAGG - Intronic
1075142219 10:119849134-119849156 CTGGCTATGAATATGGAAGAAGG + Intronic
1075196694 10:120365618-120365640 TTGGACATAAAGAGGGAAAATGG - Intergenic
1075429305 10:122366993-122367015 CTGGATATGGGGAAGGAAGACGG + Intergenic
1075548567 10:123375142-123375164 ATAAATATCAAGAGGGAAAAGGG - Intergenic
1075607225 10:123820746-123820768 CTGGCTTTGAAGATGGATAAAGG - Intronic
1077906955 11:6542010-6542032 CTGGATATAAAGAGGTGATAAGG - Intronic
1078040344 11:7855806-7855828 CTGGGTAGGAGGAGAGAAAAGGG + Intergenic
1078540644 11:12210547-12210569 GTGGGTATGGAAAGGGAAAAGGG - Intronic
1078811280 11:14767767-14767789 CAGAATATTTAGAGGGAAAAAGG - Intronic
1079192149 11:18287971-18287993 GTGTATATGGAGATGGAAAAAGG - Exonic
1079222773 11:18578280-18578302 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1079252488 11:18796993-18797015 ATGGAAGTGAATAGGGAAAAAGG - Intergenic
1079402108 11:20114158-20114180 CTGGATGTGGAGTTGGAAAAAGG - Intronic
1079487971 11:20955366-20955388 CTGGTTATGAAAAGTGAAAGAGG - Intronic
1079590728 11:22179355-22179377 CAGGAGAGGAAGAGGGGAAAGGG - Intergenic
1079776794 11:24541515-24541537 CTGAAAATGAAGATGGTAAAAGG - Intronic
1080151052 11:29052371-29052393 CCTCATATGAAGAGGAAAAATGG + Intergenic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1083514124 11:63240743-63240765 CAAGATGTGAAGATGGAAAATGG - Intronic
1085074346 11:73576601-73576623 CTGGAAATGAAGACGGAAATGGG + Intronic
1085764079 11:79267344-79267366 TTGGATTTGAACAGGGTAAATGG - Intronic
1086158712 11:83696509-83696531 CTTGATATGAAAAAGCAAAATGG + Intronic
1086251421 11:84819600-84819622 CTGGATTTGAAGAGTGAATCTGG - Intronic
1086559705 11:88153909-88153931 CTTTATATCAAGAAGGAAAATGG + Intronic
1086581476 11:88404562-88404584 CTGGATAGAAAGAAGTAAAAAGG + Intergenic
1086581601 11:88406103-88406125 CTGGATAGAAAGAAGTAAAAAGG + Intergenic
1086880869 11:92152042-92152064 CTGGCTATGAAGAAGGAAGGAGG - Intergenic
1087195713 11:95302533-95302555 ATGGATTTGGAGAGGGAAATTGG + Intergenic
1087306867 11:96499361-96499383 CTGGAGAAGAAGAGAGAACAAGG - Intronic
1087384973 11:97459657-97459679 TTGGATATAAAGAGTGAAAGAGG - Intergenic
1088090125 11:106028121-106028143 CTGGAGATAAAAAGGTAAAAAGG - Intergenic
1088266976 11:107997241-107997263 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1088834271 11:113564540-113564562 CTGCATGTGAAGAGGGACACTGG + Intergenic
1089168561 11:116496931-116496953 CTGAATTTGAAGACAGAAAAAGG + Intergenic
1089714864 11:120349210-120349232 CTGGATGTGAACAGTAAAAAAGG + Intronic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090475356 11:127015239-127015261 CTGGATAGGAAGATGGAAAGAGG - Intergenic
1090623081 11:128579143-128579165 CTGGGTATGAAGATGGCACATGG + Intronic
1090767856 11:129892628-129892650 CTGGAAATGTAGAGTGGAAAAGG + Intronic
1090886452 11:130881056-130881078 CTGTCTATGAACAAGGAAAAGGG + Intronic
1091011516 11:132005638-132005660 TAGGATATGAAAATGGAAAAGGG - Intronic
1091047376 11:132336731-132336753 CTGGATGTGATGAGGGAAAGGGG + Intronic
1091115616 11:133010011-133010033 CTGGATATGAAAAGGGACTAGGG - Intronic
1092000895 12:5031276-5031298 CAGGATGAGAAGAGGGGAAAAGG + Intergenic
1092157673 12:6294988-6295010 CTAGTTATGCAGAGGGAACAGGG + Intergenic
1093516335 12:19990874-19990896 CTGGTTTTGAAGATGGAGAAAGG + Intergenic
1094316798 12:29144888-29144910 GGGGATATGAAGATGGAAGAAGG - Intergenic
1095136808 12:38614983-38615005 CTGGTTTTGATGATGGAAAAGGG - Intergenic
1095975772 12:47940152-47940174 GTGGATGTGAAGAATGAAAATGG + Intronic
1096360944 12:50986116-50986138 CTGGAAATTAACAGGGGAAAAGG - Exonic
1096613856 12:52820524-52820546 GTGGAGATGAAGAGGAAAGAAGG + Intergenic
1096889993 12:54760171-54760193 CTGGAGATAAAGAGGGAAAGTGG - Intergenic
1097137790 12:56873532-56873554 CAGCATATGAAGAGTGAATAAGG - Intergenic
1097583944 12:61492729-61492751 CTGGCTTTGAAGATGGAACAAGG + Intergenic
1097596438 12:61638202-61638224 CTGGATTTGAAGATGGAGGAAGG + Intergenic
1097669335 12:62517230-62517252 GTGGATATGAAAAGGAAAAGGGG - Intronic
1098464959 12:70776109-70776131 GTGGATAGGAAGAAGGAGAAAGG - Intronic
1098576764 12:72051537-72051559 CTTGCTTTGAAGATGGAAAAAGG - Intronic
1098706279 12:73694157-73694179 TTGGATATTTAGAGGAAAAATGG + Intergenic
1098870103 12:75807883-75807905 CTTGAAATCAAGAGGGAATATGG + Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099442134 12:82712003-82712025 CAGGAAAGGAGGAGGGAAAAGGG - Intronic
1101699011 12:107154143-107154165 CTGGGTATCTAGAGGGGAAAGGG - Intergenic
1101797489 12:107988870-107988892 CTGGTTAACATGAGGGAAAATGG + Intergenic
1103137902 12:118523558-118523580 CTAGATTTGAAGATGGAGAAAGG + Intergenic
1104482634 12:129121562-129121584 CTGGATTTGAAGATGGAGAATGG + Intronic
1105538356 13:21291377-21291399 CAGGCTATGAAGATGGGAAAAGG + Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1106942551 13:34794194-34794216 CTAGATATCAGAAGGGAAAAAGG - Intergenic
1106981668 13:35291454-35291476 CTGGCTATAAAGAGGAAAATGGG - Intronic
1107153181 13:37135836-37135858 TTGAATATGATGAGAGAAAAGGG + Intergenic
1107719597 13:43234020-43234042 CTGGATCAGAATAGAGAAAAAGG - Intronic
1107838959 13:44436096-44436118 CTGAAAAAGAGGAGGGAAAAAGG + Intronic
1108293789 13:48991018-48991040 AAGCAGATGAAGAGGGAAAAGGG + Intronic
1108300176 13:49065719-49065741 CTGGATTTGAAAAGGAATAAGGG + Intronic
1108792112 13:53982875-53982897 AAGGGTATGAAGAGGGCAAAGGG + Intergenic
1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG + Intergenic
1109347512 13:61133309-61133331 CTTGAAATGAAAAAGGAAAATGG + Intergenic
1109796459 13:67320107-67320129 CTGCAAATCAAGAGGGAAAATGG - Intergenic
1110263625 13:73513884-73513906 CAGGATATGAATAGGAAAAATGG - Intergenic
1110403389 13:75120596-75120618 AAGGAAATGAAGAAGGAAAAAGG + Intergenic
1110631721 13:77715535-77715557 CTGGTTATGAAAATGAAAAATGG - Intronic
1111033068 13:82632776-82632798 ATGAATAAGAAAAGGGAAAAAGG - Intergenic
1111050741 13:82881080-82881102 CTTGATATTAAAAGGTAAAAGGG + Intergenic
1111186152 13:84738435-84738457 CTGGATATGATGGAGGAAGATGG + Intergenic
1111509783 13:89245959-89245981 CAGGAAATGAAGGGAGAAAAAGG + Intergenic
1111940990 13:94606593-94606615 CTGAATAATAAGAGGAAAAAGGG - Intronic
1112098554 13:96162343-96162365 CTAGATATCAAGTGTGAAAATGG + Intronic
1112105328 13:96233721-96233743 CTTGATAGGAAGAGGGAATGTGG + Intronic
1112382984 13:98910812-98910834 CAGGGTATGAAGAGGTAAAGAGG - Intronic
1112390611 13:98980546-98980568 ATGGAAGTGAAGAGGTAAAAAGG + Intronic
1112620335 13:101048026-101048048 CTAGATATTAAAAGGGAAAGAGG - Intergenic
1113259821 13:108549286-108549308 CTGGTTTTGAAGGGGAAAAAGGG + Intergenic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113873828 13:113582321-113582343 GTGGCTATGGAGAGGAAAAAGGG + Intergenic
1114285618 14:21239865-21239887 CTGGGTCTCAAGAGAGAAAAAGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114951983 14:27766120-27766142 CTGCCTTTGAAGACGGAAAAGGG + Intergenic
1115162565 14:30412330-30412352 CTGGCTGTGAAGATGGAAGAAGG - Intergenic
1115352297 14:32408227-32408249 CTGGAAATGAACAGGGAAGGAGG + Intronic
1116975231 14:51108575-51108597 CAGGATCTAAAGAGGGAAAAGGG + Intergenic
1117363547 14:55002229-55002251 TTGAATTTGAAGAAGGAAAAAGG + Intronic
1117728542 14:58697518-58697540 CGGTATTTGAACAGGGAAAATGG + Intergenic
1117835272 14:59798530-59798552 CTGGCTTTGAAGATGGAGAATGG - Intronic
1120208609 14:81612476-81612498 ATGCAGATTAAGAGGGAAAATGG + Intergenic
1120587082 14:86325586-86325608 CTGCATATGTAGAGAGAAATAGG + Intergenic
1121060742 14:90907073-90907095 CTGGATGTTAAGAGGGAGAAAGG - Intronic
1121593837 14:95143365-95143387 CTGGAAAAGAAAAGGGGAAAGGG - Intronic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122254883 14:100469246-100469268 CAGGAGACGCAGAGGGAAAATGG + Intronic
1122680702 14:103459933-103459955 CTGGTGATGAATATGGAAAAGGG - Intronic
1124145653 15:27123034-27123056 ATGGAAAGGGAGAGGGAAAAAGG - Intronic
1124395989 15:29302123-29302145 ATGAAGATGAAGAGTGAAAATGG - Intronic
1125257989 15:37788666-37788688 CTGGATATGAATCGGTTAAAAGG + Intergenic
1126200715 15:45982741-45982763 CTGGATGGGAAAAGGAAAAATGG - Intergenic
1126243671 15:46476047-46476069 GTGGATATGAAGTGGTGAAAGGG - Intergenic
1126449449 15:48789720-48789742 CTGGCTTTGAAGATGGAAATGGG + Intronic
1126773775 15:52082377-52082399 CTGGATATGCAGCGGCAGAAAGG - Intergenic
1126921385 15:53529482-53529504 CAGGATACTAAGAGGGTAAATGG + Intronic
1127120304 15:55766164-55766186 CTGGCCTTGAAGATGGAAAAAGG - Intergenic
1127341090 15:58044824-58044846 TTGGATGAGCAGAGGGAAAAGGG + Intronic
1127549554 15:60023384-60023406 CTGGATGGGGAGAGGGAACAGGG + Intronic
1128576924 15:68782735-68782757 CTGGATTAGAAGAGGGGAAGAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130402758 15:83572886-83572908 CTGGAGATGAAGCAGGATAATGG + Intronic
1130620849 15:85460757-85460779 CTGGCTCTGAAGATGGAGAAAGG + Intronic
1130712094 15:86293416-86293438 CTGGCTTTGAAGATGGAGAAAGG - Intronic
1130747496 15:86671602-86671624 CTGGATATAAACTGGGAAACAGG - Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1131640726 15:94289983-94290005 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133677287 16:8086467-8086489 CTGGTTATGAAAACGGAAATTGG - Intergenic
1134404690 16:13946102-13946124 CTGGCTATGAAGATGGAGGAAGG - Intronic
1134872775 16:17666824-17666846 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1135556455 16:23440985-23441007 ATATATATGGAGAGGGAAAAAGG + Intronic
1135716185 16:24770252-24770274 CAGGATATGAATCTGGAAAAAGG + Intronic
1137387483 16:48055145-48055167 CTGTTTACGAAGAGGGAAAACGG - Intergenic
1138460426 16:57144430-57144452 CTGGATATGAAGGTGGCTAAGGG + Intronic
1138649906 16:58453994-58454016 CTGGATTTGAAGATAGAGAAAGG - Intergenic
1139151202 16:64383574-64383596 AGGGATATTAAGAGGTAAAATGG + Intergenic
1139459641 16:67111282-67111304 CTGGAAATGGAGAGGGTGAAGGG - Intronic
1139478630 16:67215993-67216015 GTGGACATGAACAGGGGAAAGGG - Intronic
1140030057 16:71328546-71328568 CTGGTCATAAAGGGGGAAAAGGG - Intergenic
1140127208 16:72128012-72128034 CTGCTTATGATGAGGGAGAAAGG + Intronic
1140335764 16:74103625-74103647 CTGGCTCTGAAGATGGAGAAAGG + Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1140806477 16:78536705-78536727 ATGACTATGAAAAGGGAAAATGG + Intronic
1140940922 16:79721205-79721227 GTAGAAATGAAGAAGGAAAAAGG + Intergenic
1141055152 16:80806922-80806944 GTGGAAATGAAGAAGAAAAATGG + Intergenic
1141205047 16:81927059-81927081 CTGGATAAGAAGAGAGGACATGG - Intronic
1141462882 16:84188289-84188311 CTGGCTTTGAAGATGGAAAGGGG - Intergenic
1141471933 16:84244671-84244693 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1141804237 16:86332249-86332271 ATGGACAGGAGGAGGGAAAAGGG - Intergenic
1143525379 17:7468858-7468880 CTGGATGGGAAGAAGGAAGATGG + Intronic
1144039191 17:11393335-11393357 CTGGCTAAGAAGGGGGCAAATGG - Intronic
1144260504 17:13515029-13515051 ATGGAAATGAAGAGGGAAAGGGG + Intronic
1144701654 17:17344517-17344539 CTGGGTGTGAAGAGGGGACAGGG + Intronic
1144942997 17:18954251-18954273 CAAGATCTGAAGAGGGAAAGAGG + Intronic
1144962493 17:19053014-19053036 CTGGATATGGTCAGGGAAAGAGG + Intergenic
1144972668 17:19121506-19121528 CTGGATATGGTCAGGGAAAGAGG - Intergenic
1146537531 17:33666104-33666126 CTGGTTATGTGGGGGGAAAATGG - Intronic
1146665428 17:34699500-34699522 CTGGAGAGGCAGAGGGAGAAAGG - Intergenic
1147297344 17:39494673-39494695 CTGGATTTCAAGAAGGACAAAGG + Exonic
1148520004 17:48264617-48264639 CAGGAAATGGGGAGGGAAAAGGG + Intronic
1148560967 17:48605844-48605866 TTGGATAGAAAGAGGGAAGAGGG - Intergenic
1148883307 17:50749843-50749865 CTGCAAATGAAGAATGAAAAAGG - Intronic
1148966828 17:51442793-51442815 CTAGAAATGCAGAGGGAAACGGG - Intergenic
1149123694 17:53201781-53201803 CATAATATGTAGAGGGAAAATGG + Intergenic
1149930329 17:60746966-60746988 CTTGATATGAACAGAAAAAAAGG - Intronic
1149991091 17:61384037-61384059 CCGGCTATGAAGAGGGGACAGGG - Intronic
1150045652 17:61910615-61910637 CTGGAAACGAAGAGTGATAATGG + Intronic
1150988729 17:70230265-70230287 CTGGATACGAACAGAGAAGAGGG + Intergenic
1151998753 17:77631376-77631398 CTTTATATTAAGAGGGAAAAAGG + Intergenic
1152174628 17:78779682-78779704 CTGGCTTTGAAGATGGAAAGGGG + Intronic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1155516921 18:26632836-26632858 TTGGATATGAAAATGGAATATGG + Intronic
1155745260 18:29348601-29348623 CTGGCTTTGAAGATGGAAAAAGG - Intergenic
1155905492 18:31446115-31446137 CTGGAAATGAAGAGTGGTAATGG + Intergenic
1155932042 18:31718639-31718661 CTGGCCATGAAGAGCCAAAAGGG + Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156261802 18:35451457-35451479 AAGGATAAGGAGAGGGAAAAGGG + Intronic
1156624655 18:38893713-38893735 CTGGATATGAGAGGTGAAAAGGG + Intergenic
1157015416 18:43706608-43706630 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1157185367 18:45536081-45536103 CTGGACAATAAGAAGGAAAAAGG - Intronic
1157620819 18:49016678-49016700 CGGGGTCTGAGGAGGGAAAAGGG + Intergenic
1157919198 18:51698138-51698160 GAGGATTTGAAGGGGGAAAAGGG - Intergenic
1157932137 18:51834761-51834783 CCCTATATGAAGAGGGCAAAAGG - Intergenic
1158234490 18:55298319-55298341 CTGGTTTTGAAATGGGAAAATGG - Intronic
1158379675 18:56915516-56915538 CTGGATCTGAATAGTGAAGAAGG - Intronic
1158968257 18:62642614-62642636 TTGGCTTTGAAGATGGAAAAAGG + Intergenic
1159129953 18:64270127-64270149 TTTGATCTGAAGAGGGAAACAGG + Intergenic
1159409254 18:68049832-68049854 CAGGCTATGAAAAGTGAAAATGG - Intergenic
1159571841 18:70123477-70123499 GTGGATATGGGTAGGGAAAAGGG - Intronic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160553495 18:79711382-79711404 CTGGATACTCAGAGGCAAAAGGG - Intronic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1162914402 19:13866166-13866188 CTGGCCATAAAAAGGGAAAATGG + Intronic
1163446224 19:17347964-17347986 CAGGATAGGAGGAGGCAAAAGGG + Intergenic
1164639652 19:29814650-29814672 CTGTATGTGAGCAGGGAAAAAGG - Intronic
1166264637 19:41671506-41671528 CTGGAGATGAAGATGGTTAAGGG + Intronic
1167123336 19:47532071-47532093 CTGGAAATGGAGGGGGAAGAAGG + Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926445723 2:12940075-12940097 CTAGATATGGAGATGTAAAATGG + Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
926664517 2:15505891-15505913 CTGGACAAGAAGAGTGAAAAAGG + Intronic
927043451 2:19253444-19253466 CTGGATGTGAAGAAAGGAAAAGG - Intergenic
927440236 2:23110584-23110606 ATGGATAGGAAGAATGAAAATGG - Intergenic
927935651 2:27074682-27074704 CTGAATATTGGGAGGGAAAAAGG - Intergenic
928354825 2:30602003-30602025 CTAGATATGATGAGGGGAAGAGG + Intronic
928870137 2:35966199-35966221 GTGGATATAAACATGGAAAAGGG - Intergenic
928879106 2:36076994-36077016 CAGGATTTGAGAAGGGAAAATGG + Intergenic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
931945831 2:67306233-67306255 CTGGAGATGATTAGGTAAAAAGG - Intergenic
932006528 2:67933165-67933187 CTGGCCATGTAGAGTGAAAAGGG + Intergenic
932495978 2:72146016-72146038 CTGGAGGTGAGGAGGGAAATAGG - Intronic
933069152 2:77835986-77836008 ATGGATACTAAGAGGAAAAATGG + Intergenic
934945103 2:98535051-98535073 CTGGATCTCCAGAGAGAAAAAGG + Intronic
935072039 2:99703243-99703265 CTGGCTTTGAAGATGGAAAAAGG - Intronic
935082389 2:99810870-99810892 CTGGCTTTGAAGATGGAAAAAGG - Intronic
936775992 2:115974167-115974189 CTGGATATCAAGGGGAAAATAGG - Intergenic
937342025 2:121097185-121097207 CTGGATTTGAAGATGGAGGAAGG + Intergenic
938323249 2:130379882-130379904 GTGGATGTGAAGAAGGATAAGGG + Intergenic
938365980 2:130734665-130734687 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
938615583 2:132994498-132994520 TTGGAAATGAAGAGGGATATTGG - Intronic
939057247 2:137380574-137380596 CTGGCTTTGAAGAGGGAGGAAGG + Intronic
939706938 2:145466670-145466692 ATAGAAATGAAGAGTGAAAAAGG + Intergenic
940159010 2:150691904-150691926 TTGGGCATGGAGAGGGAAAAGGG + Intergenic
940732679 2:157412002-157412024 CTGGTAATGAAGAGGAAAAAGGG - Intergenic
941115694 2:161469744-161469766 CTGAATAGAAGGAGGGAAAATGG + Intronic
941158362 2:162005948-162005970 GTGGTTATGAAGAAGGAAAAGGG + Intronic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941798694 2:169630417-169630439 CTTGATAATAAGAGGGAAAGTGG + Intronic
941877435 2:170448402-170448424 TGGGCTATGAAGATGGAAAAAGG + Intronic
942634423 2:177987232-177987254 AAGGGGATGAAGAGGGAAAAGGG + Intronic
942856042 2:180549837-180549859 CTGGCTTTGAAGAAGGAAGATGG - Intergenic
943068959 2:183119046-183119068 ATGCATATTAAGAGGCAAAATGG - Intronic
944177083 2:196842656-196842678 TTAGATATAAAGGGGGAAAAAGG + Intronic
944433920 2:199666478-199666500 TTGGATGTCAAGAGAGAAAAAGG - Intergenic
944565732 2:200989155-200989177 CTAGATTTGAATAGGGAAAAAGG + Intronic
944587228 2:201183057-201183079 CTGGAAAAGGGGAGGGAAAAAGG + Exonic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
944884079 2:204044706-204044728 ATGGAGAGGATGAGGGAAAAAGG + Intergenic
945381860 2:209149950-209149972 TTGGATAAGGAGAGGGAAAGTGG - Intergenic
945780842 2:214169848-214169870 CTGGGGATAAAAAGGGAAAACGG + Intronic
946324487 2:218977792-218977814 CAGGAAGTGAAGAGGAAAAATGG - Intergenic
946469506 2:219945330-219945352 CTGGATATGCTGAAGAAAAATGG + Intergenic
947025540 2:225733808-225733830 CTTGATATGAAAAAGGAAAAGGG + Intergenic
947282386 2:228469769-228469791 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
947337438 2:229102051-229102073 CTGGCTTTGAAGATGGAGAATGG + Intronic
947538069 2:230953421-230953443 CTGGGTTTGAAGACGGAAGAAGG + Intronic
947665441 2:231902607-231902629 CTGGTTTTGAAGACGGAAGAAGG - Intergenic
948212642 2:236206395-236206417 CAGGATATGAACAAGGAAACGGG + Intronic
948373245 2:237504002-237504024 CTGGTTTTGAAGATGGAGAAAGG + Intronic
1168747213 20:253839-253861 CTGGAAAGGAAGGGGAAAAAGGG + Intergenic
1169489123 20:6056375-6056397 CTGGGTATGACCAGGGAAACAGG - Intergenic
1171202775 20:23255287-23255309 CAGCGTATGAAGAGGGAAAGTGG + Intergenic
1172375738 20:34438451-34438473 CTGGGTAAGAAGAGGGGAAAAGG - Intronic
1172506042 20:35463467-35463489 CTTGCTATGAACAGGGGAAATGG - Intronic
1172610457 20:36247483-36247505 CTGGAGTTGATGGGGGAAAACGG - Intronic
1173441188 20:43077692-43077714 GGGTATATGCAGAGGGAAAAAGG + Intronic
1173555062 20:43960235-43960257 CTGGATCTGAGGAGGGACTAGGG - Intronic
1173887422 20:46472637-46472659 CTGAAAAAGAAGAGGGATAAAGG + Intergenic
1174043549 20:47717025-47717047 ATGGGTATGCAGATGGAAAAGGG + Intronic
1174940765 20:54924034-54924056 AAGGGTATGAAGAGGGAAAAGGG + Intergenic
1175855437 20:62118489-62118511 ATGGATGGGAAGAGGGAAGAGGG + Intergenic
1176968925 21:15243619-15243641 CTGAATTTGAAGTGGGAAGAAGG + Intergenic
1177859492 21:26436271-26436293 AGGGATATGAAGAGGAACAAAGG + Intergenic
1178948159 21:36965641-36965663 CAGAAGATGGAGAGGGAAAAGGG + Intronic
1179113526 21:38468338-38468360 CTGAATATAGAGAGGGAAATTGG + Intronic
1179374689 21:40839898-40839920 CAAGATATGAAGAAGGAAAGAGG - Intronic
1179769918 21:43606794-43606816 CTGGATGTGAAGAGAGCAACTGG + Intronic
1179964844 21:44796869-44796891 CTGGCTGTGAAGATGGAAGAAGG - Intronic
1182000984 22:26919619-26919641 CTGGCTTTGAAGATGGAGAAGGG + Intergenic
1182947597 22:34339070-34339092 CTGGAAATGACGAGGGGAATGGG - Intergenic
1184374611 22:44103762-44103784 CTGGCTCTGAAGATGGAAGAAGG + Intronic
949135149 3:555336-555358 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
949147630 3:721865-721887 CTGGTTTTGAAGATGGAAGAAGG + Intergenic
949695791 3:6693681-6693703 CTGCAAATGAAGAGTGAATAAGG - Intergenic
950306620 3:11919716-11919738 CAAGATGTGAAGTGGGAAAAAGG + Intergenic
950938153 3:16864355-16864377 CTGGAAACGAAAAGGGAAAATGG - Intronic
951336918 3:21434616-21434638 CTGGATCTGAAGATCAAAAATGG + Intronic
951380223 3:21974924-21974946 CTGGCAAGGAAGAGGAAAAACGG + Intronic
951737290 3:25882024-25882046 CTGGCTTTCAAGATGGAAAAGGG - Intergenic
951806492 3:26649928-26649950 CTGGATAAGTAGAGGGAAAGAGG - Intronic
952162483 3:30707766-30707788 CTGGATATCTAGAAGGATAATGG + Intergenic
952553172 3:34501951-34501973 CTGGCTATGAAGAAGAAAAGGGG + Intergenic
952721711 3:36540585-36540607 ATGGATGTGAAGATGGAGAAAGG + Intronic
952828992 3:37547440-37547462 TTGGATATGAAAATGGAAACAGG - Intronic
952981645 3:38740952-38740974 GTTGATATGAAAAGGAAAAATGG - Intronic
953294250 3:41696893-41696915 CTGGCTTTGAAGATGGAATAAGG + Intronic
953728956 3:45428606-45428628 CTGGAGATGAAGAGTGATAATGG - Intronic
954561969 3:51564486-51564508 CTGGATAGGAGGAGGTATAAGGG + Intronic
954865185 3:53722940-53722962 CTGGAGAGGTAGAGGGAAACGGG - Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
955838882 3:63090048-63090070 CTGCATATGAAGAGAGATAAAGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957189638 3:76990784-76990806 ATGCATATCAAGAGGCAAAACGG + Intronic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958151230 3:89697092-89697114 ATGCATATTAAGAGGCAAAATGG + Intergenic
958446303 3:94219174-94219196 CTGGAAATGAAGGAGGCAAAAGG + Intergenic
958558431 3:95709741-95709763 GTGGAGATGAAGAGGGAAATGGG + Intergenic
958561343 3:95751350-95751372 CTGGATATTGAGAAGGAAACAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959585793 3:108023953-108023975 CTGGCTCTGAAGATGGAAGAAGG + Intergenic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
960025666 3:113006420-113006442 CAGGAAATGAACAAGGAAAAAGG + Intronic
960556827 3:119039361-119039383 CTGGATTTGAAGATAGAAGAAGG - Intronic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
961027159 3:123568422-123568444 CTGGTTATCAAGAGGGATAACGG - Intronic
961705863 3:128784691-128784713 CTGGATATGAAGGGGGAAAAGGG - Intronic
962064172 3:131961868-131961890 CTGGATCTGAGTAGGGAAAAGGG - Intronic
962658086 3:137569855-137569877 TTGAATATTAAGGGGGAAAATGG + Intergenic
963057912 3:141202280-141202302 CTGGGTATGAAGAGATATAAGGG + Intergenic
963372533 3:144419484-144419506 CTGGCTTTGAAGATGGAGAATGG - Intergenic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
963784689 3:149522634-149522656 CTGGAGATGAAGAGAAAAAAAGG - Intronic
963853167 3:150227624-150227646 CTAGGTAAGAAGAGGGAAAGTGG + Intergenic
964509171 3:157431392-157431414 CTGGCTGTGAAGATGGAGAAAGG - Intronic
964595267 3:158420031-158420053 CTGCCTATGAGGAGGGTAAAAGG - Intronic
964654912 3:159055599-159055621 CTGGCTTTGAAGATGGAGAAGGG - Intronic
964702015 3:159578686-159578708 CTGACTTTGAAGATGGAAAAAGG - Intronic
964873738 3:161342287-161342309 CTGGCTCCAAAGAGGGAAAAAGG - Intergenic
964920771 3:161892748-161892770 GTGGATATGGAGAGGAGAAAAGG - Intergenic
965636580 3:170788243-170788265 CTGGCTTTGAAGATGGAGAAAGG + Intronic
967117726 3:186356889-186356911 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967118034 3:186359969-186359991 CTGGAAGAGAAGGGGGAAAAGGG - Intronic
967180703 3:186901189-186901211 CTTGATATTTAGAGGGAAATGGG - Intergenic
967200613 3:187069443-187069465 CTGCATAAGAACAGAGAAAAAGG - Intronic
967258137 3:187614019-187614041 CTGGATGTGAGGATGGTAAAAGG - Intergenic
967331009 3:188289742-188289764 CTGGATGTTTAGAGAGAAAATGG + Intronic
967433733 3:189419882-189419904 CTGAAGATGAAGGGGGAAAAGGG + Intergenic
967751381 3:193119911-193119933 ATGCACATTAAGAGGGAAAATGG + Intergenic
968278588 3:197458964-197458986 ATAGAAATGAAGATGGAAAAGGG - Intergenic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969304746 4:6319147-6319169 CTGGATGTGAAGATGGAGGAGGG - Intergenic
970798641 4:19945886-19945908 ATGCATATTAAGAGGCAAAATGG + Intergenic
970954051 4:21789963-21789985 ATGTATATGAAGATGGAAAATGG - Intronic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
971503905 4:27345735-27345757 TTGGAAATCAAGAGAGAAAATGG - Intergenic
971842700 4:31874662-31874684 CTGATTTTGAAGATGGAAAAAGG - Intergenic
971949892 4:33331777-33331799 CTTTATTTCAAGAGGGAAAATGG + Intergenic
972169260 4:36324945-36324967 CTGGAGAGGAAGAGAGAAAGGGG + Intronic
972693533 4:41422599-41422621 CTATATCTGAAGAAGGAAAAAGG - Intronic
973611330 4:52638283-52638305 CTGGCCTTGAAGAGGGAAGAAGG + Intronic
973758730 4:54098955-54098977 GGGGAAATGAAGAGAGAAAATGG + Intronic
973968905 4:56191327-56191349 CTGGTTTTGAAGAGGGAGGAAGG - Intronic
974098606 4:57392591-57392613 CTGCATATTAAGAGGCAAAATGG + Intergenic
974374402 4:61057947-61057969 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
974476797 4:62392448-62392470 CTGGCTTTGAAGACGGAAACAGG + Intergenic
974631103 4:64490117-64490139 ATGAATATGAAGAGGGACAATGG - Intergenic
974728116 4:65823156-65823178 CTGGCTTTGAAAATGGAAAAAGG + Intergenic
975299031 4:72767678-72767700 ATAAATATGAAAAGGGAAAAAGG + Intergenic
975939581 4:79626462-79626484 CTGCTTATGAAGAGGCAAACTGG + Intergenic
977361933 4:96016294-96016316 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
977791358 4:101107531-101107553 CTGGTGATGATGAGGGAAGAAGG - Intronic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978312844 4:107404702-107404724 CTGTCTAGGAAGAGGAAAAATGG - Intergenic
979666886 4:123321560-123321582 CTGGATTTGAGGATGGAGAAAGG + Intergenic
979754138 4:124318587-124318609 CTGTATATGCAGTGAGAAAAGGG - Intergenic
979851674 4:125578967-125578989 GGGGAAATTAAGAGGGAAAAGGG + Intergenic
980383749 4:132060525-132060547 CTGCCTTTGAAGAGGGAAGAAGG + Intergenic
980740015 4:136938323-136938345 CTGGGAATCAAGAGGGAAGAAGG + Intergenic
981147852 4:141346791-141346813 CTGTATGTTAAGAGGGAGAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981853313 4:149257283-149257305 CTAGATATGAACAGGGACACAGG + Intergenic
982295079 4:153819763-153819785 CTGGATAGGAAGAATCAAAATGG + Intergenic
982471310 4:155793833-155793855 CTGGATATCAAAGGGGGAAATGG - Intronic
982572057 4:157062837-157062859 CAGGATATGAAAAGATAAAAGGG + Intergenic
983435229 4:167706681-167706703 CTGGATCTGAAGGGGAAAGAAGG + Intergenic
984780482 4:183521527-183521549 ATGGTTATGAAAAGGGAGAAGGG - Intergenic
985232304 4:187833379-187833401 CTGGAAAGGAAGAAGTAAAATGG - Intergenic
986033202 5:3912279-3912301 CTGCAAATGAGGAGGTAAAATGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986728592 5:10618310-10618332 CTAGAAATGAAGAGGGGAAGCGG - Intronic
987214117 5:15714932-15714954 CTGGCTTTGAAGATGGAACAGGG + Intronic
987215327 5:15731102-15731124 CTTGTTAGCAAGAGGGAAAATGG + Intronic
987661474 5:20883886-20883908 CTGGCTATCATGTGGGAAAATGG + Intergenic
987767583 5:22253696-22253718 GTGGAGGAGAAGAGGGAAAAGGG - Intronic
988371680 5:30377372-30377394 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
988426598 5:31072511-31072533 TTGGATATGAAGATGGTTAAAGG - Intergenic
988762112 5:34321432-34321454 CTGGCTATCATGTGGGAAAATGG - Intergenic
989118742 5:37982455-37982477 GTAGAAATGAAGCGGGAAAAGGG - Intergenic
989126699 5:38060638-38060660 CTGGATTTGAAGAAAGAAAAGGG - Intergenic
989344296 5:40411865-40411887 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
989488149 5:42016168-42016190 CTGGAGATGAGCATGGAAAAGGG - Intergenic
989978459 5:50612910-50612932 ATGGATATGAAGGGAAAAAAAGG + Intergenic
990153675 5:52849464-52849486 ATGAAAATGAAGAAGGAAAATGG + Exonic
990302518 5:54462895-54462917 CTGGATATGAGGAAGGAAAATGG + Intergenic
990513781 5:56513682-56513704 ATGGGTAAGAAGAGGAAAAATGG + Intronic
990592591 5:57281509-57281531 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
990597924 5:57329868-57329890 ATGAAGATGAAGAGGCAAAAAGG - Intergenic
990649606 5:57883338-57883360 TGGGATATGAAGAAGGAAACAGG + Intergenic
990737323 5:58878489-58878511 CTGGATTTGAAGGTGGAAAAAGG + Intergenic
991247432 5:64522997-64523019 CTGGAAAAGAAAAGAGAAAATGG + Intronic
991625924 5:68601065-68601087 CTGGCTTTGAAGTTGGAAAAAGG - Intergenic
991648047 5:68821121-68821143 TTGGATATGAGGAGGCAAAAGGG - Intergenic
991994286 5:72371745-72371767 CTGGAGATGAAGAGGCACAGCGG - Intergenic
992202540 5:74398615-74398637 CTGAATATGAAGAGGAACAGAGG - Intergenic
992825008 5:80540134-80540156 CTGGATCAGAAGAGGAAAAAGGG - Intronic
993028450 5:82673687-82673709 CTGGTCAGGAAGAGGTAAAAAGG + Intergenic
993731555 5:91428837-91428859 CTGGCTTTGAAGATGGAAAAAGG + Intergenic
993878358 5:93335709-93335731 CTGGCTTTGAAGATGGAGAAGGG - Intergenic
994377618 5:99032957-99032979 GTGGAGCTGAACAGGGAAAATGG - Intergenic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
995736198 5:115302643-115302665 CTAGACAGGAAGAAGGAAAAGGG + Intergenic
995788707 5:115860136-115860158 CTGGCTATGAACATGGAGAATGG - Intronic
996143234 5:119941194-119941216 TTGGATATTAAGGGGGAAGAGGG - Intergenic
996606643 5:125330618-125330640 CTGGATGTAAAGTGGGAGAAGGG + Intergenic
997130605 5:131272403-131272425 CTGAAAATGAAGAGGAAAAAAGG - Intronic
997389742 5:133504292-133504314 CTGGATATGGAAAGTGAAAAAGG - Intronic
997647914 5:135493202-135493224 CTGGAAATGAAGCAGGAAACTGG + Intergenic
998068672 5:139179508-139179530 CTGCTTCTGTAGAGGGAAAATGG - Intronic
998188710 5:140003478-140003500 CTGGTTTTGAAGGTGGAAAATGG + Intronic
998745635 5:145256203-145256225 CTGGATTTGAAGATGGAAGGAGG - Intergenic
999322042 5:150621496-150621518 CTGGAGATCAGGAGGGAAGAAGG + Intronic
999968545 5:156835622-156835644 ATGGAGTTGAAGAGGGAGAATGG - Intergenic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001899416 5:175412862-175412884 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1001995812 5:176156940-176156962 ATGGAAATGAAGAGGGCAGAGGG - Intergenic
1003845588 6:10170970-10170992 CTGGCTTTGAAGTTGGAAAAAGG + Intronic
1004112244 6:12730541-12730563 CTGCAAAGGAAGAGGAAAAAGGG + Intronic
1004308611 6:14523645-14523667 CTGGCCATGGAGAGGGAGAAGGG - Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004739961 6:18450005-18450027 TTGGATAAGAAAAGGGAAATTGG - Intronic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005047494 6:21655914-21655936 CTGGCTATGAAGAAGACAAATGG + Intergenic
1005056963 6:21738443-21738465 CTGGAGATGAGGATGGACAAGGG + Intergenic
1006185516 6:32179569-32179591 CAGGAGATGAAGAGGGAAATGGG + Intronic
1008430682 6:51413194-51413216 TGGGATATAAAGAGGGAAACAGG - Intergenic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1009524005 6:64720199-64720221 CTGGCTTTGAAGAGGGAGGAAGG - Intronic
1010346895 6:74821713-74821735 CTGGAGAGGATGAGGAAAAAGGG + Intergenic
1010591033 6:77712522-77712544 ATAGATATGAATAAGGAAAAGGG + Intronic
1011136075 6:84102439-84102461 CTGGCTATGAAGATGGAGGAAGG + Intergenic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1011787360 6:90862123-90862145 CTTCATATGCAGAGTGAAAAAGG - Intergenic
1011805752 6:91071068-91071090 CTTGTTATCAAGGGGGAAAATGG + Intergenic
1011927764 6:92669169-92669191 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1012278444 6:97300713-97300735 AGGGATAGGAAGAGGGTAAATGG + Intergenic
1012414623 6:98999769-98999791 CATGATATGAAAGGGGAAAAAGG - Intergenic
1014002980 6:116385495-116385517 TTGGATATGGAGAGTGAAATAGG + Intronic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014168079 6:118248552-118248574 CTGGCTTTGAAGATGGAGAAAGG + Intronic
1014317076 6:119881365-119881387 TTGAATATGAAGAGTTAAAATGG - Intergenic
1014997321 6:128165332-128165354 CTGTATGTAAAGAGGAAAAAGGG - Intronic
1015275289 6:131377747-131377769 CTGGCTTTGAAGAAGGAGAAAGG - Intergenic
1015666654 6:135638056-135638078 CTGGATAAGGTGATGGAAAATGG + Intergenic
1015823818 6:137291202-137291224 CTGGTTTGGAAGAGGGGAAATGG + Intergenic
1015868093 6:137748073-137748095 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1016352335 6:143181852-143181874 CAGGATAAGAAGTTGGAAAAGGG + Intronic
1016473555 6:144401408-144401430 TTTGATATGAAGATGGTAAAGGG + Intronic
1016635710 6:146287760-146287782 CTGGTTTTGAAAAGGGAAAAGGG + Intronic
1017051005 6:150393300-150393322 CTCCCTATAAAGAGGGAAAATGG - Intronic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1017768750 6:157628604-157628626 CTGGAAGTGAGGAGGGGAAAGGG - Intronic
1018335448 6:162783144-162783166 ATGAATATGTAGAGGGTAAAAGG + Intronic
1018463500 6:164021224-164021246 CAGGATATGAGGAAGGAAAGAGG + Intergenic
1018668352 6:166160229-166160251 CAAGTTATGCAGAGGGAAAAAGG - Intronic
1019986003 7:4656421-4656443 CTGGATAGGAAAAGGGGGAAGGG - Intergenic
1021149681 7:17134414-17134436 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1021790069 7:24195905-24195927 CTGGATCCCAAGAGGGAAAAAGG + Intergenic
1022099759 7:27161997-27162019 CAGGCTCTGAAGAGGGAAATAGG - Intergenic
1022772718 7:33491826-33491848 CTAGAGATGAAGAGGCCAAAGGG + Intronic
1022901254 7:34812579-34812601 CTGGATTTGAAGAGGCAGAGAGG + Intronic
1023059900 7:36316859-36316881 CTGGATATCATGAAGGAAACTGG - Intergenic
1023165546 7:37339859-37339881 CTTGATATGATGAGCCAAAAAGG + Intronic
1023310458 7:38881274-38881296 CTAGCTTTGAAGAGGGAAGAAGG - Intronic
1025638836 7:63349204-63349226 CTGGATGTGACCAGGGATAAGGG - Intergenic
1025643860 7:63398885-63398907 CTGGATGTGACCAGGGATAAGGG + Intergenic
1026258259 7:68731717-68731739 ATGCATATTAAGAGGCAAAATGG + Intergenic
1026938987 7:74275761-74275783 CTGGAGATGGAGAGGGAAACAGG - Intergenic
1027557713 7:79686875-79686897 CTGGCTCTGAAGATGGAGAAAGG - Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028372098 7:90103957-90103979 CTGGACTTGAAGAAGGAGAAAGG - Intergenic
1030183927 7:106740587-106740609 CTGCATTTGAAGAATGAAAAGGG - Intergenic
1030769192 7:113452668-113452690 GTGAAAAAGAAGAGGGAAAATGG + Intergenic
1030886189 7:114940914-114940936 CTGGATAACAAGATGGAATAGGG - Intronic
1031033061 7:116755689-116755711 TTGGATTTGAAGAGAGAGAAAGG + Intronic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031346807 7:120676834-120676856 CTGGATAGGAAAAAGAAAAAAGG + Intronic
1031375894 7:121025613-121025635 CAGGAGGTTAAGAGGGAAAAGGG - Intronic
1031865481 7:127034535-127034557 CTGGATATGAAGAGGGAAAAGGG - Intronic
1031915440 7:127558756-127558778 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1032697261 7:134348125-134348147 CTGGAGAGGAATAAGGAAAATGG - Intergenic
1033269503 7:139918112-139918134 ATGGCTTAGAAGAGGGAAAATGG - Intronic
1033424436 7:141231157-141231179 CTGGAAATGCAGAGGCAAACAGG - Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1034625247 7:152487395-152487417 CTGGACAGGGAGAGAGAAAAAGG - Intergenic
1035928922 8:3759993-3760015 CTGGACATCAGGAGAGAAAATGG - Intronic
1037172849 8:15914124-15914146 CTGGAAGTGAAGAGGGAGGAGGG + Intergenic
1037217598 8:16476665-16476687 CAGAATAAGAAGAGGGAAAAGGG - Intronic
1037288600 8:17326926-17326948 TTGTAAATAAAGAGGGAAAAAGG + Intronic
1037358112 8:18044299-18044321 CTGACTTTGAAGATGGAAAAAGG - Intergenic
1037421906 8:18711141-18711163 CTGAATATGGAAAGGGAAAATGG + Intronic
1038169122 8:25112833-25112855 CTTGAAATGAGGAGGGAAACAGG - Intergenic
1038202882 8:25431448-25431470 CTGGATATGATAGGGGACAATGG + Intronic
1038552772 8:28484248-28484270 CTGGAAATTAAGAGGGGAGAAGG - Intronic
1038813032 8:30871014-30871036 CTGGCTTTGAAGATGAAAAAAGG - Intronic
1039466064 8:37786309-37786331 CTGGATGTGGAGAGGGGGAAAGG + Intronic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1039858518 8:41436815-41436837 CTGGGTATAAAGAGAGAAGAAGG + Intergenic
1039908554 8:41805878-41805900 TTGGATATGTAGTTGGAAAAAGG + Intronic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1040061475 8:43106871-43106893 TGGGCTATGAAGATGGAAAAAGG + Intronic
1040740045 8:50562422-50562444 CTGGCTCTGAAGATGGAGAAGGG + Intronic
1041037840 8:53813543-53813565 CTGGAGATGAAAAGGTAGAAGGG - Intronic
1041849199 8:62369037-62369059 ATGGAAATGAAGAGTGCAAAGGG - Intronic
1041945261 8:63433687-63433709 CTGGATAAGACCAGGGAATATGG + Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1043510202 8:80943615-80943637 TTGGACATGAAGAGGGAGCAAGG - Intergenic
1043716040 8:83488109-83488131 CTGAATTTCAAAAGGGAAAAGGG + Intergenic
1044647935 8:94464306-94464328 CTGGCTATGAAGACGGAAGAAGG + Intronic
1045002732 8:97892567-97892589 ATGGATATGTAGTTGGAAAAGGG + Intronic
1045928563 8:107598484-107598506 ATGGATATAAAGTAGGAAAAAGG - Intergenic
1046035123 8:108831495-108831517 ATGGCTATGAACAGGGGAAAGGG - Intergenic
1046885217 8:119359597-119359619 ATGGAAAAGAAGAGGGAAAATGG - Intergenic
1046945900 8:119974059-119974081 CTGGAAAGGAAAGGGGAAAAAGG + Intronic
1047407180 8:124595483-124595505 CTGGCTTTGAAGATGGACAAAGG - Intronic
1047589267 8:126309859-126309881 CTTGAGAAGAAAAGGGAAAATGG - Intergenic
1047638384 8:126791917-126791939 CTGGCTTTGAAGAAGGAAAATGG - Intergenic
1048316619 8:133367833-133367855 CTGGATTTCAAGAGGGAGGAAGG + Intergenic
1048977872 8:139683103-139683125 CCTGATAGGAAGAAGGAAAAGGG + Intronic
1049941602 9:551253-551275 CTGGACAAAAAGAGGGAAACAGG - Intronic
1051244260 9:15093233-15093255 CTGGCTTTGAAGAGGGAAGGAGG - Intergenic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1052069682 9:24067082-24067104 CTGGAACTGGAGAGGGAGAAAGG + Intergenic
1054969312 9:71066827-71066849 CTAGATAAAAAGAGGGAACAGGG - Intronic
1055045168 9:71916590-71916612 CTTGAGATGGAGATGGAAAATGG + Intronic
1055270334 9:74550649-74550671 CTGTATAAGAAAAGAGAAAATGG - Intronic
1055369186 9:75578679-75578701 CTGGATGTGAGGGGGAAAAATGG + Intergenic
1056262199 9:84860187-84860209 CTGAATATGAGAAGGGTAAAGGG - Intronic
1056780048 9:89542511-89542533 CTGGAGATGGAGAGAGAAACGGG + Intergenic
1056806583 9:89733499-89733521 AAGGAAATGAAGAGGGAAGAAGG - Intergenic
1057041411 9:91850518-91850540 CTGGCTCTGAAGATGGACAAGGG + Intronic
1057540812 9:95967811-95967833 ATTGATATGAAAAGGGAAACTGG - Exonic
1057713481 9:97468416-97468438 CTGGATGTGAAGAATAAAAAAGG + Intronic
1057738480 9:97690112-97690134 CTGGCTATGAAGATGGAGGAAGG - Intronic
1058090953 9:100804752-100804774 CTGGATTTGAAGATGGAAGGAGG + Intergenic
1058140399 9:101351898-101351920 ATGGATAAGGAGAGGGGAAATGG + Intergenic
1058860114 9:109108059-109108081 CTGGATAAGAGGAGGGAACTGGG - Intronic
1059223621 9:112650619-112650641 ATGGAAAAGAAGAGGAAAAAAGG + Intronic
1059894187 9:118842007-118842029 CTGGCTCTGAAGATGGAACAAGG - Intergenic
1059905991 9:118986977-118986999 CAGGATATGAAGATGAATAAGGG - Intergenic
1060046252 9:120343625-120343647 CTGGCTCTGAAGATGGAAGAAGG - Intergenic
1061673308 9:132201460-132201482 GCGGAACTGAAGAGGGAAAAGGG - Intronic
1185481175 X:447507-447529 CTGGGAATGGGGAGGGAAAATGG - Intergenic
1185934849 X:4244788-4244810 CTGTGTTTGAAGACGGAAAAGGG + Intergenic
1186125040 X:6404261-6404283 CTGGCTTTGAAGATGGAAATTGG + Intergenic
1186233866 X:7485800-7485822 CTGGCTTTGAAGATGGAAAGGGG - Intergenic
1186350431 X:8733428-8733450 GTGTATAAGAATAGGGAAAAGGG - Intergenic
1186840683 X:13482028-13482050 CTGGAAAGGAACAAGGAAAAAGG - Intergenic
1187333896 X:18365121-18365143 CTGGCTTTGAAGATGGACAAAGG - Intergenic
1188344452 X:29046392-29046414 ATGGATATGAACAGGGATAGAGG + Intronic
1188410913 X:29871107-29871129 CCGGTTTTGAAGATGGAAAAAGG - Intronic
1188713784 X:33434924-33434946 AAGAATATAAAGAGGGAAAACGG + Intergenic
1188738639 X:33749767-33749789 CTGGATATGATGAGTACAAAAGG - Intergenic
1188881565 X:35497913-35497935 CTGGATCTGGAAAGGAAAAAAGG - Intergenic
1189120909 X:38393922-38393944 CTAGGTTTGAAGATGGAAAAAGG - Intronic
1189161552 X:38814214-38814236 CTGGCTGTGAAGATGGAAGAAGG + Intergenic
1189730139 X:44011613-44011635 CTGGCTTTGAAGATGGAGAAAGG - Intergenic
1190000423 X:46681263-46681285 TTGGATAAGATGGGGGAAAAGGG - Intronic
1190062795 X:47221882-47221904 CTGGATTTGAGGAGAGAAATGGG - Intronic
1190815033 X:53922370-53922392 TTGGATATGAAGTGTGAGAAAGG + Intergenic
1190980699 X:55454730-55454752 CTGGATGTCAAGAAGGAAGAAGG - Intergenic
1190987998 X:55518450-55518472 CTGGATGTCAAGAAGGAAGAAGG + Intergenic
1192615726 X:72620181-72620203 CTGGATATGAAAGGAGAGAAGGG - Intronic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1193960993 X:87924602-87924624 CTGGTGATGAACAGGGAAACAGG - Intergenic
1194129230 X:90059611-90059633 CTGGCTTTGAAGATGGAGAAAGG + Intergenic
1194741072 X:97575034-97575056 CTGGATATGAGGATAAAAAAGGG + Intronic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1195295977 X:103477902-103477924 ATGGATTTAAAGAGGTAAAAAGG - Intergenic
1195491387 X:105474205-105474227 CTGGCTTTGAAGATGAAAAATGG + Intronic
1196053233 X:111327754-111327776 GTGGAAGTGGAGAGGGAAAATGG + Intronic
1196527344 X:116741524-116741546 CTGGGTATAGAGAGGGACAACGG - Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196647353 X:118132200-118132222 AAGTATATGAAAAGGGAAAAAGG + Intergenic
1197790585 X:130249838-130249860 CAGGATATGAACAGGAATAAAGG + Intronic
1197864847 X:131006911-131006933 CTGGATTTGGAAAGGGCAAAGGG + Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199310523 X:146315158-146315180 ATGGACAGGAACAGGGAAAAAGG + Intergenic
1199366516 X:146991795-146991817 CTGGATATGAATGGGCCAAAAGG - Intergenic
1199627180 X:149751348-149751370 ATGGACAGGAACAGGGAAAAAGG + Intergenic
1199684618 X:150255141-150255163 CTGTCTCTGGAGAGGGAAAAGGG - Intergenic
1201433620 Y:13931890-13931912 ATGGAAATGAAGAGGGCAAGAGG + Intergenic
1201606762 Y:15794397-15794419 CTGGCTTTGAAGATGGAAATTGG + Intergenic