ID: 1031867505

View in Genome Browser
Species Human (GRCh38)
Location 7:127053987-127054009
Sequence AGATACTTCTTAACTGGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031867503_1031867505 -1 Left 1031867503 7:127053965-127053987 CCTTACAGTAACTCTGAGAGGTA 0: 1
1: 1
2: 7
3: 77
4: 442
Right 1031867505 7:127053987-127054009 AGATACTTCTTAACTGGTATAGG 0: 1
1: 0
2: 1
3: 7
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031867505 Original CRISPR AGATACTTCTTAACTGGTAT AGG Intronic
901158520 1:7156667-7156689 AGATACTTCTGAAATCGTCTTGG - Intronic
904092077 1:27952333-27952355 AGATATTTCCCAACTGGAATGGG + Intronic
905358039 1:37398507-37398529 AGAAACTGCTTAATGGGTATGGG + Intergenic
906042451 1:42798566-42798588 AGAGCCTTCAGAACTGGTATTGG + Intergenic
906552512 1:46677297-46677319 AGCTACTTCTGAGCTGGTAATGG + Exonic
906571515 1:46845831-46845853 AGATGCTTCTTAAATGGTTGAGG - Intergenic
906813613 1:48854342-48854364 AGATCCTTGGTCACTGGTATGGG + Intronic
908447516 1:64214923-64214945 AGATACTTCTTACTTTGTAATGG - Exonic
913704883 1:121410451-121410473 AGATATTTCTTCACAAGTATTGG - Intergenic
922602749 1:226869890-226869912 AGAAACTTCTCAATGGGTATGGG + Intergenic
924661807 1:246026179-246026201 AGAAACTTTTTTTCTGGTATGGG - Intronic
1068191738 10:53660688-53660710 AGATACTTCTTATTTGGTCTTGG + Intergenic
1071850340 10:89562414-89562436 AGATATTTTTTAAAAGGTATGGG + Intergenic
1071998808 10:91174109-91174131 AGTTACTACTTAACTGTAATTGG + Intronic
1073664947 10:105521017-105521039 AGTTAATTCTTAAATGGTGTTGG - Intergenic
1077426799 11:2484109-2484131 AGATACTTCTTTTGTGTTATGGG + Intronic
1078007385 11:7542223-7542245 GAATAATTCCTAACTGGTATGGG + Intronic
1078284819 11:9941503-9941525 AAATACTCCTTGGCTGGTATTGG - Intronic
1079113277 11:17620218-17620240 AGAAACTGCTTAATGGGTATGGG - Intronic
1079754335 11:24237355-24237377 AAATACTTGTTAACTGCTAAAGG + Intergenic
1080160151 11:29164107-29164129 GGATACTCCTTAACTGTTAGTGG + Intergenic
1080207836 11:29751518-29751540 ACATTCTTCTTGACTGTTATTGG + Intergenic
1081051856 11:38351121-38351143 AGGTACTTCTTAACAGGCAGAGG - Intergenic
1081480044 11:43477516-43477538 AGATACTTCTTACATGGTGGTGG + Intronic
1081894914 11:46577475-46577497 ACAAACTGCTTAACTGGTAAGGG + Intronic
1086558620 11:88141402-88141424 AAATAATTCTTAGCTGGGATTGG - Intronic
1087953034 11:104248704-104248726 AGGAACTTCTGAAATGGTATCGG - Intergenic
1089371526 11:117963131-117963153 TGATACTTCTTTACTAGTATGGG - Intergenic
1090894020 11:130953230-130953252 AGATGCTTGTAAACTGGGATTGG - Intergenic
1090954972 11:131505769-131505791 AGATAGTTCTCAACTGGGTTGGG - Intronic
1095660562 12:44729036-44729058 AAGTACTTTTTAACTGGTAAAGG + Intronic
1101262854 12:103050452-103050474 AGATGCTTCTTATCTGTTGTAGG + Intergenic
1103063889 12:117881049-117881071 AGATACTTGAAATCTGGTATAGG - Intronic
1104139871 12:125977431-125977453 AGATATTTCTTAACTGATGGTGG + Intergenic
1105203524 13:18199849-18199871 AGAAACCTCTTAAATGCTATTGG - Intergenic
1107215500 13:37913545-37913567 AGAAACTTCCTAAGTGGTTTAGG - Intergenic
1107624698 13:42271408-42271430 AGCTACTTCTTGGCTGGGATAGG + Intergenic
1109751676 13:66700966-66700988 ATATACTTTTTCACAGGTATAGG + Intronic
1111316556 13:86568981-86569003 TGATAATTCTGACCTGGTATAGG + Intergenic
1115185413 14:30683088-30683110 AGATACTTCTTAAAAGCTGTGGG + Intronic
1115290005 14:31760006-31760028 AGATGCTTCTTAACTTGCAGTGG - Intronic
1115421650 14:33201801-33201823 AGAGACTACTTAATTGGAATGGG - Intronic
1116705962 14:48300850-48300872 AGATACTGAGTTACTGGTATGGG + Intergenic
1121079169 14:91093966-91093988 AGTGACTGCTTAACAGGTATAGG + Intronic
1125301757 15:38262309-38262331 AGATACTTCTGAAATGTGATGGG + Intronic
1130782242 15:87053916-87053938 AGATAATTCTTCACAGGTAATGG + Intergenic
1131693528 15:94852278-94852300 TCATCCTTCTTAATTGGTATTGG + Intergenic
1133106475 16:3513368-3513390 ACATACTTCTTGGCTGGCATTGG - Intronic
1134151111 16:11805589-11805611 AGGTACTTCTTTTCTGGTACAGG - Intergenic
1135106682 16:19655775-19655797 AGATGCTTCTTAACTGGAGATGG + Intronic
1137640734 16:50026128-50026150 AGAAGCTTCATAAATGGTATTGG - Intronic
1138610419 16:58119283-58119305 TGATGCTTCATAACTGGTCTTGG - Intronic
925895189 2:8465973-8465995 AGATACTTCTTAACTGCGTGTGG - Intergenic
927675525 2:25103255-25103277 AAATACTTCTTGACTTGGATTGG + Intronic
928161601 2:28931751-28931773 AAACACTTCTTAAATTGTATAGG + Intronic
929741079 2:44601094-44601116 TGGTACTTTTTAACTGATATTGG - Intronic
930791431 2:55334333-55334355 AGAGACTTCTCAACTGGAAAAGG - Exonic
933658597 2:84908264-84908286 AGATTCTTATTAATTGATATTGG + Intergenic
936963527 2:118102116-118102138 TGATTCCTCTTAAGTGGTATTGG + Intronic
938252365 2:129825864-129825886 AGATACTGCCTCACAGGTATCGG + Intergenic
939571908 2:143849973-143849995 AGATTTTCCTTAACAGGTATTGG - Intergenic
939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG + Intronic
940639393 2:156331509-156331531 ACATACTGCTTATATGGTATTGG + Intronic
941118241 2:161496845-161496867 AGTTAATACTTAACAGGTATGGG - Intronic
941713087 2:168735567-168735589 AAATACTTCTTAAGTGCTGTTGG - Intronic
941942879 2:171062063-171062085 AGATACTTTCTATCTGTTATAGG - Intronic
943541908 2:189226384-189226406 AGGTGCCTCTTAACTGGTTTTGG - Intergenic
943902649 2:193460670-193460692 AGATACTGCTTAACTGTCTTAGG + Intergenic
944462258 2:199962312-199962334 AGTGACTTCTTAACTCGCATGGG + Intronic
1175178002 20:57125216-57125238 AAAGACTTTTTAACAGGTATGGG + Intergenic
1176714445 21:10338228-10338250 AGAAACCTCTTAAATGCTATTGG + Intergenic
1178330285 21:31684654-31684676 AGATACTTCTTTAACGGCATAGG - Intronic
950793127 3:15489283-15489305 AGATTCTTCTTAGCAGGAATTGG - Intronic
952162493 3:30707877-30707899 ATATACTTCTTTCCTGGTTTTGG - Intergenic
953403335 3:42646087-42646109 AGACACTTCTTAATTGTTACTGG + Exonic
954022249 3:47752459-47752481 AAATACTTGTTAATTCGTATTGG + Intronic
958284849 3:91727285-91727307 AGAAACTTCTTGATTGTTATGGG + Intergenic
958285547 3:91738857-91738879 AGAAACTTCTTGATTGTTATGGG + Intergenic
958289056 3:91796349-91796371 AGAAACTTCTTGATTGTTATGGG + Intergenic
958289249 3:91799580-91799602 AGAAACTTCTTGATTGTTATGGG + Intergenic
958289956 3:91811142-91811164 AGAAACTTCTTGATTGTTATGGG + Intergenic
958290481 3:91819817-91819839 AGAAACTTCTTGATTGTTATGGG + Intergenic
958292035 3:91845169-91845191 AGAAACTTCTTGATTGTTATGGG + Intergenic
958294469 3:91884623-91884645 AGAAACTTCTTGATTGTTATGGG + Intergenic
958294649 3:91887514-91887536 AGAAACTTCTTGATTGTTATGGG + Intergenic
958297109 3:91927585-91927607 AGAAACTTCTTGATTGTTATGGG + Intergenic
958315950 3:92236025-92236047 AGAAACTTCTTGATTGTTATGGG + Intergenic
958319311 3:92291327-92291349 AGAAACTTCTTGATTGTTATGGG + Intergenic
958323285 3:92357015-92357037 AGAAACTTCTTGATTGTTATGGG + Intergenic
958326476 3:92409258-92409280 AGAAACTTCTTGATTGTTATGGG + Intergenic
958338555 3:92607631-92607653 AGAAACTTCTTGATTGTTATGGG + Intergenic
958346603 3:92738633-92738655 AGAAACTTCTTGATTGTTATGGG + Intergenic
958354619 3:92870640-92870662 AGAAACTTCTTGATTGTTATGGG + Intergenic
958359988 3:92959275-92959297 AGAAACTTCTTGATTGTTATGGG + Intergenic
958364042 3:93025425-93025447 AGAAACTTCTTGATTGTTATGGG + Intergenic
958371997 3:93155402-93155424 AGAAACTTCTTGATTGTTATGGG + Intergenic
958375289 3:93209326-93209348 AGAAACTTCTTGATTGTTATGGG + Intergenic
958375808 3:93218003-93218025 AGAAACTTCTTGATTGTTATGGG + Intergenic
958378256 3:93257478-93257500 AGAAACTTCTTGATTGTTATGGG + Intergenic
958381880 3:93316502-93316524 AGAAACTTCTTGATTGTTATGGG + Intergenic
958387268 3:93404948-93404970 AGAAACTTCTTGATTGTTATGGG + Intergenic
958388339 3:93422298-93422320 AGAAACTTCTTGATTGTTATGGG + Intergenic
958393375 3:93504700-93504722 AGAAACTTCTTGATTGTTATGGG + Intergenic
958399361 3:93603019-93603041 AGAAACTTCTTGATTGTTATGGG + Intergenic
959887339 3:111517801-111517823 AGGTTCTTCTTAACTGGAACAGG - Intronic
959968541 3:112382482-112382504 AGGTACTTCTTAAATGGCAGTGG - Intergenic
961308131 3:125973910-125973932 AGAAACCTCTTACCAGGTATTGG + Intronic
962672734 3:137725875-137725897 AGGTACTTCTTACATGGTAGCGG + Intergenic
963571835 3:147008075-147008097 AGATACTGCTTTGCTGGTCTTGG + Intergenic
970972706 4:22002854-22002876 AGAAATTACTTAACTGCTATGGG + Intergenic
972944084 4:44231930-44231952 AGAAACTTCTTAAGTAGTTTTGG + Intronic
976901139 4:90177760-90177782 AGATACTGCTTAAATGGTTTAGG - Intronic
977236035 4:94508358-94508380 GGAAACTTATTAAGTGGTATTGG + Intronic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978187501 4:105873884-105873906 AGATACTTCTTTTCAAGTATTGG - Intronic
979864682 4:125738808-125738830 AGATACTTCTTAGTTGGTCATGG - Intergenic
981636137 4:146882004-146882026 CGATACTCTTTAACTGGTGTGGG - Intronic
982611837 4:157584195-157584217 AGACACTTCTTACATGGCATCGG + Intergenic
983535919 4:168856806-168856828 ATATACTTCTTAACTGGTTTAGG - Intronic
983689079 4:170446228-170446250 AGATACTTCTGAACTTTTACAGG - Intergenic
988663995 5:33305055-33305077 AGATTCTGGTTAATTGGTATAGG - Intergenic
989143717 5:38227750-38227772 ACATTCTTCTCAAATGGTATCGG - Intergenic
989192190 5:38681636-38681658 ACTTATTTCTTAACTGGTTTTGG - Intergenic
989547949 5:42696421-42696443 AGTTACCTCTGAACTGGAATTGG + Intronic
993893432 5:93502780-93502802 AGCTATTTCTTATCTGGCATGGG - Intergenic
994491242 5:100446435-100446457 GGATACATCTTAACTGATAGAGG - Intergenic
997079017 5:130716269-130716291 AAATACTTCTTTACTGGAATAGG + Intergenic
997220463 5:132157796-132157818 AGATAAATCTTAACTGCCATGGG - Intergenic
1004713574 6:18194918-18194940 AGAGACTGTTTAATTGGTATAGG - Intronic
1011025112 6:82860196-82860218 AGATAATTGTTTACTGGTTTTGG + Intergenic
1011184377 6:84658072-84658094 AGAGACTTGTTAACTGCTTTCGG + Intergenic
1014338973 6:120178621-120178643 AGATGCTTCTTTACTGATAAAGG - Intergenic
1017614904 6:156236046-156236068 AAATACTTATTAACTGATCTGGG - Intergenic
1017791033 6:157799662-157799684 AGATACTTCTTACATGGTGGTGG + Intronic
1018220756 6:161576327-161576349 AGATTCTCCTTAACTGGCTTAGG - Intronic
1027877775 7:83793113-83793135 ATAAACTTCTTAACTTGTTTAGG - Intergenic
1028407190 7:90488084-90488106 GGAAACTTCTTAAATGGTACTGG - Intronic
1028783370 7:94763613-94763635 AGATATTTCATAACATGTATTGG + Intergenic
1029027692 7:97434745-97434767 AGATTCTTCTTGAGTGGGATGGG + Intergenic
1029324384 7:99793519-99793541 AGAAACTGCTCAACTGGTACAGG - Intergenic
1031867505 7:127053987-127054009 AGATACTTCTTAACTGGTATAGG + Intronic
1038203163 8:25435790-25435812 AAATACTTATTAGCAGGTATAGG - Intronic
1039827350 8:41186082-41186104 AGCTACTTTTTAACTGGTTCTGG + Intergenic
1040094726 8:43432579-43432601 AGATACTTCTTACATGGTAGTGG - Intergenic
1045223288 8:100219689-100219711 AGATACATCTTTAGTGATATTGG + Intronic
1050026546 9:1340312-1340334 AGATACTTCAAAACTGGACTAGG - Intergenic
1054968815 9:71061044-71061066 AGATATTTCTTAACAAGTGTCGG + Intronic
1058279766 9:103099378-103099400 AGAGACTTGTTAAATGGTTTTGG - Intergenic
1186323855 X:8458073-8458095 AGGTACTTCTTACCTGGCAGTGG + Intergenic
1186363561 X:8868432-8868454 AGGTACTTCTTAAATGGTTTTGG + Intergenic
1189826065 X:44919370-44919392 AGATGCTCCTCTACTGGTATAGG + Intronic
1190514391 X:51207574-51207596 AGATACTTCTTAAATAAAATGGG - Intergenic
1192384377 X:70651084-70651106 AGACAATTCTTAACTGATATGGG + Intronic
1192905846 X:75549337-75549359 AACTAATTCTTAGCTGGTATTGG + Intergenic
1196402742 X:115333129-115333151 AGTAACTTCTTAATTGGTGTGGG - Intergenic
1197690863 X:129499958-129499980 AGAAAGTTCGCAACTGGTATTGG - Intronic
1198013673 X:132586709-132586731 AGTTAGTTCTTAAAGGGTATAGG + Intergenic
1200874816 Y:8142507-8142529 AGGAACTGCTTAACTGGTAGTGG - Intergenic
1202187619 Y:22203881-22203903 AGGAACTGCTTAACTGGTAGTGG - Intergenic
1202203741 Y:22382515-22382537 AGGAACTGCTTAACTGGTAGTGG + Intronic