ID: 1031869091

View in Genome Browser
Species Human (GRCh38)
Location 7:127073011-127073033
Sequence CAGGAAAAACTCTCAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 328}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031869082_1031869091 23 Left 1031869082 7:127072965-127072987 CCATCCTCGCTTCCTTTTCCCTT 0: 1
1: 0
2: 23
3: 406
4: 3142
Right 1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 328
1031869086_1031869091 4 Left 1031869086 7:127072984-127073006 CCTTTTCCTTCAAAAAGTAGTAT 0: 1
1: 0
2: 2
3: 35
4: 395
Right 1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 328
1031869087_1031869091 -2 Left 1031869087 7:127072990-127073012 CCTTCAAAAAGTAGTATTCTACA 0: 1
1: 0
2: 0
3: 23
4: 204
Right 1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 328
1031869084_1031869091 11 Left 1031869084 7:127072977-127072999 CCTTTTCCCTTTTCCTTCAAAAA 0: 1
1: 1
2: 4
3: 97
4: 1085
Right 1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 328
1031869085_1031869091 5 Left 1031869085 7:127072983-127073005 CCCTTTTCCTTCAAAAAGTAGTA 0: 1
1: 0
2: 2
3: 35
4: 399
Right 1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 328
1031869083_1031869091 19 Left 1031869083 7:127072969-127072991 CCTCGCTTCCTTTTCCCTTTTCC 0: 1
1: 0
2: 6
3: 125
4: 1146
Right 1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG 0: 1
1: 0
2: 1
3: 29
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031869091 Original CRISPR CAGGAAAAACTCTCAGAGGA GGG Intronic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
901651617 1:10746465-10746487 TAGGAGAAGCTCCCAGAGGAAGG + Intronic
901773120 1:11540984-11541006 CAGGATAGACTCTCAGAAGCAGG - Intergenic
902391626 1:16110491-16110513 CAGGAAAACCGCTCTGAGGAGGG + Intergenic
902887305 1:19414966-19414988 CAGCAAAAACTCTCTGATGCTGG + Intronic
903561748 1:24233284-24233306 TAGGAAAAGCACTCAGCGGAGGG + Intergenic
903746287 1:25588999-25589021 CAGGAAGACTTCTTAGAGGAAGG - Intergenic
904738499 1:32653186-32653208 CAGATAAAATTATCAGAGGAAGG + Intronic
904809479 1:33153992-33154014 CAGGAAGGCTTCTCAGAGGAAGG + Intronic
905035862 1:34918078-34918100 CAGGCAGAACCCTCAGAGGGGGG + Intronic
905898309 1:41563439-41563461 CAGGAAAAAGTCAGGGAGGAGGG - Intronic
906349176 1:45042693-45042715 CAGGAAACTATTTCAGAGGAGGG + Intronic
906726662 1:48049168-48049190 GAGGAAAAGCTGTCTGAGGAGGG + Intergenic
907291079 1:53413303-53413325 GAGGATAAACTGTCAGAGGCTGG - Intergenic
907806534 1:57826096-57826118 CATGTAAAAATCTCAGAAGAAGG + Intronic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
913052203 1:115127426-115127448 CAGGAAGGACTCTCTGAGCAAGG + Intergenic
915064875 1:153216632-153216654 CAGGAAAGGCTCTCAGAGGGTGG + Intergenic
915330038 1:155105689-155105711 CAGGAAAGACTCTCACTGGAGGG + Intergenic
915420783 1:155779727-155779749 CTGGAAAAAGTCTCCCAGGAGGG + Intronic
916508315 1:165448216-165448238 CAGAAGGAACTCTCAGAGAAAGG - Intergenic
917067594 1:171113693-171113715 CAGGAAAAACTCTGAAGTGAGGG - Intronic
922107223 1:222523095-222523117 CAGGAAAGACTTACAGAGGAAGG - Intronic
922860209 1:228810118-228810140 CTGGAAAAACTCCAAGAGGATGG - Intergenic
924282576 1:242452937-242452959 CAGGTAAAATGCTCAGCGGAAGG + Intronic
924443057 1:244102787-244102809 CAGGAATAACACCCAGGGGATGG + Intergenic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1065091873 10:22243596-22243618 CAGGAAGAACACGCAGAGGGAGG + Intergenic
1067790381 10:49283315-49283337 GAGGAAGAACTCTTAAAGGATGG - Intergenic
1072158952 10:92748640-92748662 CAGGAAAGAGTCTCAAAGGGAGG - Intergenic
1072605903 10:96982474-96982496 CCGGAAAAGCTTTCAGTGGAGGG - Exonic
1072646734 10:97261753-97261775 CAGGAAAAATACTCAGGGGCAGG + Intronic
1073265990 10:102228730-102228752 CGGGAGAAATTCTCAGGGGAGGG - Intronic
1074279491 10:112037473-112037495 CAGGAAGACCTCTCTGATGAGGG - Intergenic
1074464045 10:113666425-113666447 CAGGAACATCTACCAGAGGAAGG + Intergenic
1074662466 10:115677315-115677337 CAGGAAAATCCCTCACAGCATGG + Intronic
1074982353 10:118629994-118630016 CAGAATATGCTCTCAGAGGAAGG + Intergenic
1077792069 11:5451718-5451740 CAGAAAGAACTCTGAGAGCATGG + Intronic
1077831928 11:5882216-5882238 CAGGTAAAACTGTGAGAGGGTGG + Intronic
1078129866 11:8604625-8604647 TAGGAAAAGCTCTCTGAGGAGGG + Intergenic
1078409686 11:11104059-11104081 CAGGAAAACATCACAGAGAAGGG - Intergenic
1078772524 11:14364109-14364131 CAGCAAGAACTCTTAGAGGAGGG + Intronic
1079230567 11:18645559-18645581 CAGGTAAATCTCACAGTGGAGGG + Intergenic
1079719756 11:23794986-23795008 TAGGAAAAAATAACAGAGGAAGG + Intergenic
1084962501 11:72724604-72724626 TAGGAAAAACTCACAGCAGATGG - Intronic
1085552150 11:77383900-77383922 GTGGAAAGAATCTCAGAGGAAGG + Intronic
1085942275 11:81219383-81219405 CAGGAAAATTTATCAGATGAAGG + Intergenic
1086307428 11:85496706-85496728 CAGATGAAGCTCTCAGAGGAAGG + Intronic
1087021149 11:93604644-93604666 CAGTAAATACTATCACAGGAGGG + Intergenic
1087473176 11:98603044-98603066 CAGCAAAACATCTCAGAGGTAGG - Intergenic
1087553405 11:99681944-99681966 CAGGAATAACTCACAAAGCAAGG + Intronic
1087854790 11:103078771-103078793 CAGGAAAATGTTTCAGAAGAGGG - Intronic
1088199936 11:107321228-107321250 CAGAATAAACCCTCAGAGAAGGG + Intergenic
1089228676 11:116949905-116949927 CAGGTAAAAATCTCAGAGTTAGG + Intronic
1091848774 12:3678547-3678569 CATGAAAAACCCTGAGAGCATGG + Intronic
1092154949 12:6276085-6276107 CAGGTGAAAAGCTCAGAGGAGGG + Intergenic
1092619914 12:10252731-10252753 GAGGAATAACTTTCAGAGGAAGG + Intergenic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1094408717 12:30147239-30147261 CAGGAAAAACTGTCCTAAGATGG + Intergenic
1095381474 12:41598994-41599016 TAGGATAGACTCTCAGAGGTGGG - Intergenic
1096186549 12:49585491-49585513 CTGAAAAAAATCTCAGAGAAGGG + Intronic
1097407538 12:59209244-59209266 CTCGAAAAAGTCTTAGAGGAGGG + Intergenic
1101220628 12:102635503-102635525 CAGGAAATGTTCACAGAGGAAGG - Intergenic
1101345089 12:103879166-103879188 CAGGACACACTCCCAAAGGAGGG - Intergenic
1103997854 12:124841738-124841760 CAGGAGGGCCTCTCAGAGGAGGG - Intronic
1104296336 12:127517972-127517994 GAGGAACACCTCTCTGAGGATGG + Intergenic
1104736801 12:131140033-131140055 GAGGCAAAACTCACAGCGGATGG - Exonic
1104852256 12:131882648-131882670 TAAGAAGACCTCTCAGAGGATGG + Intergenic
1106425025 13:29619801-29619823 CAGAAAAAACTTTCTAAGGATGG - Intergenic
1106658863 13:31777238-31777260 AAGGAAAAGCTCTCAGGGAAGGG + Intronic
1108006914 13:45957743-45957765 AAGGAAAAACTATGTGAGGAAGG - Intronic
1109612416 13:64784135-64784157 CAGAAAACTCTCTGAGAGGAGGG - Intergenic
1110341112 13:74391345-74391367 CAGGCAAAACTCACTGATGACGG - Intergenic
1112666019 13:101574500-101574522 CATATAAAACTCTGAGAGGAGGG + Intronic
1112744468 13:102511216-102511238 CTGGAATATTTCTCAGAGGAGGG - Intergenic
1113220435 13:108095401-108095423 TTAGAAAATCTCTCAGAGGATGG - Intergenic
1113379846 13:109794091-109794113 CAGGAGAGACGCACAGAGGAGGG - Intergenic
1114279203 14:21175484-21175506 CAGCAAAAACTGACAGAGGCTGG + Intergenic
1115473849 14:33795660-33795682 TAGGAAGAAATCTCAGAGAATGG - Intronic
1115477145 14:33826252-33826274 CAGGTAAAGCTTTCAGAGGAAGG + Intergenic
1116264279 14:42666668-42666690 GAGGAAAAAAACTCAGAGCATGG + Intergenic
1117916135 14:60680101-60680123 CAGGCAACAATGTCAGAGGAGGG - Intergenic
1118132789 14:62986311-62986333 CAGAAAAACCTCTCAAAGGGAGG - Intronic
1118150114 14:63180055-63180077 CAGCAAAAACTCTGCTAGGAAGG - Intergenic
1118411790 14:65487199-65487221 CAAGGATAGCTCTCAGAGGAGGG + Intronic
1119138173 14:72239705-72239727 TAGCAAACACTTTCAGAGGAGGG - Intronic
1121148583 14:91608122-91608144 CAGGAATAGCTGTAAGAGGAGGG + Intronic
1121291570 14:92780016-92780038 AAAGAAAAACCCACAGAGGAGGG - Intergenic
1123695106 15:22873450-22873472 CAGGACAAAGCCCCAGAGGAGGG - Intronic
1126529132 15:49692275-49692297 AAGAAAAAACCCTCAGAAGAGGG + Intergenic
1126789594 15:52209046-52209068 CAGGGAAACCTCAGAGAGGAAGG + Intronic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1127064439 15:55222342-55222364 CAGGAAAAACACATAGAGTAGGG - Intronic
1127595177 15:60474340-60474362 TAGGATAAACTGTCAGTGGAGGG - Intronic
1127724279 15:61732897-61732919 AAGGAAATAATCTCAGAGAAGGG + Intergenic
1127836431 15:62794566-62794588 CTGGAAAGCCCCTCAGAGGATGG - Intronic
1128306750 15:66603869-66603891 CAGGAGAGACTCTCAGGGCAGGG + Intronic
1128317601 15:66671073-66671095 CAGGAAAAGGACTCAGGGGAGGG - Intronic
1128680326 15:69646897-69646919 CAAGAAATGCACTCAGAGGATGG - Intergenic
1129880410 15:79003048-79003070 CAGGAGAAACCCTGAGAGTAGGG + Intronic
1130745234 15:86646276-86646298 CAGTAACAACTCTAAGTGGAAGG + Intronic
1130858550 15:87864363-87864385 AAGGCTAAACTCTCAGAGAAGGG + Intronic
1131301450 15:91203140-91203162 AAGCAAAGACTCTCAAAGGATGG - Intronic
1132502212 16:289588-289610 CAGGACAAGATCGCAGAGGAAGG - Exonic
1132953593 16:2578780-2578802 CAGGAAAAACTGTGGGAGGTGGG + Intronic
1132960758 16:2621387-2621409 CAGGAAAAACTGTGGGAGGTGGG - Intergenic
1134611041 16:15607936-15607958 CAGGCAAAACTCACACTGGAAGG + Intronic
1135473394 16:22752111-22752133 CTGGAGAAACTCTGAGAAGAAGG + Intergenic
1135523558 16:23196180-23196202 CAGAAAGATCTCTAAGAGGAGGG + Intronic
1135552620 16:23409704-23409726 AGGGAAAAACTGTCTGAGGAAGG + Intronic
1135663704 16:24318005-24318027 CAGGGAAGCCTCTCAGAGAAGGG - Intronic
1136058685 16:27709759-27709781 CAAGAAAAACCCACAGAGCAGGG - Intronic
1136112128 16:28070289-28070311 CAGAAAATGCTCTCAGAGGCAGG + Intergenic
1137492196 16:48942597-48942619 CATGAAAAACACTCAGAAGTAGG - Intergenic
1138240956 16:55426607-55426629 GAGGAAAAAATATCAGAGAAAGG - Intronic
1138679164 16:58672569-58672591 CAGGAAGCATTCTCTGAGGAAGG - Intronic
1138901478 16:61275727-61275749 CTGGAAAAACTGGAAGAGGAAGG - Intergenic
1140516785 16:75548970-75548992 CAGGAACATCTCAGAGAGGAGGG + Intronic
1144237635 17:13277464-13277486 CAGGAGAAACTTTCAAAGAATGG + Intergenic
1145744485 17:27304873-27304895 GAGACAAAACTCTCAGAGTATGG + Exonic
1146144010 17:30394588-30394610 CAGGAAAGAGTCCTAGAGGAGGG + Intronic
1148022427 17:44562273-44562295 AATGAAACACTCTTAGAGGAAGG + Intergenic
1148833796 17:50454593-50454615 GAGAAGAAACTTTCAGAGGAAGG - Intronic
1148891847 17:50813330-50813352 CAGGAAAAACCCCCAGGGGTGGG + Intergenic
1149141840 17:53440566-53440588 CAGAAAATCCTCTCAGCGGATGG - Intergenic
1149350570 17:55782794-55782816 CTGCAAAACTTCTCAGAGGAGGG - Intronic
1149856472 17:60087422-60087444 CAAGAGACACTCTCAGAGAATGG + Intergenic
1151209185 17:72531317-72531339 CATGAAACACCCTCTGAGGATGG - Intergenic
1152175871 17:78786837-78786859 CGGGAAAAACTCTCAAACTATGG - Intergenic
1152214742 17:79025401-79025423 CAGGAACACCTCACAGAGGGGGG - Intronic
1153405267 18:4731562-4731584 TAGGAAAAGCTCTCAAAGGAAGG + Intergenic
1153538059 18:6124081-6124103 CATGAAAACATCTCAGTGGAGGG + Intronic
1153674590 18:7445544-7445566 CAGGAACAGTTCTCTGAGGAGGG + Intergenic
1156920665 18:42518704-42518726 CAGAAAAGATTCTCAGAGAAAGG - Intergenic
1157082150 18:44536882-44536904 ATTGAAAAACTCTAAGAGGAAGG - Intergenic
1158785556 18:60707584-60707606 CAGGGAAAAATCTCAGATGAGGG - Intergenic
1159687145 18:71436579-71436601 CAGGAAAGGCTCTTAGGGGAAGG + Intergenic
1163052446 19:14694636-14694658 TAGGAAAAACTCTCTAAGCAGGG + Intronic
1163272416 19:16262204-16262226 CAGGAAAAACTCTGGGGGAAGGG + Intergenic
1163894815 19:20049452-20049474 CAGGAAAAACTAGTGGAGGATGG + Intergenic
1164544751 19:29151036-29151058 AAGGAAGAAGTCACAGAGGAGGG + Intergenic
1165775398 19:38401640-38401662 CAGCAACAACTCTAAGAGGTAGG + Intergenic
1167584854 19:50368543-50368565 CAGGAAAATCCCCCAGAGCAAGG - Intronic
925717675 2:6799510-6799532 CAGTAAAAACACTTAGAGGATGG + Intergenic
926784867 2:16508966-16508988 CATGAAAAGGTTTCAGAGGATGG + Intergenic
927723913 2:25406096-25406118 CAGGAAATACGTGCAGAGGAGGG + Intronic
928411073 2:31054359-31054381 GGGGAAAGAGTCTCAGAGGAAGG - Intronic
930261019 2:49146115-49146137 CAGGACAAGATCTCAGAGCAGGG + Intronic
932068212 2:68589272-68589294 CAGGCAGAACTCTCAGAACATGG + Intronic
932096847 2:68857826-68857848 CAGGAAAAAGCCCCAGGGGAGGG + Intergenic
933682519 2:85114666-85114688 CTGGAAAAACTTTGAGAAGAAGG - Intergenic
934334720 2:92116396-92116418 CAGAAAAATCTCTGTGAGGATGG + Intergenic
935353858 2:102179954-102179976 CAGGAAGAACTCTCTGCAGAAGG - Intergenic
937098856 2:119253344-119253366 CAGGAAAAGCACTCAATGGATGG + Intronic
937232266 2:120405138-120405160 CAGGAAAGAATTTCAGAGCAGGG - Intergenic
938516208 2:132010004-132010026 CAGCAAAAACCCTCAGCGGCGGG + Intergenic
938783554 2:134606471-134606493 CAGGAGAGACTCGAAGAGGAGGG - Intronic
938825065 2:134996565-134996587 CAGGAAGACTTCCCAGAGGAAGG + Intronic
939640759 2:144638032-144638054 CGGGCAAAACTTCCAGAGGAAGG - Intergenic
939900306 2:147843778-147843800 AAGAAAAAACTCACGGAGGAAGG - Intergenic
941354494 2:164472632-164472654 AAGCAAAAACTCTCATAAGAAGG + Intergenic
948012330 2:234659352-234659374 CTGGAAAAATTATCAGAGAAGGG + Intergenic
1169620264 20:7498805-7498827 GAGGAAACACTCTCAGTGCATGG - Intergenic
1170112038 20:12815589-12815611 CAAGAAATGATCTCAGAGGAGGG + Intergenic
1170429384 20:16262631-16262653 CAGAAAAACCAGTCAGAGGATGG + Intergenic
1170536773 20:17348625-17348647 GAGGTAAAAGTCTCAGATGAAGG + Intronic
1170947481 20:20904302-20904324 CTGGACAAACTCCCTGAGGAAGG - Intergenic
1172049191 20:32103332-32103354 CAGGGGAAGCTCTCAGTGGAGGG + Intergenic
1173059331 20:39646651-39646673 CAGGAAAAGTTCTCAGAGGGAGG - Intergenic
1174504176 20:51005950-51005972 CAGGAAAGCTTCCCAGAGGAAGG - Intronic
1175042851 20:56072088-56072110 GAAGAAAAACTATCATAGGATGG + Intergenic
1175458976 20:59136629-59136651 CAGGATGAAAGCTCAGAGGAGGG - Intergenic
1176015805 20:62931303-62931325 CATGAAACATTCTCAGAGGAAGG - Intronic
1176046083 20:63093359-63093381 CATGAAAAACTTTAAAAGGACGG + Intergenic
1176425131 21:6544044-6544066 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1178279524 21:31269377-31269399 TAAGAGAAACTCTCAGGGGATGG + Intronic
1178809996 21:35872792-35872814 TAGGACAAAATCTCAGAGCATGG + Intronic
1179465347 21:41568073-41568095 CAGGAAGAGACCTCAGAGGAGGG - Intergenic
1179700622 21:43152361-43152383 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1180683917 22:17649961-17649983 CAGGAGAATCGCTCAGAGCAGGG - Intronic
1182433445 22:30314851-30314873 CACAAAAAACCCACAGAGGAGGG + Intronic
1182950797 22:34373856-34373878 AAGGAAAAACACTCAGAGCATGG + Intergenic
1184598806 22:45530399-45530421 CAGGAAGCCCTCCCAGAGGAGGG - Intronic
1184872904 22:47252092-47252114 CAGCAAACACTCTCAGGGGCTGG - Intergenic
1184875197 22:47269957-47269979 CAGGGAGACTTCTCAGAGGAGGG + Intergenic
1184950811 22:47841503-47841525 CAGGAAAAAGACTCAGGGAAGGG - Intergenic
1202717054 2_KI270715v1_random:17900-17922 CAGAAAAATCTCTGTGAGGATGG + Intergenic
1202729368 2_KI270716v1_random:46408-46430 CAGAAAAATCTCTGTGAGGATGG + Intergenic
949586154 3:5439997-5440019 AAAGAAAAGCTCTGAGAGGAGGG + Intergenic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
949821519 3:8121089-8121111 CAGGAAAAATTCTCCAATGAAGG + Intergenic
949971295 3:9407448-9407470 CATGATAAACTGTAAGAGGAAGG - Intronic
950163496 3:10776947-10776969 CAGGAGAAACTGGCAGGGGAGGG - Intergenic
950425725 3:12923861-12923883 CAGGAAGAGCACTCAGAGCAGGG - Intronic
950880872 3:16321783-16321805 CAGGGAAAATTCAGAGAGGATGG - Intronic
951587795 3:24233021-24233043 CAGGTAGAACTGGCAGAGGAAGG - Intronic
951595294 3:24312153-24312175 CAGGAAAACTTCCCAAAGGAAGG - Intronic
952012818 3:28920366-28920388 AAGCTAAACCTCTCAGAGGATGG - Intergenic
952468740 3:33620910-33620932 AAGGTACAACTCTCTGAGGAAGG - Intronic
954451935 3:50576338-50576360 CAGGAAAAACTCTGGGAGCAGGG + Intronic
954469134 3:50676525-50676547 CAGGGAATACTCTAAGAGAAGGG - Intronic
954592578 3:51796017-51796039 TAAGAAAAACTCTTAAAGGAAGG - Intergenic
955870156 3:63429854-63429876 CAGAACAAACTGTCAGAAGAAGG - Intronic
955886532 3:63605216-63605238 CAGGAAAGACTATCTGGGGAGGG + Intronic
956471396 3:69570741-69570763 CAGGAAAGATTCCCAGATGAGGG - Intergenic
958605705 3:96355900-96355922 CAGGAACAAGTCTCAGTGCATGG - Intergenic
960334332 3:116397733-116397755 CTGAAAAAAATCTCAGAGGAAGG + Intronic
961325299 3:126105940-126105962 CAGGAAGAACTCCCTGAGGGAGG + Intronic
961344143 3:126250803-126250825 CAGGAAAAAGGCCCAGAGAAGGG - Intergenic
961751922 3:129101622-129101644 CAGGACAAAGGCTCAGAGGCAGG + Intronic
962450989 3:135516835-135516857 TAGGATACACTCTCAGAGCAAGG + Intergenic
962582036 3:136806779-136806801 CAGGAGAAAGTCTCACAGGGTGG + Intergenic
963502521 3:146146347-146146369 CAGGAATACATCTTAGAGGAGGG - Intronic
965028587 3:163334269-163334291 CAGCAAAAATTCTCATAGGATGG + Intergenic
966159829 3:176955934-176955956 CAGGAAAAGCTTTCAGTGAATGG + Intergenic
966387586 3:179417058-179417080 AAGTAAAAACTGTCAGAAGAGGG + Intronic
966876155 3:184323048-184323070 CAGGAAAAGGTCTCAGAAGCAGG - Intronic
967045828 3:185736039-185736061 AAGAAAAAACTCTGAGAGGGAGG - Intronic
968082437 3:195855866-195855888 CGGGAAACACTCTGAGAGGGAGG + Intergenic
968242142 3:197099788-197099810 GAGAAACAATTCTCAGAGGATGG + Intronic
970712275 4:18877121-18877143 CAGAAGAAACTGTCAGAGGCAGG - Intergenic
971215555 4:24659105-24659127 AAGGAAAAACTATCACAGCATGG - Intergenic
971375898 4:26055685-26055707 CTGGAAAAGCTCCCAGAGCAAGG - Intergenic
973033511 4:45374621-45374643 AATGAAACAGTCTCAGAGGATGG + Intergenic
973965360 4:56156317-56156339 CAGCAAAGCCTCTCAGAGGAAGG - Intergenic
976029250 4:80730942-80730964 CAGGAAGTCTTCTCAGAGGATGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
979388564 4:120099594-120099616 GATGAAAAATTCTCACAGGAAGG - Intergenic
984107210 4:175563328-175563350 CTGTAAAAACTCTCAGACAATGG + Intergenic
984843551 4:184090887-184090909 CAGGATGAACTCTCTGAGCAGGG - Exonic
986041028 5:3994185-3994207 CAGGAAATCCCCACAGAGGATGG + Intergenic
986140427 5:5025123-5025145 CAGGAAGACCCCTGAGAGGAAGG + Intergenic
986632007 5:9782893-9782915 CAGGAAAACCTCTCAGAATGAGG + Intergenic
987498908 5:18681076-18681098 CAGGAAACACTGTGAGAGAAAGG - Intergenic
987815144 5:22890789-22890811 CCAGAAAAACTCTCTGAGGAAGG + Intergenic
987849620 5:23333611-23333633 CAGGAAAGATTCTCAGAAGTTGG - Intergenic
989310003 5:40004713-40004735 CAGGAATAAATCTCACTGGATGG + Intergenic
990271439 5:54145588-54145610 AAAGAAACAGTCTCAGAGGATGG + Intronic
993067365 5:83115945-83115967 GAGGTAAAACTTTCAGTGGATGG + Intronic
993135822 5:83962303-83962325 CAACAAAAACTCTCAGATGAAGG - Intronic
994013948 5:94943227-94943249 CAGGAACTCCTCTCTGAGGAAGG + Intronic
995104832 5:108364748-108364770 CAGGACAAACTCACTGATGAAGG - Exonic
995190096 5:109310597-109310619 CAAGTGAAACTCTCAGAGGCAGG + Intergenic
997746996 5:136308092-136308114 CTGGAAAAACTCCCAGGAGAAGG - Intronic
998071834 5:139203795-139203817 AAGGAAAAACACTCAAAAGAAGG + Intronic
998314379 5:141168208-141168230 CAGGGAAAACTCTTAGAAGCTGG + Intergenic
1000452107 5:161402438-161402460 CAGGAATAACTCTAAAAGGAAGG + Intronic
1001487356 5:172129073-172129095 GAGGACACAGTCTCAGAGGACGG - Intronic
1001577941 5:172776926-172776948 CAGGAAAGATGCCCAGAGGAGGG + Intergenic
1001682158 5:173566207-173566229 CAGGCAAGACACTCAGAGAATGG - Intergenic
1001732326 5:173969491-173969513 CAGGAAGTCCTCTCAGAGGGAGG - Intergenic
1002254797 5:177951077-177951099 GAGGTAAAACACTCAGGGGATGG - Intergenic
1003461078 6:6328731-6328753 CAAGAAACACTTTCACAGGAAGG - Intergenic
1004299314 6:14442883-14442905 CAGGAAAGCCCCTCAGAGCAGGG - Intergenic
1004589471 6:17035064-17035086 AAGGAAGACCTCTCTGAGGAGGG - Intergenic
1006154087 6:32004813-32004835 CAGGAAAAAGAAGCAGAGGAGGG - Intergenic
1006160395 6:32037549-32037571 CAGGAAAAAGAAGCAGAGGAGGG - Intergenic
1006404614 6:33837759-33837781 CAGGCAAAAGTCTCAGGAGAGGG + Intergenic
1006802334 6:36767150-36767172 TACGAAAAACTATCAGAGGCCGG - Intronic
1007196483 6:40066008-40066030 CAGGAAAGAATGGCAGAGGAAGG - Intergenic
1007979569 6:46137491-46137513 CAGTTAAAACTCTCTGAGGGAGG + Intronic
1008555055 6:52665870-52665892 CAGGAAGAAAACTCAGAGCATGG + Intergenic
1009369095 6:62879106-62879128 AAGGAAAAAATGTCAGAGGGAGG - Intergenic
1010048995 6:71481577-71481599 CAAGAATAACTCTCAGACGTTGG - Intergenic
1010405345 6:75499057-75499079 CAGGAAATAGTCTCAGGAGAAGG - Intergenic
1012350110 6:98240034-98240056 CAGGAAGTCCTCTTAGAGGAGGG - Intergenic
1014217771 6:118768964-118768986 CAGTGGAAACTTTCAGAGGAAGG + Intergenic
1014618941 6:123641593-123641615 CAGGAAAAACTTTAAGAGAAAGG + Intergenic
1015006408 6:128286997-128287019 CAGGTAAAACTTTAAGAGGCAGG - Intronic
1015462323 6:133505591-133505613 CAGGAAGAGCTGGCAGAGGATGG - Intronic
1015717054 6:136203851-136203873 CAGGAAGCCCTCCCAGAGGAAGG + Intergenic
1016297829 6:142594491-142594513 CAGGAAACTTTCTCAGGGGATGG + Intergenic
1018208614 6:161459063-161459085 CAGCAGACACTCTCTGAGGAAGG - Intronic
1019368882 7:650492-650514 CAGGAATGACTCCCAGAGGAGGG - Intronic
1019492459 7:1321759-1321781 AAGGAAAAACTCCCAAAGGAGGG + Intergenic
1019682108 7:2356078-2356100 CAGGAAAAAATCTCTGAGACAGG - Intronic
1021550751 7:21868743-21868765 CAGGAAAGTCACTCAGAAGATGG + Intronic
1021929926 7:25569966-25569988 CAGGAAAAACTCTATGAAGGAGG - Intergenic
1023766474 7:43516016-43516038 CAGGAAAGACCCTTAGAGAAGGG - Intronic
1026104152 7:67407849-67407871 CAGGAGGGACACTCAGAGGAGGG - Intergenic
1027969979 7:85066987-85067009 AGGGAAATACTCTAAGAGGATGG - Intronic
1028369861 7:90078985-90079007 CAGGAAAAACCCTGGGAGGCAGG + Intergenic
1029166877 7:98598337-98598359 CAGTAAAAATTCACATAGGAAGG - Intergenic
1029199146 7:98827138-98827160 CAGGGACAGCTCTCAGAGGCAGG - Intergenic
1029259723 7:99293583-99293605 CAGGAGAGACTCTCTGAGAAGGG - Intergenic
1029527409 7:101103505-101103527 CAGGAAAAAATCTTAGCTGAGGG - Intergenic
1029648559 7:101874463-101874485 CAGGACACACGCACAGAGGAAGG + Intronic
1029975351 7:104828374-104828396 CAGGGAAAAGCCTCACAGGATGG + Intronic
1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG + Intronic
1033029613 7:137813098-137813120 CAGGAACAACCCTAAGAGGCAGG + Intronic
1035046763 7:155972943-155972965 CAAGAAAAACTGTCAGAGAGAGG - Intergenic
1037202202 8:16269217-16269239 CAGGAGAAATTCTTAGAAGATGG - Intronic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1037835833 8:22214244-22214266 GAGGAGGAACACTCAGAGGACGG + Intergenic
1038777793 8:30546582-30546604 AAGGAAGAACTCCCAGGGGAGGG - Intronic
1039715113 8:40099814-40099836 GAGGAATTACTCTTAGAGGAAGG - Intergenic
1039864883 8:41491510-41491532 CAGGAAAATGTCTCAGAACAAGG + Intronic
1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG + Intergenic
1041688443 8:60665968-60665990 CATGAGAGGCTCTCAGAGGAAGG - Intergenic
1041928715 8:63265036-63265058 CAGGAAAAAATGACAGAGAAGGG + Intergenic
1042416375 8:68525164-68525186 TAGAAAAAATTCTAAGAGGAAGG - Intronic
1043275902 8:78392435-78392457 AGAGAAAAACTCTCAGAGAAAGG + Intergenic
1043528415 8:81122273-81122295 CAAGAAAAGCTCTCAGAGATTGG + Intergenic
1043772870 8:84226516-84226538 CAGGAGAATCACTCAGAGGCAGG - Intronic
1043784922 8:84386849-84386871 CAGGCAACATTTTCAGAGGAAGG - Intronic
1044037005 8:87318675-87318697 CCTGGAAGACTCTCAGAGGAAGG + Intronic
1044843078 8:96354654-96354676 CAGGAAGAAATCTCAGAGTGTGG - Intergenic
1045053006 8:98343670-98343692 CAAGAAAAGCACTCAGAGCAAGG + Intergenic
1045088018 8:98708509-98708531 AAGCAAAGACTATCAGAGGAGGG + Intronic
1045149290 8:99385614-99385636 CACTAAATACTCTCAGAGGGAGG - Intronic
1045436323 8:102168514-102168536 CAGGTAGTTCTCTCAGAGGAGGG + Intergenic
1047481858 8:125291150-125291172 CAGCAGAAACTTTCAGAGGTAGG + Intronic
1047595722 8:126375810-126375832 CAGCAAAAAAACTCAGAGCAAGG - Intergenic
1047709237 8:127534069-127534091 CAGGAAAAAGTCTCAGAGAATGG + Intergenic
1048918882 8:139209955-139209977 CTAGAAAATGTCTCAGAGGAAGG + Intergenic
1049759574 8:144326004-144326026 TAGGAAAGGCTCCCAGAGGAGGG - Intronic
1050330777 9:4543545-4543567 AAGGAAAAGCTTTCAGAGAATGG + Intronic
1051139889 9:13967027-13967049 CACGAAAGACTGTGAGAGGAAGG - Intergenic
1051203396 9:14657259-14657281 TAGTGAAAACTCTCAGAGGGAGG - Intronic
1052310674 9:27065270-27065292 GTGGAAAGGCTCTCAGAGGAAGG - Intergenic
1052441952 9:28509345-28509367 CAGGAATCACTGTCATAGGAAGG - Intronic
1054779027 9:69149643-69149665 CAGGAAAAACTTTCAGTGGGAGG - Intronic
1054805903 9:69395743-69395765 TAGGAAGAACTGGCAGAGGAAGG + Intergenic
1054867825 9:70020623-70020645 CTGGAAAAGCCCTCGGAGGAGGG - Intergenic
1055368522 9:75572109-75572131 CTGGATATACTTTCAGAGGAAGG - Intergenic
1055713986 9:79097479-79097501 CAGCACACACTCTCAGAGGGTGG - Intergenic
1056265948 9:84896987-84897009 CAAGAACATCTCTCAGAGCAGGG - Intronic
1056723272 9:89089622-89089644 AAGGAAATAAACTCAGAGGAGGG + Intronic
1058700196 9:107593839-107593861 CAGGAGAAAGTCTCTGAGAATGG + Intergenic
1059325975 9:113504189-113504211 CAGGGACAACCCTCAAAGGAAGG + Intronic
1060301109 9:122375147-122375169 CAGGAAAAGTTCTCCCAGGAAGG - Intronic
1060344176 9:122802374-122802396 CAGGAAGAAGTCTCAGACCAGGG + Intronic
1060577320 9:124708547-124708569 GAGGGAAAACTTCCAGAGGAAGG + Intronic
1061810174 9:133157808-133157830 CTGGAAACACTCTAAGTGGATGG - Intronic
1061913978 9:133739544-133739566 CAGGAGGACCTCTTAGAGGAGGG + Intronic
1186528906 X:10275742-10275764 CATGAAGAGCTCTCAGAGTAGGG - Intergenic
1186549182 X:10484160-10484182 CATAAGAAACTGTCAGAGGAAGG + Intronic
1186636666 X:11413090-11413112 CAGGAAAATGTCTCTGAGGGTGG - Intronic
1186877882 X:13834772-13834794 CAGGAAAGCTTCTCAGTGGAAGG + Intronic
1186999505 X:15160576-15160598 AAGGAAACACTCTAAGAGGAGGG + Intergenic
1188324110 X:28778353-28778375 CAGGGAGAACTCACAAAGGAGGG + Intronic
1188444527 X:30242588-30242610 CAGGAAAGTCTCTCAGCGCACGG + Exonic
1188525681 X:31085437-31085459 GAGTAAAACCTCTAAGAGGAAGG - Intergenic
1188852560 X:35150367-35150389 CAGGAAAAACTCTCTGTGTGTGG - Intergenic
1189012580 X:37061128-37061150 AAGGAAAAACCCTTAGAAGATGG - Intergenic
1190143831 X:47872575-47872597 CAGGAAAAATTTTCAGACAATGG + Intronic
1190498874 X:51055635-51055657 GAGGAAACACTCTGGGAGGATGG - Intergenic
1191821526 X:65314579-65314601 CAGAAAACATTCTCAGAGAAAGG + Intergenic
1191911685 X:66158329-66158351 AGGGAAAACCTCTTAGAGGAAGG + Intergenic
1193614281 X:83668688-83668710 CAGGAAATAATCTCAGAGCATGG + Intergenic
1194354680 X:92867842-92867864 CATGAAAAAGTCTCAAAGAAGGG + Intergenic
1196858243 X:120003398-120003420 TAGGAATAATACTCAGAGGATGG - Intergenic
1197402112 X:126005521-126005543 AAAAAAAAACTCTCAGGGGAAGG + Intergenic
1200663042 Y:5984873-5984895 CATGAAAAAGTCTCAAAGAAGGG + Intergenic
1201432378 Y:13916564-13916586 CAGGAAAATCTCTCACATAATGG - Intergenic
1202282885 Y:23208775-23208797 CAGGAAAAACTGCCAAGGGAAGG - Intergenic
1202360719 Y:24107352-24107374 CAGCCAAAAATCTCAGTGGATGG + Intergenic
1202434559 Y:24823160-24823182 CAGGAAAAACTGCCAAGGGAAGG - Intergenic
1202510059 Y:25562766-25562788 CAGCCAAAAATCTCAGTGGATGG - Intergenic