ID: 1031878501

View in Genome Browser
Species Human (GRCh38)
Location 7:127169097-127169119
Sequence ATGAGGAAGCTTAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1471
Summary {0: 1, 1: 2, 2: 73, 3: 468, 4: 927}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031878498_1031878501 -1 Left 1031878498 7:127169075-127169097 CCAGGAAAAAAAAAAGCTAGAAA 0: 1
1: 0
2: 19
3: 278
4: 2373
Right 1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG 0: 1
1: 2
2: 73
3: 468
4: 927

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031878501 Original CRISPR ATGAGGAAGCTTAATGAGGA AGG Intronic
901751056 1:11409010-11409032 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
901949427 1:12730268-12730290 ATGATTAAACTTAGTGAGGAAGG - Intergenic
902705414 1:18200886-18200908 ATGAGGAGGGATAATGAGGAGGG + Intronic
903097120 1:20987842-20987864 ATGACTAAACTTAGTGAGGAAGG + Intronic
903880935 1:26508718-26508740 ATAAGGAAGTTAAATGAGTAAGG + Intergenic
904665386 1:32116739-32116761 ATGATTAAGCTTAGTGAGGAAGG - Intronic
904761223 1:32805625-32805647 ATGATTAAGCTTAGTGAAGAAGG - Intronic
904776932 1:32915329-32915351 ATGATTAAGCTTACTGAGGAAGG - Intergenic
905188923 1:36217969-36217991 ATGATTAAGCTTAATGAGGAAGG + Intergenic
905545869 1:38800288-38800310 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
906321604 1:44820719-44820741 ATGAGGAGGCTTAGTGAGGCTGG + Intronic
906558824 1:46738596-46738618 ATGATTAAGCTTAGTGACGAAGG - Intergenic
907112978 1:51943497-51943519 ATAATTAAGCTTAGTGAGGAAGG + Intronic
907548137 1:55280284-55280306 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
907685089 1:56602825-56602847 ATGATTAAGCTTAGCGAGGAAGG + Intronic
907766136 1:57412358-57412380 ATGATTAAGCTTAGTGGGGAAGG + Intronic
907802496 1:57784042-57784064 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
907916833 1:58878026-58878048 ATAATAAAGCTTAATGAGGAAGG + Intergenic
907943570 1:59111711-59111733 AAGAGGAAGTTTAGTGAGCATGG + Intergenic
908221489 1:62011267-62011289 ATGATGAAACTTAGTGAGGAAGG - Intronic
908333242 1:63092926-63092948 TAGAGTAAGCTTAGTGAGGAAGG - Intergenic
908973765 1:69870541-69870563 ATAAGGGAGCTTAATATGGAGGG - Intronic
908975401 1:69891161-69891183 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
909088450 1:71195604-71195626 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
909147287 1:71952158-71952180 ATGATTAAGGTTAGTGAGGAAGG + Intronic
909336997 1:74486982-74487004 AGGAGAAAGCTTGATTAGGATGG + Intronic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
909767203 1:79371414-79371436 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
909844066 1:80368211-80368233 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
909916090 1:81321432-81321454 ATGATGAAGCTTAGTGAGAAAGG - Intronic
909964348 1:81889195-81889217 ATGATTAAGCTTAGTGAGGAAGG + Intronic
910054855 1:83021282-83021304 ATGATGAAGCTTAGTGAGAAAGG - Intergenic
910072021 1:83228096-83228118 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910076401 1:83284752-83284774 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910078440 1:83309025-83309047 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
910151519 1:84152945-84152967 ATGATTAAGCTTAGTAAGGATGG - Intronic
910200457 1:84692958-84692980 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910231726 1:84994875-84994897 GTGATTAAGCTTAGTGAGGAAGG - Intronic
910269832 1:85382074-85382096 ATTATGAAGCTTAGTGAGGAAGG + Intronic
910298403 1:85676496-85676518 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910640091 1:89451036-89451058 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
910718663 1:90260244-90260266 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
910918199 1:92314209-92314231 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911199097 1:95026307-95026329 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911296628 1:96125347-96125369 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
911503115 1:98713590-98713612 ATGATTAAACTTAGTGAGGAAGG - Intronic
911591394 1:99752290-99752312 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911649627 1:100373107-100373129 ATGATTAAGCTTAGTGAAGAAGG - Intronic
911868406 1:103058526-103058548 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911990526 1:104691460-104691482 ATAAAGAAATTTAATGAGGATGG + Intergenic
912032772 1:105270414-105270436 ATGAGTAAGCTTAGAAAGGAAGG + Intergenic
912307194 1:108580444-108580466 ATGATTAAGCTTAGTGAGGAAGG + Intronic
912874002 1:113337254-113337276 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
912902496 1:113667720-113667742 TTGATTAAGCTTAGTGAGGAAGG - Intronic
912954142 1:114141161-114141183 ATAATGAAGCTTAGTGAGGATGG + Intronic
913034626 1:114951754-114951776 ATGAGGAATCTTTATGGAGATGG - Intronic
913207322 1:116552062-116552084 ATGATTAAGCTTAGTGAGGAAGG - Intronic
913308019 1:117452329-117452351 ATAATTAAGCTTAGTGAGGAAGG + Intronic
913435606 1:118844538-118844560 ATGAAGGAGCTAAATGATGATGG - Intergenic
914436187 1:147661640-147661662 ATGATTAAGCTTAGTAAGGAAGG + Intronic
914744379 1:150490809-150490831 ATGAGGAAGCTGGAGGAGAAGGG + Intronic
914774559 1:150724610-150724632 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
916553119 1:165868901-165868923 ATAATTAAGCTTAGTGAGGAAGG - Intronic
916566681 1:165985065-165985087 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
916799875 1:168206899-168206921 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
916919327 1:169446472-169446494 TTTAGGAAGCTAAATGAAGAAGG - Intronic
916948092 1:169749528-169749550 ATGATGAAGCTTAGTGAAAAAGG - Intronic
917115375 1:171597910-171597932 ATGATTAAGCTTAATGAGGAAGG + Intergenic
917192322 1:172431171-172431193 ATGATTAAGCTTAGTGAAGAAGG + Intronic
917238949 1:172926266-172926288 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
917362366 1:174190789-174190811 ATGATTAAGCTTACTGAGGAAGG - Intronic
917766162 1:178219736-178219758 ATGATTAAGCTTAGTGAGGAAGG - Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
917950909 1:180034915-180034937 ATGATTAAGCTTAGTGACGAAGG + Intronic
917993542 1:180409868-180409890 ATGATTAAGCTTAGTGAGGAAGG + Intronic
918029517 1:180791013-180791035 AGGAGGAAACTAAAAGAGGAGGG + Intronic
918130682 1:181625844-181625866 ATGATTAAGCTTAGTGAGGAAGG - Intronic
918411582 1:184263983-184264005 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
918606147 1:186428652-186428674 ATGATTAAGCTAAATGAGGAAGG - Intergenic
919113317 1:193247530-193247552 ATGATTAAGCTTAGTAAGGAAGG + Intronic
919185005 1:194134498-194134520 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
919335684 1:196229579-196229601 ATGATTATGCTTAGTGAGGAAGG + Intronic
919436067 1:197562722-197562744 ATGATGAAGCTTGTTGAGGAAGG + Intronic
919448816 1:197745294-197745316 GTGATAAAGCTTAGTGAGGAAGG - Intronic
919487863 1:198166457-198166479 ATGATTAAGCTTAGTGAGAAAGG - Intronic
919501239 1:198340765-198340787 AACAGGAATCTTAATGAGGTTGG + Intergenic
920024332 1:202982169-202982191 ATGATGAAGCTTAGCAAGGACGG - Intergenic
920538324 1:206756520-206756542 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921091029 1:211843270-211843292 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
921141901 1:212316177-212316199 ATGATTAAGCTTAGTGAGGAAGG + Intronic
921204167 1:212833911-212833933 ATGATTAAGCTTAGTGAGGAAGG - Intronic
921276182 1:213523011-213523033 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
921282021 1:213576776-213576798 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921303944 1:213777253-213777275 ATGATTAAGCTTAGTGGGGAAGG - Intergenic
921307945 1:213815868-213815890 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921308238 1:213818242-213818264 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
921398735 1:214696441-214696463 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921402611 1:214742897-214742919 ATGACTAAGCTTAATGAGGAAGG - Intergenic
921492583 1:215796732-215796754 ATGATTAAGCTTATTGAGGAAGG + Intronic
921537981 1:216375754-216375776 ATGAGTAAGCTTAGTGAGGAAGG - Intronic
921571736 1:216787698-216787720 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
921609796 1:217197913-217197935 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
921828868 1:219704460-219704482 ATGATTAAGTTTAGTGAGGAAGG + Intronic
922032482 1:221815019-221815041 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
922065582 1:222136307-222136329 ATGATTAAACTTAGTGAGGAAGG - Intergenic
922333165 1:224595617-224595639 ATGATTTAGCTTAGTGAGGAAGG + Intronic
922349323 1:224722754-224722776 ATGAGGAAGCTTAAAGAAATGGG + Intronic
922389533 1:225125828-225125850 ATGATTAAGCTTAATAAGGAAGG - Intronic
922588659 1:226755367-226755389 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
922624164 1:227020833-227020855 ATGATTAAACTTAATGAGGAAGG - Intronic
922727948 1:227933562-227933584 ATGATTAAGATTAGTGAGGAAGG - Intronic
922823387 1:228500585-228500607 ATGATCAATCTTAGTGAGGAAGG - Intergenic
922959213 1:229631478-229631500 ATAATTAAGCTTAGTGAGGAAGG - Intronic
923014678 1:230117425-230117447 ATGATTAAGCTTAGTGAGGAAGG - Intronic
923192520 1:231633515-231633537 ATGTGGAAGCCCAATGAGCAGGG - Intronic
923371995 1:233323868-233323890 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
923763175 1:236866575-236866597 ATGATTAAGTTTAGTGAGGAAGG + Intronic
923898293 1:238297159-238297181 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
923936449 1:238765587-238765609 ATGATGAAGCTTAGTGAAGAAGG - Intergenic
924080590 1:240393614-240393636 ATGGTTAACCTTAATGAGGAAGG + Intronic
924499838 1:244627000-244627022 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062777214 10:162013-162035 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062879666 10:967733-967755 GTGAGGAAGCTTAATGAAGATGG - Intergenic
1062893898 10:1088342-1088364 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062988179 10:1789659-1789681 ATGAGGGAGCTAAATGACCATGG - Intergenic
1062995635 10:1863732-1863754 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1063337616 10:5231592-5231614 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1063788565 10:9412977-9412999 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1065064818 10:21950584-21950606 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1065699982 10:28415485-28415507 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1066043377 10:31575773-31575795 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1066266903 10:33784815-33784837 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066478959 10:35776883-35776905 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1067119744 10:43464074-43464096 ATACTTAAGCTTAATGAGGAAGG + Intronic
1067186682 10:44035108-44035130 ATGACTAAGCTTAGTGAAGAAGG - Intergenic
1067548145 10:47211355-47211377 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1068127105 10:52853919-52853941 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1068220279 10:54035756-54035778 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1068248297 10:54402942-54402964 ATTATTGAGCTTAATGAGGAAGG + Intronic
1068748730 10:60566374-60566396 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1068870112 10:61934443-61934465 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1068940890 10:62680019-62680041 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1069016486 10:63434959-63434981 ATGAGGAAGTGTTGTGAGGAGGG - Intronic
1069304008 10:66945691-66945713 ATGATAAAGCTTAATGAGGAAGG - Intronic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1069947177 10:71995522-71995544 ATGATGGAGCTTAGTGAGGCAGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070412577 10:76156489-76156511 ATCAGGCTGCTTAAGGAGGAAGG - Intronic
1070420780 10:76235042-76235064 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1070984384 10:80675609-80675631 ATGATTAAGCTTAGTAAGGAGGG + Intergenic
1071132726 10:82414135-82414157 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1071381559 10:85068304-85068326 ATAAGTAAGATTAGTGAGGAAGG + Intergenic
1071662990 10:87524593-87524615 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1071683324 10:87729671-87729693 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1071851634 10:89577597-89577619 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1071871819 10:89803882-89803904 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1071879942 10:89886117-89886139 AACAGGAAGCTTACTGAGGAAGG + Intergenic
1071971195 10:90908837-90908859 ATGATTAAGCTTATTGAGAAAGG + Intergenic
1072094779 10:92167350-92167372 ATGATTAAGCTTAATGAAGAAGG - Intronic
1072166681 10:92820301-92820323 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1072220100 10:93319470-93319492 ATGTGGAAGTTTGATAAGGAAGG + Intronic
1072325736 10:94296833-94296855 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1072344468 10:94489620-94489642 ATGAGTAAGCTTAATGAGGAAGG - Intronic
1072601024 10:96929724-96929746 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1072836305 10:98717441-98717463 ACGATTAAGCTTAATGAGGAAGG - Intronic
1072889651 10:99311761-99311783 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1072912665 10:99517842-99517864 AGGACTAAGCTTAGTGAGGAAGG - Intergenic
1073193503 10:101669192-101669214 AAGAGGATCCTAAATGAGGAGGG + Intronic
1073681511 10:105709228-105709250 ATGATTAAGCTTAGTGAGCAAGG + Intergenic
1073696305 10:105872918-105872940 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1073932676 10:108594246-108594268 ATGTGGAAGCATAATGAAGCAGG - Intergenic
1074090918 10:110254520-110254542 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1074210714 10:111331679-111331701 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074607248 10:114985531-114985553 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1074649848 10:115508424-115508446 GTGATTAAGCTTAGTGAGGAGGG + Intronic
1074691476 10:116008866-116008888 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074905253 10:117856686-117856708 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1075034716 10:119054798-119054820 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1075178940 10:120192356-120192378 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1075381024 10:122018842-122018864 TGGAGGAAGCTAGATGAGGAGGG - Intronic
1075490750 10:122866905-122866927 ATGATTAAGCTTAGTGAGTAAGG + Intronic
1075596523 10:123734270-123734292 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1075751218 10:124773073-124773095 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1076513453 10:131028669-131028691 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1076666993 10:132098883-132098905 CTGAGGAGGCTTACTGAGTATGG - Intergenic
1076670972 10:132120979-132121001 GAGAGGCAGCTTCATGAGGATGG + Intronic
1076788159 10:132761534-132761556 ACGAGGAAGCTTGCTGAGGATGG + Intronic
1078193648 11:9115752-9115774 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1078398931 11:11006912-11006934 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1079132905 11:17759515-17759537 ATGATTACGCTTAGTGAGGAAGG - Intronic
1080550379 11:33369267-33369289 CTGAGGCAGCACAATGAGGATGG - Intergenic
1080842311 11:35996142-35996164 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
1081094142 11:38910996-38911018 GTGATTAAGCTTAATGAGAAAGG + Intergenic
1081212013 11:40347527-40347549 ATGACTAAGCTTAGTAAGGAAGG - Intronic
1081256448 11:40902518-40902540 ATGATAAAGTTTAAAGAGGATGG + Intronic
1081410395 11:42750923-42750945 CTAATGAAGCTTAGTGAGGAAGG + Intergenic
1081485721 11:43526647-43526669 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1082131640 11:48497010-48497032 CTGAAGAATCTTAGTGAGGAAGG + Intergenic
1082200019 11:49355223-49355245 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082230026 11:49752372-49752394 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1082232853 11:49790220-49790242 ATGATTATACTTAATGAGGAAGG - Intergenic
1082761827 11:57134650-57134672 ATGATTAAGCTTAGTGAGCAAGG - Intergenic
1082923062 11:58516864-58516886 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083040116 11:59677723-59677745 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1083071436 11:59987382-59987404 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1083976064 11:66121452-66121474 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1084056651 11:66638324-66638346 ATGTGGAAGCTTAACGAAGTTGG + Intronic
1084369246 11:68728152-68728174 AAGATTAAGCTTAGTGAGGAAGG + Intronic
1084668189 11:70588324-70588346 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1085367159 11:75959760-75959782 ATGACAAAGCTTACTGAGGAAGG - Intronic
1085441187 11:76564395-76564417 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1085633266 11:78137502-78137524 ATGATTGAGCTTGATGAGGAAGG - Intronic
1085858152 11:80199122-80199144 ATGATTATGCTTACTGAGGAAGG + Intergenic
1085882691 11:80486424-80486446 GAGAGGAAGCATAATGAAGATGG + Intergenic
1086034530 11:82400685-82400707 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086121633 11:83310830-83310852 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086134097 11:83429688-83429710 CTGAGGAAGCTAAGAGAGGAAGG + Intergenic
1086187156 11:84032201-84032223 ATGATTATGCTTAGTGAGGAAGG + Intronic
1086273353 11:85094879-85094901 ATGATTAAACTTAGTGAGGAAGG - Intronic
1086323553 11:85675261-85675283 ATGATTAAACTTAGTGAGGATGG - Intronic
1086560783 11:88166503-88166525 ATGAGCAAGCTTGATCTGGAAGG - Intronic
1086617775 11:88843665-88843687 ATGATTATACTTAATGAGGAAGG + Intronic
1086620032 11:88876577-88876599 ATGATTAAGCTTAATGAGGAAGG - Intronic
1086646959 11:89234512-89234534 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1086778343 11:90868962-90868984 ATGATAAAGCTTACTGAAGAGGG + Intergenic
1086896949 11:92324307-92324329 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1087156034 11:94904888-94904910 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1087651029 11:100867778-100867800 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1087665651 11:101044600-101044622 ATGATTAAGCTTAATTAGGAAGG - Intronic
1088389462 11:109298215-109298237 ATCAGTAAGTTTAGTGAGGAAGG - Intergenic
1088439679 11:109855932-109855954 ATGATTAAGCTTAGTGAGAACGG - Intergenic
1088662072 11:112057358-112057380 ATGATTAAGCTCAATGAGTAAGG + Intronic
1089415271 11:118283916-118283938 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
1089823736 11:121252545-121252567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090051645 11:123385321-123385343 ATGAGGATGATTGATTAGGAGGG - Intergenic
1090260903 11:125319081-125319103 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1090738041 11:129629468-129629490 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1090813157 11:130265507-130265529 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1090990576 11:131813599-131813621 ATGAGGAGGCTTAAAGAGTTTGG + Intronic
1091515568 12:1177332-1177354 AAGATTAAGCTTAGTGAGGAAGG - Intronic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1092622937 12:10293302-10293324 ATGAATAAGCTTAGTGAGGAAGG - Intergenic
1092900921 12:13058689-13058711 ATGTGGAAGCTTTCTGATGAGGG - Intronic
1093252560 12:16825311-16825333 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
1093427557 12:19045529-19045551 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1093450935 12:19312873-19312895 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1093575176 12:20719422-20719444 AAGATTAGGCTTAATGAGGAAGG + Intronic
1093617170 12:21240321-21240343 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1093653694 12:21672964-21672986 ATGAGGAAGGTTAAGAAAGATGG - Intronic
1094112507 12:26876543-26876565 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1094273699 12:28645491-28645513 AAGAGGATGCTTCAGGAGGAAGG - Intergenic
1094280096 12:28727412-28727434 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1094632655 12:32192012-32192034 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1094637047 12:32236626-32236648 ATGATTATGCTTAGTGAGGAAGG + Intronic
1095233370 12:39768460-39768482 ATAATTGAGCTTAATGAGGAAGG - Intronic
1095284743 12:40395553-40395575 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095308420 12:40664848-40664870 AGGATTAAGCTTAGTGAGGAAGG + Intergenic
1095435508 12:42183341-42183363 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1095518404 12:43033149-43033171 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095605972 12:44068375-44068397 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1095688108 12:45058740-45058762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095729051 12:45485691-45485713 ATCACTAAGCTTAGTGAGGAAGG + Intergenic
1095732273 12:45519053-45519075 ATGAGGAAGAGCAATGTGGAAGG - Intergenic
1095754577 12:45750090-45750112 ATGATTACGCTTAATGAGGAAGG - Intronic
1095936801 12:47692777-47692799 ATGATTAAACTTAGTGAGGACGG - Intronic
1096013268 12:48241985-48242007 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1096440344 12:51637345-51637367 ATGATTAAACTTAGTGAGGAAGG + Intronic
1096672818 12:53210496-53210518 GTGAGGGAGCTGAGTGAGGAGGG - Intergenic
1096990401 12:55797081-55797103 ATGAGGGACCTTAATGAGACTGG - Intronic
1097123651 12:56755417-56755439 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1097672018 12:62551209-62551231 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1097936419 12:65257144-65257166 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1097954745 12:65472122-65472144 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1098075184 12:66722204-66722226 ATGATTAAGCTTATTGAGGAAGG - Intronic
1098206639 12:68117837-68117859 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1098563741 12:71907515-71907537 ATGATGAAAATAAATGAGGATGG + Intronic
1098577875 12:72064504-72064526 ATGATTAAACTTACTGAGGAAGG + Intronic
1098721772 12:73909205-73909227 ATGAGGAAGCTTTAGGAACAAGG - Intergenic
1098752066 12:74306199-74306221 ATGATTAATCTTAGTGAGGAAGG - Intergenic
1098800675 12:74953434-74953456 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1098921761 12:76309032-76309054 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1098936739 12:76488862-76488884 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1099162019 12:79253660-79253682 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1099503106 12:83437880-83437902 ATGATTAAGCTTATTGAAGAAGG - Intergenic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1099609114 12:84843723-84843745 ATGATTAAGCTTATTGAGGAAGG + Intergenic
1099938065 12:89151790-89151812 ATGACTAAGCTTAGTTAGGAAGG + Intergenic
1100076724 12:90794107-90794129 ATGAGCCAGCTTAAATAGGAAGG - Intergenic
1100117480 12:91325004-91325026 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1100204640 12:92334942-92334964 ATGAGGAAGATTAGGGAAGATGG + Intergenic
1100257005 12:92894386-92894408 ATGATTAAGCTTAATGAGGAAGG + Intronic
1100468287 12:94868270-94868292 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1100516422 12:95332636-95332658 ATGATTAAGCTTAGTGAGAAGGG - Intergenic
1100695616 12:97089572-97089594 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1100868033 12:98878500-98878522 GTGAGGAAGCTTCTTGAGGTCGG + Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1101934888 12:109049215-109049237 ATGATTAAGCTCAGTGAGGAAGG - Intronic
1102654059 12:114465393-114465415 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1104165155 12:126221162-126221184 ATGATTTAGCTTACTGAGGAAGG + Intergenic
1104395742 12:128431012-128431034 ATGATGAAGCTTCATGAGGAAGG + Intronic
1104520641 12:129471637-129471659 ATGATTAACCTTCATGAGGAAGG + Intronic
1104534049 12:129601517-129601539 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1105325033 13:19363110-19363132 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1105547644 13:21362782-21362804 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1105746995 13:23386713-23386735 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1105780077 13:23697912-23697934 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1105833549 13:24187927-24187949 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1106149255 13:27082619-27082641 ATGATTAAGCTTAATGAATAGGG - Intronic
1106987696 13:35374086-35374108 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1107143722 13:37034209-37034231 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1107287288 13:38808438-38808460 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1107459078 13:40583915-40583937 ATGATTCAGCTTAGTGAGGAAGG - Intronic
1107717103 13:43211095-43211117 ATCAGGAGGATTAAAGAGGATGG + Intergenic
1107813034 13:44218509-44218531 ATGAGAAATGTTAATGAGAAGGG - Intergenic
1108010334 13:46000792-46000814 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1108181372 13:47843163-47843185 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1108274439 13:48793233-48793255 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1108278059 13:48831468-48831490 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1108602029 13:52003205-52003227 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108770635 13:53696384-53696406 ATGATTAAGCTTAATGAAGATGG + Intergenic
1108909245 13:55522368-55522390 ATGATTAAGCTTAGTCAGGAAGG - Intergenic
1109177949 13:59178496-59178518 CTGAGGAAGCCTAAAGAAGAAGG + Intergenic
1109254684 13:60064804-60064826 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1109265840 13:60199357-60199379 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109350491 13:61174310-61174332 ATGACTAAGCTTAATGGGGAAGG + Intergenic
1109515465 13:63438202-63438224 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1109815616 13:67579313-67579335 ATGATTAAGTTTAGTGAGGATGG - Intergenic
1109853567 13:68100884-68100906 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109953297 13:69531109-69531131 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1110082140 13:71327731-71327753 GTGAGGAAGCTTAATGAAGAAGG - Intergenic
1110240935 13:73265899-73265921 ATATGGAAGCTTAATGATTATGG + Intergenic
1110316373 13:74112818-74112840 ATGAGTAAGTTTAATGAGGGAGG + Intronic
1110379003 13:74828051-74828073 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1110382496 13:74869884-74869906 TTGATTAAGCTTAGTGAGGAAGG - Intergenic
1110411646 13:75210308-75210330 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1110447263 13:75599844-75599866 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1110735535 13:78931771-78931793 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110841477 13:80148455-80148477 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110849199 13:80224648-80224670 ATGAGGAAGTTGGAGGAGGAGGG + Intergenic
1111220173 13:85194593-85194615 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1111366028 13:87246100-87246122 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1111384424 13:87505538-87505560 ATGATTAAGCTTACTGAGGTAGG - Intergenic
1111571714 13:90096586-90096608 ATGATTAAACTTAGTGAGGATGG - Intergenic
1111575792 13:90152975-90152997 ATGATTGAGCTTAATGAGGAAGG - Intergenic
1111787385 13:92806524-92806546 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1111839959 13:93437326-93437348 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1111886293 13:94025962-94025984 ATGAGGTAGGTTAATGAGGATGG + Intronic
1112208806 13:97352299-97352321 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1112521162 13:100096560-100096582 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1112623064 13:101071820-101071842 ATGATTAAGCTTATGGAGGAAGG - Intronic
1112728824 13:102336132-102336154 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112997837 13:105596221-105596243 ATGAGAAATCTAAATGAGAAAGG + Intergenic
1113320865 13:109230711-109230733 ATGAGTCAGCTTCATGGGGATGG - Intergenic
1113487013 13:110661654-110661676 ATGCTTAAGCTTAATGAGGAGGG - Intronic
1114223750 14:20720036-20720058 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1114424444 14:22610546-22610568 ATGAGTGTGCTTAATGAGGCTGG + Intronic
1114585470 14:23808895-23808917 ATGAGTAAGCTTAGTAAGGAAGG + Intergenic
1114943317 14:27644327-27644349 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
1114977298 14:28117900-28117922 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1115308251 14:31953967-31953989 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1115419077 14:33171822-33171844 ACGATGAAGCTTAGTGAGAAAGG - Intronic
1115468579 14:33744172-33744194 ATGATGAAGCTTAGTGAATAAGG - Intronic
1115709550 14:36035803-36035825 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1115710629 14:36046933-36046955 ATGGGGAAGCATAATTGGGAGGG - Intergenic
1115953546 14:38749255-38749277 AAGAACAAGCTTAATCAGGATGG + Intergenic
1116016528 14:39414548-39414570 ATGATTAAGCTTCATAAGGAAGG - Intronic
1116091678 14:40315712-40315734 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1116141688 14:41004135-41004157 ATGATTAAGCTTACTGAAGAAGG + Intergenic
1116562157 14:46394136-46394158 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1116592345 14:46794213-46794235 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1116924907 14:50624656-50624678 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1117201706 14:53396423-53396445 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117231259 14:53721207-53721229 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117269596 14:54128628-54128650 ATGATTAAGCTTAGTGATGAAGG + Intergenic
1117401439 14:55362062-55362084 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1117519558 14:56537236-56537258 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117586956 14:57217741-57217763 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117926770 14:60789041-60789063 ATGACCAAGCTTCCTGAGGAGGG - Intronic
1118125018 14:62892079-62892101 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1118507733 14:66432568-66432590 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1118518089 14:66548748-66548770 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1118553147 14:66979783-66979805 ATGACTAAGTTTAGTGAGGAAGG - Intronic
1118560446 14:67074622-67074644 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118692985 14:68357868-68357890 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1118959927 14:70519778-70519800 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1119017268 14:71071772-71071794 ATAAGGAAGCTTAGTGAGGAAGG - Intronic
1119170583 14:72532523-72532545 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1119736309 14:76984942-76984964 AGGAGGAAGCTGATGGAGGAGGG - Intergenic
1119883358 14:78119784-78119806 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1120049167 14:79845384-79845406 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1120058658 14:79955444-79955466 ATGATGAAGCTTAGTGTGGCTGG - Intergenic
1120175009 14:81284252-81284274 ATGAGTAAGCTTAGTGAACAAGG + Intronic
1120264708 14:82234140-82234162 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1120318633 14:82930407-82930429 ATGATTAATCTTATTGAGGAAGG - Intergenic
1120430663 14:84410344-84410366 AAGATTAAGCTTACTGAGGAAGG + Intergenic
1120544139 14:85789491-85789513 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1120880482 14:89412109-89412131 ATGAGGCAGCTGAAGGAGTAGGG + Exonic
1121018673 14:90565370-90565392 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1121051036 14:90819063-90819085 ATAAGGTGGCTTCATGAGGACGG + Intergenic
1121296261 14:92827646-92827668 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1121461480 14:94081975-94081997 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1121705082 14:95986538-95986560 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1121959844 14:98249131-98249153 TTGGGGAAGCTTTATTAGGAAGG + Intergenic
1121994930 14:98594294-98594316 AGGAGAAAGCTCCATGAGGAGGG + Intergenic
1122001392 14:98658244-98658266 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1122054528 14:99084537-99084559 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122522735 14:102357054-102357076 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1122590622 14:102847619-102847641 ATATGGAAGCTTGATCAGGAAGG - Intronic
1122675157 14:103406531-103406553 TTGAGAAAGCTTAATTAGGCTGG - Intronic
1122675184 14:103406762-103406784 TTGAGAAAGCTTAATTAGGCTGG - Intronic
1123027022 14:105430162-105430184 ATGACTAAGCTTAGTTAGGAAGG - Intronic
1123964799 15:25444207-25444229 ATGAGGAAACTAAATCAGAAAGG - Intergenic
1124093358 15:26626431-26626453 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1124100057 15:26684546-26684568 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1124397177 15:29312853-29312875 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1124670795 15:31636595-31636617 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1124901608 15:33828385-33828407 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1125000543 15:34765506-34765528 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1125252753 15:37724725-37724747 ATGAGGAGGCTTAGTAAGGAAGG - Intergenic
1125651986 15:41324834-41324856 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1125875370 15:43139459-43139481 ATGATGAAGCTTGGTGAGGAAGG + Intronic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1126096481 15:45094388-45094410 AGGAGGAGGCTTAACGTGGAGGG + Intronic
1126240363 15:46435189-46435211 ACGATGAAGCTTAGTGAAGAAGG + Intergenic
1126391713 15:48163010-48163032 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1126828277 15:52572621-52572643 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
1127206206 15:56721935-56721957 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1127447109 15:59074821-59074843 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1127705195 15:61539962-61539984 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1127948605 15:63781723-63781745 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1128173920 15:65536840-65536862 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1128189932 15:65682698-65682720 ATGATTAAGCTTAATGAGGAAGG - Intronic
1128207796 15:65868665-65868687 TTGATGAATCTTGATGAGGAGGG + Intronic
1128629337 15:69247620-69247642 ATGATTAAGCTCAGTGAGGAGGG - Intronic
1129126423 15:73445539-73445561 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1129289797 15:74556110-74556132 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1129499314 15:76020322-76020344 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1129575424 15:76738365-76738387 ATGATAATGCTTATTGAGGAAGG - Intronic
1129948835 15:79567554-79567576 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1130145472 15:81270796-81270818 ATGAGTAATCTTTATGAGGCCGG + Intronic
1130199423 15:81811153-81811175 ATAAGGTAGCTGATTGAGGAAGG + Intergenic
1130408132 15:83621279-83621301 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
1130443017 15:83974164-83974186 CTGAGAAAGCTTACTGGGGAAGG - Intronic
1131169655 15:90168541-90168563 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131756558 15:95569909-95569931 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1131974142 15:97925844-97925866 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1132032394 15:98449413-98449435 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1132420970 15:101668193-101668215 ATGATTAAGCTTGGTGAGGAAGG - Intronic
1132797963 16:1734538-1734560 ATGAGCCAGCTAAAGGAGGAAGG + Intronic
1133093018 16:3419736-3419758 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1134221800 16:12360779-12360801 AAGAGGAAGCATATTTAGGAAGG + Intronic
1134272967 16:12750301-12750323 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1135506615 16:23043041-23043063 ATGAGTAAGCCTAGTGAGGGAGG - Intergenic
1135766385 16:25180939-25180961 ATGATTAAGCTTGGTGAGGAAGG + Intergenic
1135939718 16:26810482-26810504 ATGAGGAGGCATAAGGGGGATGG + Intergenic
1136118959 16:28116527-28116549 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1137416181 16:48282846-48282868 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1137740400 16:50765578-50765600 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138073028 16:54012041-54012063 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138255456 16:55554731-55554753 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1140157061 16:72441480-72441502 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1140162612 16:72513647-72513669 ATGATTAACCTTAATGAGGAAGG - Intergenic
1140398983 16:74654641-74654663 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1140574659 16:76152573-76152595 ATGATTAAGCTTAGTGAGGACGG - Intergenic
1140955914 16:79865142-79865164 ATGGGCAAGTTTAATGCGGAAGG - Intergenic
1141304487 16:82848835-82848857 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1142918980 17:3167885-3167907 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1143360300 17:6363971-6363993 ATGAGAAAGCTTCATCAGGGAGG - Intergenic
1144165655 17:12607898-12607920 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1144265689 17:13566516-13566538 ATGATTAAACTTAGTGAGGAAGG + Intronic
1144324489 17:14165677-14165699 ATGATTAAGCTTAATGAGGAAGG + Intronic
1144530780 17:16036978-16037000 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1144706858 17:17374356-17374378 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1145277706 17:21444381-21444403 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145315541 17:21730259-21730281 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1145713972 17:27002197-27002219 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145726879 17:27137398-27137420 ATGATTGAGCTTAATGAGGAAGG + Intergenic
1145905147 17:28512140-28512162 TGGAGGAAGCTTGTTGAGGAGGG + Intronic
1146115483 17:30133982-30134004 ATGATTAAGCTGATTGAGGAAGG - Intronic
1146578766 17:34017502-34017524 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1146678978 17:34793438-34793460 GGGAGGAATCTCAATGAGGAAGG + Intergenic
1147372120 17:39999625-39999647 ATGATTATGCTTAGTGAGGAAGG + Intergenic
1147627835 17:41911184-41911206 CTGAGGAAGCCCAATGAGGGAGG + Intronic
1147856174 17:43482125-43482147 AAGAGGAAGCGAAATGGGGAGGG + Intergenic
1148997092 17:51720157-51720179 AGGAGGAATCTTAAGTAGGATGG + Intronic
1149299429 17:55290739-55290761 ATGAGTAAGCTTAATTTTGAAGG + Intronic
1150031581 17:61742458-61742480 ATGATTAAGCTTAGTGAGCAAGG - Intronic
1150179845 17:63106429-63106451 AAGAGGAAGCTTCAAGAGTAAGG + Intronic
1151410776 17:73926780-73926802 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152194197 17:78907009-78907031 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1152402232 17:80074014-80074036 ATGATTAAGCTTCATGAGGAAGG + Intronic
1152434437 17:80266838-80266860 ATGATTAAGCTTCTTGAGGAAGG + Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1152907767 17:82978259-82978281 ATTAGGAAGCAAACTGAGGAAGG - Intronic
1152981462 18:281585-281607 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153270619 18:3317718-3317740 ACGATTAAGCTTACTGAGGAAGG - Intergenic
1153292785 18:3518079-3518101 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1153491276 18:5650747-5650769 ATGATTAAGCATATTGAGGAAGG + Intergenic
1153569906 18:6459848-6459870 ATAATAAAGCTTAATGAAGAAGG + Intergenic
1153859682 18:9188989-9189011 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1153896346 18:9565439-9565461 ATGATTAAGCTTAGTGGGGAAGG + Intronic
1154127799 18:11708193-11708215 ATGATTAAGCTTACTGAGGAAGG - Intronic
1154249490 18:12731662-12731684 ATGATTAAGCTTATTGAGGAAGG - Intergenic
1154341665 18:13507900-13507922 ATGATTAAACTTAGTGAGGAAGG + Intronic
1154953151 18:21229517-21229539 ATGATTAAACTTACTGAGGAAGG - Intergenic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155266145 18:24095799-24095821 ATGATTAAGCTTAATGAGGAAGG - Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155582083 18:27320980-27321002 AAAAGGAAGCTTAATTAGTATGG + Intergenic
1155681126 18:28488251-28488273 ATGATTAAATTTAATGAGGAAGG + Intergenic
1155686223 18:28555143-28555165 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1155694300 18:28666329-28666351 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1155853716 18:30805408-30805430 ATGATTAAGCTTAATGAGAAAGG + Intergenic
1156320938 18:36021589-36021611 GTGATGAAGTTTAGTGAGGAAGG + Intronic
1156415058 18:36879382-36879404 GTGAGGAAGCTTTCAGAGGAAGG - Intronic
1156629195 18:38946182-38946204 ATGATGAAGCTTAGCGAGGAAGG + Intergenic
1156851978 18:41739214-41739236 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1156875950 18:42011737-42011759 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1157010225 18:43639257-43639279 ATAATGAAGCTTAGTGAGAAAGG - Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157894806 18:51455682-51455704 AAGAGGAAGGATAAAGAGGAAGG + Intergenic
1157960458 18:52148190-52148212 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1158212049 18:55062543-55062565 ATGATTAAGCTTCATGAGGAAGG - Intergenic
1158844051 18:61422088-61422110 TTCAGGGACCTTAATGAGGATGG + Intronic
1158853464 18:61518398-61518420 GTGAAGAAGCTTCAAGAGGAAGG + Intronic
1158919201 18:62170703-62170725 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159191228 18:65045497-65045519 ATGATTAAGCCTATTGAGGAAGG + Intergenic
1159374161 18:67570400-67570422 ATGAAGAAGATTAATGAGGTTGG + Intergenic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159429941 18:68338141-68338163 AAGAGGCAGATTAATGTGGAGGG - Intergenic
1159656877 18:71040433-71040455 GTGATTAAGCTTAGTGAGGAAGG + Intergenic
1159700517 18:71620935-71620957 ATGTTTAAGCTTAATGAGGAAGG - Intergenic
1160016082 18:75141755-75141777 ATGAGGAAGCTCCAGGAGGGAGG - Intergenic
1160117389 18:76093493-76093515 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1160218093 18:76951773-76951795 ATGATTAAGCTTAATGAGGAAGG - Intronic
1160320555 18:77889581-77889603 ATGACTAAGATTAGTGAGGAAGG - Intergenic
1160450505 18:78961011-78961033 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1160546470 18:79660081-79660103 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1162612751 19:11768728-11768750 AGGAAGTAGCTTATTGAGGAAGG - Intronic
1165575263 19:36810127-36810149 ACGATTAGGCTTAATGAGGAAGG + Intergenic
1165599614 19:37042814-37042836 ACGATTAGGCTTAATGAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166392255 19:42415365-42415387 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1166580164 19:43890049-43890071 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1168426820 19:56245706-56245728 TTGAGGAAACTGAATGGGGAAGG - Intronic
1168652847 19:58103774-58103796 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1202634473 1_KI270706v1_random:31956-31978 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1202651407 1_KI270707v1_random:8089-8111 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1202660717 1_KI270708v1_random:67627-67649 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
924989673 2:301832-301854 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925153024 2:1629034-1629056 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
925168568 2:1736247-1736269 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925215522 2:2092153-2092175 ATGATTAAGCTTAGTAAGGAAGG - Intronic
925343665 2:3154378-3154400 GTCAGGAAGCTTAATAAGGCAGG - Intergenic
925360062 2:3272390-3272412 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925854074 2:8112661-8112683 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925871424 2:8274831-8274853 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
925954294 2:8946963-8946985 ATGATTAAGCTTAGTGACGATGG + Intronic
926387956 2:12356475-12356497 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
926493531 2:13555426-13555448 ATGATTAAGCTTACTGAGGAAGG - Intergenic
926608410 2:14921031-14921053 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
926649441 2:15325843-15325865 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926818525 2:16826612-16826634 ATGATTAAGATTAGTGAGGAAGG - Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
926895361 2:17681457-17681479 ATGATTAAGCTTAGTGAGGAAGG - Intronic
927396413 2:22656104-22656126 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
927470782 2:23374733-23374755 ATCAGGGAATTTAATGAGGATGG + Intergenic
927640321 2:24841659-24841681 AAGAGGATGCTGCATGAGGAAGG + Exonic
927657325 2:24960486-24960508 ATGATTAAGCTTAGTGAGGAAGG + Intronic
927800270 2:26092453-26092475 GAGAGGAAACTTAGTGAGGAAGG + Intronic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928261546 2:29771940-29771962 CTCAGGAAGCTGACTGAGGAGGG + Intronic
928631240 2:33194315-33194337 ATGATTAACCTTAGTGAGGAGGG + Intronic
928657248 2:33465047-33465069 ATGATAAAGCCTAGTGAGGAAGG + Intronic
929097471 2:38277712-38277734 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
929529747 2:42741461-42741483 ATGATGAGCCTTCATGAGGAAGG - Intronic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
930471712 2:51824138-51824160 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
930492016 2:52086069-52086091 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
930559236 2:52939502-52939524 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
930948710 2:57110275-57110297 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
931013685 2:57949724-57949746 ATGATTAAGCTTAATGAGGAAGG + Intronic
931022356 2:58062438-58062460 ATAATTAAGCTTAGTGAGGAAGG + Intronic
931050713 2:58411393-58411415 ATGATTAAGATTAGTGAGGAAGG + Intergenic
931683880 2:64776324-64776346 ATGAATAAACTTAGTGAGGAAGG - Intergenic
931960981 2:67482591-67482613 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
932033339 2:68213252-68213274 ATGATGAAGCTTATTGAGGAAGG - Intronic
932469932 2:71948121-71948143 ATGATCAAGATTAGTGAGGAAGG - Intergenic
933075963 2:77927021-77927043 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933143111 2:78817915-78817937 ATGAGGAAGGATAAAGAGCATGG + Intergenic
933171010 2:79125167-79125189 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
933328380 2:80867116-80867138 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
933630131 2:84646435-84646457 ACGATTAAGCTTAGTGAGGAAGG + Intronic
933873604 2:86595532-86595554 ATGATTAAGATTAGTGAGGAAGG + Intronic
933896839 2:86818800-86818822 ATGATTAAGTTTAGTGAGGAAGG + Intronic
933906272 2:86896689-86896711 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
934061668 2:88299990-88300012 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
934548312 2:95237635-95237657 ATGATCAAGCTTAGTGAGGAAGG + Intronic
935228347 2:101074072-101074094 ATGATTAAGCTTAATGAGAAAGG - Intronic
935289090 2:101594130-101594152 ATGATGAAGCTTAGTCAGGAAGG - Intergenic
935460212 2:103322213-103322235 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
935608250 2:104992566-104992588 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
935776270 2:106475068-106475090 ATGATTAAGCTTCGTGAGGAAGG - Intergenic
935974300 2:108562320-108562342 ACAAGTAAGCTTAGTGAGGAAGG + Intronic
935990371 2:108713740-108713762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
936226267 2:110656215-110656237 TAGAGGAAGCTTGGTGAGGAGGG - Intronic
936365894 2:111854993-111855015 ATGATTAAGCTTAGTGAGGAAGG - Intronic
936409573 2:112244985-112245007 ATGATTAAGCTTAGTGAGGAAGG + Intronic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
937109973 2:119358148-119358170 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937461747 2:122094861-122094883 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
937678331 2:124616671-124616693 ATGATTAACCTTAATGAGGAAGG - Intronic
937722516 2:125119708-125119730 ATTATTAAGCTTAATGAGGTAGG + Intergenic
937767049 2:125673671-125673693 ATGATTAAACTTAGTGAGGAAGG + Intergenic
937818547 2:126281155-126281177 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
937979264 2:127604604-127604626 ATGATTAAGCTTCGTGAGGAAGG - Intronic
938022461 2:127917371-127917393 GTGATGAAGGTTAGTGAGGAAGG - Intergenic
938681961 2:133701291-133701313 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
938872002 2:135487974-135487996 ATGATCATGCTTAGTGAGGAAGG - Intronic
938945620 2:136209395-136209417 ATGAGGAAGCTGAAGGATTAGGG + Intergenic
938987215 2:136589015-136589037 ATGATTAAGCTTAATGAGGGAGG - Intergenic
939186015 2:138861590-138861612 GTGATGAAGCTTAGTGAGGAAGG - Intergenic
939285444 2:140123227-140123249 ATGATAAAGCTTAATGAGGAAGG - Intergenic
939437833 2:142201422-142201444 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939509161 2:143085324-143085346 ATGACTAACCTTAGTGAGGAAGG + Intergenic
939640215 2:144631612-144631634 ATGATTAAGCTCAATGAAGAAGG + Intergenic
939786912 2:146525972-146525994 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
940037452 2:149325760-149325782 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
940311376 2:152282505-152282527 ATGAGGTAGCTTAGTGAACAAGG + Intergenic
940495983 2:154429205-154429227 AAGATTAAGCTTAGTGAGGAAGG + Intronic
941327653 2:164136704-164136726 ATTAGAAAGGTAAATGAGGATGG + Intergenic
941371302 2:164668283-164668305 ATGATCAAGTTTAGTGAGGAAGG - Intronic
941386200 2:164855568-164855590 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
941433899 2:165444542-165444564 AAGATGAAGCTTAGTGAAGATGG + Intergenic
941503740 2:166313815-166313837 ATGATTAAGCTTAGTGAGGAAGG - Intronic
941733036 2:168940173-168940195 ATGACTAAGCTCAGTGAGGAAGG + Intronic
941974583 2:171389113-171389135 AAGATTAAGCTTAGTGAGGAAGG + Intronic
942229338 2:173845139-173845161 ATGAGGTAGCTGAACCAGGATGG - Intergenic
942258955 2:174138181-174138203 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942614861 2:177781040-177781062 ATGATTAAGCTTAGTGAGAAAGG - Intronic
942747804 2:179255251-179255273 ATGATTAAGCTTACTCAGGAAGG + Intronic
942876875 2:180811065-180811087 ATGATCATGCTTAGTGAGGAAGG + Intergenic
942999302 2:182304527-182304549 ATGATTAAGTTTAACGAGGAAGG - Intronic
943012657 2:182469699-182469721 ATGATGAAGTTTAGTGAAGAAGG - Intronic
943034503 2:182725361-182725383 ATGATTAAGCTTAGTGAGGGAGG + Intronic
943087416 2:183329390-183329412 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943123423 2:183766555-183766577 ATGACTAAGCTTAGTGAGAAAGG - Intergenic
943126494 2:183799412-183799434 AGGAATAAACTTAATGAGGAAGG - Intergenic
943213371 2:184998684-184998706 ATGACTAAGCTTAGTGAAGAAGG - Intergenic
943251687 2:185529636-185529658 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
943330888 2:186557855-186557877 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
943420828 2:187667175-187667197 ATTATCAAGCTTAGTGAGGAAGG + Intergenic
943616545 2:190099225-190099247 ATGATCAAGCTTAGTGAGGAAGG - Intronic
943740815 2:191406427-191406449 ATGATTAAGCTTAGTGAGGAAGG - Intronic
943935468 2:193909797-193909819 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943957341 2:194209081-194209103 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
944273967 2:197814613-197814635 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944529589 2:200654144-200654166 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944623147 2:201539839-201539861 ATGATTAAGCTTACTGAGGAAGG + Intronic
945143811 2:206715313-206715335 GGGAGGAATCTCAATGAGGAAGG - Intronic
945313609 2:208344939-208344961 AAGTAGAAGCTTCATGAGGAAGG - Intronic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
945690911 2:213034396-213034418 ATGATGAGGCTTAGTGAGGAAGG - Intronic
946064014 2:216970665-216970687 GTGGGGAAGCTCTATGAGGATGG - Intergenic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946645442 2:221828449-221828471 ATAACTAAGCTTAATGAGGAAGG - Intergenic
946713580 2:222530835-222530857 ATGATTAACCTTAGTGAGGAAGG - Intronic
946853169 2:223927769-223927791 ATGATTAAGCTTAGTGAGGAAGG - Intronic
947020709 2:225672651-225672673 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947245792 2:228046905-228046927 ATGTGGAATCATAATGAGGTTGG - Intronic
947786322 2:232824256-232824278 ATGATTAAGCTTAGTGAGGAAGG + Intronic
947807663 2:232979762-232979784 CTGAGGAAGCTTATTAAGGAGGG - Intronic
948418406 2:237835390-237835412 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1168877371 20:1180918-1180940 ATGAGACAGCTCAATGGGGATGG - Exonic
1169032815 20:2424756-2424778 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1169432717 20:5553494-5553516 ATGATTAAGATTAGTGAGGAAGG + Intronic
1169485212 20:6024626-6024648 ATTATTAAGCTTAGTGAGGAGGG + Intronic
1169616272 20:7449533-7449555 ATTAGTGAGCTTAGTGAGGAAGG + Intergenic
1169653903 20:7900797-7900819 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1169744618 20:8931025-8931047 ATGATTAAACTTAATGAAGAAGG - Intronic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1169923002 20:10755429-10755451 ATGAGGATGCTTAGTGGGAAAGG - Intergenic
1170174327 20:13451842-13451864 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1170397148 20:15938734-15938756 ATGTTTAAGCTTAATGAGGAAGG + Intronic
1170902150 20:20474617-20474639 TTGAGGATGGTTAATGAGGTGGG + Intronic
1172922821 20:38500650-38500672 ATGATTAAGTTTAATTAGGAAGG + Intronic
1173381433 20:42546624-42546646 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1173527012 20:43740520-43740542 ATGAGGAAGGTTAATGGGCAGGG + Intergenic
1173707350 20:45121586-45121608 ATGATTAACCTTAGTGAGGAAGG - Intergenic
1173772514 20:45674527-45674549 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1173882641 20:46428547-46428569 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1173942058 20:46919809-46919831 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1174025696 20:47572501-47572523 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1174327303 20:49789634-49789656 AAGAGGAACCATATTGAGGATGG - Intergenic
1174618452 20:51855079-51855101 ATGAGGAATCTTTATGATAATGG - Intergenic
1174650553 20:52121247-52121269 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1174673202 20:52327673-52327695 ATGATGACGCTTAGTGAGGGAGG + Intergenic
1174692522 20:52521750-52521772 ATGATGATGCTTAGTGAGGAAGG - Intergenic
1175025563 20:55898856-55898878 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1175088363 20:56480608-56480630 ATGATTAAGCTTAGGGAGGAAGG - Intronic
1175167960 20:57059433-57059455 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1175366921 20:58461904-58461926 ATGAGGAAGATAAAAGAGGGTGG - Intronic
1175649713 20:60708956-60708978 GTGACAAAGCTTAGTGAGGAAGG + Intergenic
1176646694 21:9357731-9357753 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1176946058 21:14983126-14983148 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1177413731 21:20767768-20767790 ATTATAAAGCTTAGTGAGGAAGG - Intergenic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1177826342 21:26088156-26088178 ATGAGGAGGCTTGAAGAGCAGGG + Intronic
1177869236 21:26550444-26550466 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1178070688 21:28962713-28962735 ATGATGAAGCTTAGCAAGGAAGG + Intronic
1178082989 21:29084737-29084759 ATCAGGAATCTCAATGAAGAAGG + Intronic
1178519425 21:33275741-33275763 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1178967542 21:37136279-37136301 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1179429171 21:41307543-41307565 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1179463443 21:41553695-41553717 ATGAGGCAGCTTCATGAACAAGG - Intergenic
1179965133 21:44799821-44799843 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1180113340 21:45677093-45677115 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1180328204 22:11451220-11451242 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1180366232 22:11941271-11941293 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180417622 22:12782989-12783011 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180651982 22:17385313-17385335 ATGATTAAGCTTCATGAAGAAGG - Intronic
1180900099 22:19364813-19364835 ATGATTAAGCTTAAAGAGGAAGG + Intronic
1180932563 22:19603073-19603095 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1182182135 22:28361181-28361203 ATGATTATGCTTAGTGAGGAAGG + Intronic
1182734675 22:32523750-32523772 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1183612534 22:38919871-38919893 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681468 22:39332737-39332759 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681483 22:39332876-39332898 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1184818138 22:46887910-46887932 CAGTGGAAGCTTAAGGAGGATGG + Intronic
1184930919 22:47680786-47680808 CTGAGAAAGCTTAAAGAGGAGGG + Intergenic
1185124561 22:49000693-49000715 ATGAGGAATCTTTATAATGATGG + Intergenic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1185262132 22:49873217-49873239 ATGATTAAGCTTAGTGATGAAGG - Intronic
949270206 3:2207323-2207345 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949438346 3:4053046-4053068 ATGATTAAGCTTAGTGAGGAAGG - Intronic
949728713 3:7081620-7081642 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950112679 3:10429704-10429726 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950632436 3:14291728-14291750 ATGATTAAGCTTAGTGAGGGAGG + Intergenic
950700312 3:14740147-14740169 ATGATTAACCTTAGTGAGGAAGG - Intronic
950817891 3:15726236-15726258 ATGACTAAGCTTAGTGAGAAAGG + Intronic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
950957969 3:17075101-17075123 ATAATGAAGCTTACTGAGGAAGG - Intronic
950976293 3:17249300-17249322 ATGTTGAAGCTTAGTTAGGAAGG - Intronic
950988879 3:17409495-17409517 ATGATTAAGCTTAGTGAGGAAGG + Intronic
951306643 3:21071265-21071287 ATGATTCAGCTTAATGAGGAAGG + Intergenic
951333061 3:21388394-21388416 ATGATGAAGCTTAGTAAGGAAGG + Intergenic
951373324 3:21880693-21880715 ATGATTAAGCTTAATGAAGAAGG + Intronic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951608822 3:24468436-24468458 ATGATTACACTTAATGAGGAAGG - Intronic
951851811 3:27149804-27149826 ATGATAAAGCTTAGTGAGGAAGG + Intronic
951862405 3:27267827-27267849 ATGATGAAGCTTAGTGAGAAAGG + Intronic
952119420 3:30224176-30224198 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
952365478 3:32671119-32671141 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
952635673 3:35527343-35527365 ATGATTAAACTTAATGAGGAAGG - Intergenic
952809980 3:37393243-37393265 ATGATTAAGCTTAGTGAGGAGGG + Intronic
952899916 3:38103639-38103661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
953174454 3:40537165-40537187 ATGATTAAGCTTAGTGAGGAAGG + Exonic
953367232 3:42355545-42355567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953436052 3:42878291-42878313 ATGATTAAGCTTAGTGAGGAAGG + Intronic
953438046 3:42895585-42895607 ATGAGGGGGGTTAATGAGGTTGG - Intronic
953445731 3:42964111-42964133 ATGATTAAGCTTAGTGAAGATGG + Intronic
953483987 3:43277158-43277180 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953591973 3:44266431-44266453 ATGATTAAGCTTAGTGAGGAAGG - Intronic
954137330 3:48588041-48588063 ATGAGGAAGATCAGTCAGGAGGG - Intronic
954364471 3:50138803-50138825 TTTAGGAGGCTTAATGAGGGGGG + Intergenic
954854558 3:53632597-53632619 ATGATTAAGCTTAGTGAGGGAGG - Intronic
954944616 3:54409544-54409566 GTGATTAAGCTTAGTGAGGAAGG + Intronic
955211174 3:56942652-56942674 ATGATTAAGCTTAGTGAGGAAGG + Intronic
955459738 3:59168733-59168755 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
955969825 3:64427216-64427238 ATGATTAAGCTTAGTGAAGAAGG + Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
957093575 3:75756420-75756442 ATAATTAAGCTTAGTGAGGAAGG + Intronic
957115760 3:76023347-76023369 ATGATTAAACTTAATGAAGAAGG - Intronic
957400897 3:79712178-79712200 ATGATTAAGCTTGGTGAGGAAGG + Intronic
957499712 3:81038725-81038747 AAGATTAAGCTTAGTGAGGATGG - Intergenic
957536757 3:81515620-81515642 ATGATTAAGCTTAGTGAGAAAGG + Intronic
957572920 3:81971171-81971193 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
957955733 3:87184761-87184783 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
957996735 3:87699408-87699430 AGGATGAAGCTTAGTGAGGAAGG + Intergenic
958452128 3:94286560-94286582 ATGATTAAGGTTAGTGAGGAAGG + Intergenic
958492956 3:94801472-94801494 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958530066 3:95316883-95316905 ATGATTAAGCTTAGTGAGGACGG - Intergenic
958655516 3:96997386-96997408 ATGATTAAACTTAGTGAGGAAGG - Intronic
958661631 3:97076137-97076159 ATGATTAGGCTTAATGAGGAAGG + Intronic
958933095 3:100228631-100228653 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959014333 3:101115701-101115723 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959058953 3:101598357-101598379 ATTGGGAAGCTTAAAGATGAAGG + Intergenic
959413099 3:106049298-106049320 ATGATTAAGCTTAGTGAGGATGG + Intergenic
959546360 3:107601335-107601357 ATGATTAAGCTTATTGAGGAAGG + Intronic
959721681 3:109497875-109497897 ATGATTAAGCTTACTGAGGAAGG - Intergenic
959773099 3:110123545-110123567 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
959812886 3:110639662-110639684 AAGTGGATGCTTAATGAGTATGG - Intergenic
959821140 3:110736994-110737016 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
959898511 3:111633047-111633069 ATAATTAAGCTTAGTGAGGAAGG - Intronic
959988389 3:112602412-112602434 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
960154599 3:114286038-114286060 ATGATTAAGCTTAGTGAAGAAGG - Intronic
960179829 3:114562639-114562661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960242243 3:115358744-115358766 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
960549324 3:118956401-118956423 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961411596 3:126726112-126726134 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961613164 3:128156925-128156947 ATGATTAAGCTTAGTGATGAAGG + Intronic
961712922 3:128841045-128841067 AGGAGGAAGTTTAAAGAGAAGGG + Intergenic
962028931 3:131578534-131578556 ATGATTAAACTTAGTGAGGAAGG + Intronic
962115954 3:132507889-132507911 ATGATTAACCTTGATGAGGAAGG + Intronic
962157414 3:132962803-132962825 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
963081367 3:141397555-141397577 ATGATTAAGCTTCATGAGGAAGG - Intronic
963183823 3:142390783-142390805 ATGATTAAGCTTAGTGAAGAAGG - Intronic
963198636 3:142563728-142563750 ATGATTAAGCCTACTGAGGAAGG + Intronic
963243036 3:143029690-143029712 ATGATTAAGCTTAGTTAGGAAGG + Intronic
963283952 3:143414830-143414852 ATGATTAAGCTTAGCGAGGAAGG + Intronic
963293209 3:143514985-143515007 ATGATTAAGCTTAGTGAGGAAGG - Intronic
963507379 3:146203968-146203990 ATGATTTAGCTTAATGAGGAAGG - Intronic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
963608786 3:147439144-147439166 ATGATTAAGCTTAGCGAGGAAGG - Intronic
963746736 3:149131731-149131753 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964010373 3:151885438-151885460 ATGCTCAAGCTTAATGGGGAAGG + Intergenic
964146614 3:153471704-153471726 ATGATGAAGATTAGTGAGGAAGG - Intergenic
964439951 3:156697858-156697880 ATGATTAAGCTTAGTGGGGAAGG + Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
964599142 3:158475878-158475900 GTGACTAAGCTTAGTGAGGAAGG + Intronic
964823311 3:160797512-160797534 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964862034 3:161213452-161213474 ATGAGGAATCTTTATGGTGATGG - Intronic
964930148 3:162009613-162009635 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
964942183 3:162172201-162172223 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
965224198 3:165966813-165966835 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
965255657 3:166406513-166406535 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
965276374 3:166688015-166688037 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
965424504 3:168505136-168505158 ATGATTAAGTTTAATGAGGAAGG - Intergenic
965438695 3:168685872-168685894 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
965595527 3:170406932-170406954 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
966023985 3:175252623-175252645 ATGATTAAGCTTAGTAAGGAAGG + Intronic
966070330 3:175869612-175869634 ATGACTAAGCTTAGAGAGGAAGG + Intergenic
966098198 3:176231687-176231709 ATGATTACGCTTATTGAGGAAGG - Intergenic
966106114 3:176335930-176335952 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
966116309 3:176467477-176467499 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
966214310 3:177486262-177486284 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
966282562 3:178249629-178249651 ATGATTACGCTTAGTGAGGAAGG - Intergenic
966299807 3:178465393-178465415 ATGAGGAAACATAATTAGAAAGG - Intronic
966644707 3:182231522-182231544 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
966717412 3:183027371-183027393 ATGATTAAGTTTAGTGAGGAAGG + Intronic
966750855 3:183320833-183320855 ACGATTAAGCTTAATGAGGAAGG - Intronic
967491864 3:190101281-190101303 ATGATTAAGTTTACTGAGGAAGG + Intronic
967639470 3:191844126-191844148 ATGACAAAGCTTAGTGAGAAAGG - Intergenic
967661459 3:192115587-192115609 ATAACTAAGCTTAGTGAGGAAGG - Intergenic
967710772 3:192705216-192705238 ATGATTAAACTTAGTGAGGAAGG - Intronic
967766572 3:193286800-193286822 ATGGGTAAGCTTAGTGAGGAAGG + Intronic
967975313 3:195031089-195031111 AATAGGAAGCTTCCTGAGGAAGG - Intergenic
968153616 3:196359474-196359496 ATGATGAAGCTTAGTGAGAAAGG + Intronic
968154029 3:196363497-196363519 ATGATTAAGCTTAGTGAGAAAGG + Intronic
969152736 4:5184146-5184168 ATAATTAAGCTTAGTGAGGAAGG - Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
969280013 4:6163622-6163644 ACAATGAAGCTTCATGAGGAAGG + Intronic
970508596 4:16757688-16757710 ATCAGGCAGCTTTTTGAGGAGGG + Intronic
970528797 4:16960865-16960887 ATGATCAAGCTTAGTGAGGAAGG + Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
970751031 4:19361680-19361702 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
970891170 4:21046223-21046245 ATGAGGAAACTCATAGAGGATGG + Intronic
970945187 4:21682612-21682634 ATAATCAAGCTTAATGAGGAGGG - Intronic
971071179 4:23093987-23094009 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
971164214 4:24165938-24165960 ATGATGAAGCTTAATGAGAAAGG + Intergenic
971609719 4:28707632-28707654 ATGATTAGGCTTAATGAGGAAGG + Intergenic
971709047 4:30087847-30087869 ATAATTAAGCTTAATGAGGCAGG - Intergenic
971921308 4:32943201-32943223 ATGTTTAAGCTTAATGAGGAAGG + Intergenic
971987635 4:33846773-33846795 ATGAGGAAATTCAAAGAGGAGGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972244501 4:37230453-37230475 CAGAGCAAGCTTAATGAGGACGG - Intergenic
972560330 4:40221795-40221817 ATCATTAAGTTTAATGAGGAAGG + Intronic
972615365 4:40693078-40693100 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
972670806 4:41213199-41213221 ATGAGGAAACTTTGTGAGGTTGG - Intronic
973223944 4:47761241-47761263 ATGATTAAGTTTAGTGAGGAAGG - Intronic
973364174 4:49194304-49194326 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
973692760 4:53455349-53455371 ATGAGGAAGCTTGAAGAGGAAGG - Intronic
973901215 4:55474051-55474073 GTGATTAAGCTTAGTGAGGAAGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974235066 4:59170203-59170225 AGGATTAAGCTTAATGAGAAAGG - Intergenic
974336900 4:60559690-60559712 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
974397044 4:61350963-61350985 ATGATTAAGCTTAGTGAGGAAGG + Intronic
974613331 4:64245951-64245973 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
974616213 4:64285843-64285865 ATGTGGAAGCTTAAAAGGGAAGG + Intronic
974665247 4:64953365-64953387 ATGAGACAGCGTAATGAGAAGGG + Intergenic
974859300 4:67499793-67499815 ATGATTAAGCTTAGTGAGGAAGG - Intronic
974973167 4:68856109-68856131 ATGATTGAGCTTAATGATGAAGG + Intergenic
975169698 4:71219138-71219160 ATGATTAAGCTTAGTGAGGAAGG + Intronic
975240727 4:72055613-72055635 ATAATTAAGCTTAGTGAGGAAGG + Intronic
975475506 4:74818813-74818835 ATGATTAAGTTTACTGAGGAAGG - Intergenic
975900366 4:79144513-79144535 ATTACTAAGCTTAGTGAGGAAGG - Intergenic
975940680 4:79641619-79641641 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
976154481 4:82127830-82127852 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
976364093 4:84213878-84213900 ATGAGGGAGCCACATGAGGAGGG - Intergenic
976468512 4:85399509-85399531 ATGACTAAGCTTAGTGAGAAAGG + Intergenic
977069798 4:92370698-92370720 GAGAGTAAGCTTAGTGAGGAAGG + Intronic
977194434 4:94042029-94042051 ATGATTTAGCTTAGTGAGGAAGG - Intergenic
977356039 4:95948089-95948111 ATGATTAAGCTTAATGAGGAAGG - Intergenic
977568063 4:98601808-98601830 ATGATTAAGCTTAGTGAGGAAGG - Intronic
977612876 4:99054650-99054672 ATGATTAAACTTAATGAGAAAGG - Intronic
977887121 4:102265141-102265163 ATGATTAGGCTTAGTGAGGAGGG - Intronic
977915753 4:102590826-102590848 ATGATTAAGCTTAGTGAGGAAGG + Intronic
978083056 4:104618073-104618095 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
978102771 4:104863278-104863300 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
978212110 4:106149365-106149387 ATGATTAAGCTTAGTGAGGAAGG - Intronic
978286887 4:107089496-107089518 ATGATTAAGCTTACTGAGAAAGG + Intronic
978304132 4:107303663-107303685 ATGATTAAACTTAGTGAGGAAGG - Intergenic
978523518 4:109640910-109640932 ATAATTAAGCTTAGTGAGGAAGG - Intronic
979123685 4:116937573-116937595 ATGATTATGCTTAGTGAGGAAGG - Intergenic
979198031 4:117942982-117943004 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
979314018 4:119238211-119238233 ATGACTAAGCTTGGTGAGGAAGG - Intronic
979345622 4:119583584-119583606 ATGAATAAGCTTAGTGAGGAAGG - Intronic
979667610 4:123329485-123329507 ATGATTAAGCTTCACGAGGAAGG + Intergenic
979694902 4:123602250-123602272 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
979744453 4:124193915-124193937 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
979843110 4:125470923-125470945 ATGAATAAGCTTAGTGACGAAGG - Intronic
980221331 4:129919783-129919805 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
980549702 4:134318622-134318644 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
980719651 4:136678230-136678252 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
980824964 4:138062146-138062168 ATGGGGAAGTTTAAGGATGAGGG - Intergenic
981191381 4:141868837-141868859 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981391918 4:144200967-144200989 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
981439338 4:144765306-144765328 AGGATTAAGCTTAATGAGGAAGG - Intergenic
981458922 4:144989650-144989672 AGGATTAAGTTTAATGAGGAAGG + Intronic
981575860 4:146204586-146204608 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
981806633 4:148723598-148723620 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
981898401 4:149832852-149832874 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
982152783 4:152480532-152480554 ATAATTAAGCTTAGTGAGGAAGG + Intronic
982520641 4:156412495-156412517 ATGATTAAGCTTACTGAGGAAGG - Intergenic
982575713 4:157107310-157107332 ATGATTAAGCTTAATGAGGAAGG + Intronic
982681710 4:158438914-158438936 ATGATCAAGTTTAGTGAGGAAGG + Intronic
982842030 4:160201090-160201112 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
982876044 4:160651244-160651266 ATTATTAAGCTAAATGAGGAAGG + Intergenic
983124664 4:163935934-163935956 ATAATTAAGCTTAGTGAGGAAGG - Intronic
983333129 4:166357188-166357210 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
983447299 4:167869552-167869574 ACGTGGAAGCTAAATGATGAGGG - Intergenic
983658473 4:170107449-170107471 ATGATTCAGCTTAGTGAGGAGGG - Intergenic
983794832 4:171849125-171849147 ATGATTAAGCTTAATAAAGAAGG - Intronic
983830949 4:172328138-172328160 CTGAGGAAGCTTAATTTGGCTGG + Intronic
983963260 4:173779541-173779563 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
984038580 4:174700580-174700602 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
984246802 4:177284557-177284579 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
984258590 4:177416871-177416893 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984299378 4:177895348-177895370 ATGATTAAGCTTAGTGATGATGG + Intronic
984326241 4:178255219-178255241 ATGATTAATCTTAGTGAGGAAGG - Intergenic
984479138 4:180276529-180276551 ATGACGAAGCTCAGTGAGGAAGG + Intergenic
984545117 4:181092338-181092360 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984637123 4:182123374-182123396 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984685571 4:182664554-182664576 ATGATTAAGCTTAGTGGGGAAGG + Intronic
984899122 4:184569044-184569066 ATGATTAGGCTTAATGAGGAAGG - Intergenic
984971737 4:185197803-185197825 ATGATTAAGCTTAGTGAGGAAGG + Intronic
985088089 4:186334972-186334994 ATAATTAAGCTTACTGAGGACGG + Intergenic
985188324 4:187342913-187342935 ATGATTAAGCTTAATGAGGAGGG - Intergenic
985311092 4:188600293-188600315 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985430261 4:189872412-189872434 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1202761489 4_GL000008v2_random:115431-115453 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
986408418 5:7450157-7450179 ATGATTAAGCTTAGTGAGGAAGG + Intronic
986697867 5:10374546-10374568 TTGAGGAAGCTTATTAAGCAGGG + Intronic
986752824 5:10804864-10804886 ATGATTACGCTTAGTGAGGAAGG + Intergenic
986776456 5:11018440-11018462 ATGATTAAGCTTAGCGAGGAAGG + Intronic
986928528 5:12790198-12790220 ATGATTGAGCTTATTGAGGAAGG - Intergenic
986941593 5:12957274-12957296 ATGATTAAGCTTATTGAGAAAGG + Intergenic
987328967 5:16838188-16838210 ATGACGCAGCTGAGTGAGGAAGG + Intronic
987454719 5:18129394-18129416 ATGATTAAGCTTGGTGAGGACGG - Intergenic
987529393 5:19097773-19097795 ATGATTAAGCTTCATGAGGAAGG + Intergenic
987668845 5:20982464-20982486 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
987726675 5:21709547-21709569 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
987768799 5:22272551-22272573 ATGGTTAAGCTTAATGAGAAAGG - Intronic
987791261 5:22571297-22571319 ATGATTAAGCTTAGTGAGGAAGG - Intronic
987813027 5:22863645-22863667 ATGAAGAAAATTAATGAGGCAGG + Intergenic
987851061 5:23355137-23355159 ATGTTTAAGCTTACTGAGGAGGG + Intergenic
987935522 5:24458932-24458954 ATAATTAAGCTTAAAGAGGAAGG - Intergenic
988334729 5:29892194-29892216 ATGAGGAAGGTTATTGATTAGGG - Intergenic
988431662 5:31126012-31126034 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
988655539 5:33207453-33207475 ATGATTAAGCTTTATGAGGAAGG + Intergenic
989001071 5:36761364-36761386 ATGATTAAGCTTAGTGATGAAGG - Intergenic
989287808 5:39722525-39722547 ATGATTAAGCGTAGTGAGGAAGG - Intergenic
989303470 5:39922888-39922910 GTGATTAAGCTTAATGAGGAAGG - Intergenic
989324660 5:40178059-40178081 ATGATTAAGCTTATTGAGGAAGG - Intergenic
989654091 5:43725760-43725782 ATGATTAAGCTAAGTGAGGAAGG - Intergenic
989802286 5:45557985-45558007 ATGATTGAGCTTAGTGAGGAAGG + Intronic
990112124 5:52339555-52339577 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
990156554 5:52884539-52884561 AAGAGGAACCTTTATGATGAAGG + Intronic
990481596 5:56216463-56216485 ATGATTAAGCTCAATGAGGAAGG + Intronic
990523161 5:56599372-56599394 ATGATTAAGCTTAGCGAGGAAGG - Intronic
990629848 5:57656306-57656328 ATGAGGAAGCTGAAGAAGAAAGG + Intergenic
990835922 5:60019975-60019997 ATGATTAATCTTAGTGAGGAAGG - Intronic
990874605 5:60469969-60469991 ATGAATAAGCTTAGTGAGGAGGG + Intronic
990885949 5:60593629-60593651 ATGATTGAGCTTAATGAGAAAGG + Intergenic
990979404 5:61588354-61588376 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991188631 5:63841536-63841558 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991228638 5:64303360-64303382 ATTAGTAAGCTTAGTGAGCAAGG + Intronic
991336222 5:65550274-65550296 ATGATTAAGTTTCATGAGGAAGG - Intronic
991356567 5:65775244-65775266 ATGGCTATGCTTAATGAGGATGG - Intronic
991366858 5:65877591-65877613 GTGATTAAGCTTCATGAGGAAGG + Intergenic
991428323 5:66515533-66515555 ACAATGAAGCTTGATGAGGAAGG - Intergenic
991651368 5:68858246-68858268 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
991729818 5:69574701-69574723 ATGATTGAGCTTAGTGAGGAAGG + Intronic
991806250 5:70429842-70429864 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
991865136 5:71053173-71053195 ATGATTGAGCTTAGTGAGGAAGG - Intronic
991960577 5:72039983-72040005 ATGAGGAAGATGACTGAGAAGGG - Intergenic
992216732 5:74532128-74532150 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
992271291 5:75065941-75065963 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
992462794 5:76977776-76977798 ATGATTAAGCTTAGTGAAGAAGG + Intronic
993082149 5:83314972-83314994 ATGATTAAGCTTAGTGAGGAAGG + Intronic
993124317 5:83813860-83813882 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993126368 5:83840902-83840924 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
993243407 5:85420387-85420409 TTGAAGAAGCTTAATTAGGATGG - Intergenic
993349601 5:86832330-86832352 ATGAGAAAGCTTAGTGAGGAAGG - Intergenic
993709383 5:91209107-91209129 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993805736 5:92406803-92406825 ATGATTAAGCTTAGTGAGGAGGG + Intergenic
993897851 5:93559559-93559581 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993906434 5:93629018-93629040 ATGATTAAGCTTAGTGAGGAAGG - Intronic
994431279 5:99664710-99664732 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
994734562 5:103536399-103536421 ATGAGGCAGGTTAAAGAGAAGGG - Intergenic
994807852 5:104475251-104475273 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
994961071 5:106603490-106603512 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
994967141 5:106688595-106688617 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
994996668 5:107072452-107072474 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
995109458 5:108412682-108412704 ATGAGGGATCTTTATTAGGAGGG - Intergenic
995339562 5:111042593-111042615 ATGATTAAACTTAGTGAGGAAGG - Intergenic
995431260 5:112080461-112080483 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
995505788 5:112859668-112859690 ATGATTAAGCTTAGTGAGGAAGG - Intronic
995658653 5:114455601-114455623 ATGATTAAGCTTAATGAGGAAGG + Intronic
995662275 5:114498689-114498711 ATGAAGAAAATTATTGAGGAAGG - Intergenic
995670073 5:114593210-114593232 ATGATTAAGCTTAAAGAGGAAGG - Intergenic
995802131 5:116008461-116008483 ATGATTAAGTTTAGTGAGGAAGG + Intronic
995886965 5:116906041-116906063 ATTACTAAGCTTAGTGAGGAAGG + Intergenic
996045788 5:118872380-118872402 ATGATTAAGCTTATTGAGGAAGG - Intronic
996067329 5:119093647-119093669 ATGATTAAGTTTAGTGAGGAGGG + Intronic
996194493 5:120586856-120586878 ATGATTAAACTTAGTGAGGAGGG + Intronic
996464905 5:123788892-123788914 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
996482924 5:123995904-123995926 ATGATTACGCTTAGTGAGGAAGG - Intergenic
996512497 5:124332652-124332674 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996526369 5:124484445-124484467 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
996807432 5:127472483-127472505 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996841952 5:127856590-127856612 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
998678220 5:144434412-144434434 ATGAGGATCCTGAATGAGGGAGG + Intronic
998719211 5:144924493-144924515 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
998814531 5:145999481-145999503 ATGATTAATCTTAATGAGGAAGG - Intronic
998831447 5:146163788-146163810 ATGATTAAGCTTAGTGAGGAAGG - Intronic
998863720 5:146473045-146473067 ATGATTAAGCTTAGTAAGGAAGG + Intronic
999551535 5:152692788-152692810 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
999575868 5:152976024-152976046 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
999688029 5:154119744-154119766 ATAATTAAGCTTAATGTGGATGG + Intronic
999835133 5:155362036-155362058 ATAATTAAGCTTAATGAGGAAGG - Intergenic
999882630 5:155883368-155883390 ATGATTAAGCCTAGTGAGGAAGG - Intronic
1000382072 5:160638233-160638255 ATGAAGAAAGTTCATGAGGAGGG - Intronic
1000532318 5:162438527-162438549 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000542513 5:162557843-162557865 ATGATCAAGCTTAGTCAGGAAGG - Intergenic
1000886704 5:166755886-166755908 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
1001257020 5:170191783-170191805 CTGAGGAAGCCTAATTATGAAGG + Intergenic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001655893 5:173349356-173349378 ATGATTAAGCTTAGTGAGGATGG + Intergenic
1002487130 5:179546833-179546855 ATGATTAAGCTTAATGAGGTAGG - Intergenic
1002822720 6:742056-742078 ATAATTAAGCTTATTGAGGAAGG - Intergenic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1003404027 6:5813891-5813913 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1003598746 6:7499218-7499240 ATGGTGAAGCTTGGTGAGGAAGG - Intergenic
1003706102 6:8532169-8532191 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1003822901 6:9919916-9919938 ATGATTAAACTTAGTGAGGAAGG + Intronic
1003830928 6:10010630-10010652 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1003996162 6:11541728-11541750 ATGATAAAGCTTAATGAGGAAGG - Intronic
1004053412 6:12110848-12110870 ATGATTAAGCTTACTGAAGAAGG - Intronic
1004437483 6:15610518-15610540 ATAATCAAGCTTAGTGAGGAAGG + Intronic
1004550352 6:16640807-16640829 ATGATTAAGCTTAGCGAGGAAGG + Intronic
1004569299 6:16829971-16829993 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1004922801 6:20392727-20392749 ATGATTAAGCCTAATGAGGAAGG - Intergenic
1004972303 6:20924017-20924039 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1004972340 6:20924371-20924393 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1004974827 6:20952907-20952929 ATGAAGAATCCTAATGAGAATGG - Intronic
1005663873 6:28029256-28029278 ATGATTAAGTTTAATGGGGAAGG + Intergenic
1005790749 6:29297167-29297189 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006875684 6:37293684-37293706 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1006959639 6:37915428-37915450 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1007017754 6:38486397-38486419 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1007091160 6:39185703-39185725 GAGAGGCAGCTTACTGAGGAAGG + Intergenic
1007611504 6:43152156-43152178 GTGAGGAAGGTTAAAGAAGAGGG - Intronic
1007651021 6:43421859-43421881 ATGATCAAACTTAGTGAGGAAGG + Intergenic
1007897111 6:45374079-45374101 ATGAGAAAGCGGGATGAGGATGG + Intronic
1008255030 6:49287891-49287913 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1008299086 6:49812168-49812190 ATGAGTAAGCTTAGTGAGGAAGG - Intergenic
1008622520 6:53285102-53285124 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1008726019 6:54420553-54420575 ATGAAGAAAGTTATTGAGGAAGG - Intergenic
1008831616 6:55770675-55770697 ATGATTACGCTTATTGAGGAAGG - Intronic
1008916853 6:56797420-56797442 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1009590035 6:65656306-65656328 ATGATTATGCTTAGTGAGGAAGG + Intronic
1009960790 6:70518026-70518048 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1009963313 6:70551275-70551297 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1010724578 6:79318809-79318831 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1011019803 6:82799822-82799844 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1011069804 6:83367923-83367945 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1011115682 6:83888759-83888781 ACGATTAAGCTTAGTGAGGAAGG + Intronic
1011218048 6:85026236-85026258 ATGATTAAGCTTAGAGAGGAAGG + Intergenic
1011708326 6:90025676-90025698 ATTAGGAGGCTAAATGAGGGTGG + Intronic
1011856504 6:91699505-91699527 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1012012745 6:93810896-93810918 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1012109048 6:95203110-95203132 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1012284482 6:97372315-97372337 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1012287661 6:97412675-97412697 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1012340055 6:98109751-98109773 ATGGGTAAGCTTAGTGAGGAAGG - Intergenic
1012564906 6:100636575-100636597 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1012836712 6:104278780-104278802 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1012918455 6:105196387-105196409 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1013202834 6:107917505-107917527 ATGACTAAGCTTAGTGAAGAAGG + Intronic
1013261271 6:108445480-108445502 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1013381898 6:109581288-109581310 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1013493501 6:110674382-110674404 ATGATTGAGCTTACTGAGGAAGG + Intronic
1013786064 6:113782634-113782656 ATGAGGATGCTACCTGAGGAGGG + Intergenic
1013821287 6:114156174-114156196 ATGTGGAAGCTTAGTGTAGAGGG - Intronic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1013922780 6:115428798-115428820 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1014262457 6:119235234-119235256 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1014305065 6:119729994-119730016 AAAAGGAAGGCTAATGAGGAAGG - Intergenic
1014618019 6:123628179-123628201 ATAATTAAGCTTACTGAGGAAGG - Intronic
1014775157 6:125500368-125500390 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1014975539 6:127877407-127877429 ATGATTAAGCTTAGTGTGGAAGG - Intronic
1015004229 6:128258859-128258881 ATCAGAAAGCTGAATGAGGGAGG + Intronic
1015009967 6:128333858-128333880 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015144858 6:129974170-129974192 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1015259586 6:131221023-131221045 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1015304196 6:131688402-131688424 ATGATTAAGCTTAATGAGGAAGG + Intronic
1015337035 6:132051178-132051200 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
1015488448 6:133798733-133798755 CTGAGGAAGCTTAGTTTGGATGG + Intergenic
1015560622 6:134511329-134511351 ATGAGGAAGATGAATTAGAATGG - Intergenic
1015640744 6:135328731-135328753 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1015939744 6:138436176-138436198 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016081618 6:139864153-139864175 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1016794079 6:148099152-148099174 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1016836398 6:148481476-148481498 ATGATTAAGCTTAGTGAGGAGGG - Intronic
1016848021 6:148588190-148588212 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016867409 6:148781118-148781140 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016903284 6:149123328-149123350 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016931573 6:149415879-149415901 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1017461017 6:154650499-154650521 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1017541208 6:155404904-155404926 TTGAAGGAGGTTAATGAGGAGGG - Intronic
1017799585 6:157881495-157881517 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1018224173 6:161611787-161611809 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1018294764 6:162333776-162333798 ATGATAAAGCTCAGTGAGGAAGG + Intronic
1018599228 6:165521402-165521424 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1019035614 6:169054685-169054707 ATGACTCAGCTTAGTGAGGAAGG - Intergenic
1019430710 7:997689-997711 ATGCGGGAGCTGGATGAGGAGGG - Exonic
1019629213 7:2037915-2037937 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1019803699 7:3107005-3107027 ATGAGGAATCTCCAGGAGGAAGG + Intergenic
1019821984 7:3251016-3251038 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1019895745 7:3981469-3981491 ATGATGAAGCTTAGTAAGGAAGG + Intronic
1020090893 7:5340087-5340109 ATGATTAAACTTAGTGAGGAAGG + Intronic
1020423824 7:8040998-8041020 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020450633 7:8316884-8316906 AAAAGGAAAATTAATGAGGAAGG - Intergenic
1020571385 7:9867648-9867670 ATGATTAAACTTATTGAGGAAGG + Intergenic
1020596857 7:10217507-10217529 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1020664563 7:11023936-11023958 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020752583 7:12161324-12161346 ATCTGGAGGCTTAATGGGGAAGG - Intergenic
1020859778 7:13477072-13477094 ATGATTAAGCTTAATGAGAAAGG - Intergenic
1020930428 7:14386467-14386489 ATGAGGTTGCTTAATTAGAAGGG - Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1021015585 7:15527158-15527180 ATGATTAAGCTTAAGAAGGAAGG + Intronic
1021132781 7:16931365-16931387 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1021678132 7:23101726-23101748 ATGACTATGCTTAGTGAGGAAGG + Intergenic
1021934091 7:25613186-25613208 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1022063269 7:26822981-26823003 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1022066720 7:26865935-26865957 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022144995 7:27528334-27528356 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022197171 7:28080517-28080539 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1022279901 7:28897216-28897238 ATTATTAAGCTTGATGAGGAAGG - Intergenic
1022548879 7:31217504-31217526 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1023026095 7:36051107-36051129 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023457560 7:40358168-40358190 ATGTGGGAGCTTAAAGATGATGG + Intronic
1023710251 7:42985077-42985099 ATGATGAAGTTTAGTGAGAAAGG - Intergenic
1023724380 7:43127077-43127099 ATGATCAAGCTTAGTGAGGACGG + Intronic
1023773233 7:43579144-43579166 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1024133320 7:46379623-46379645 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1024257972 7:47552804-47552826 ATGAGTCAGCTTAGTGGGGAAGG + Intronic
1024786131 7:52910400-52910422 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026507741 7:71000206-71000228 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027201520 7:76066924-76066946 TAGAGGAAGCTCAATGAGAAAGG - Exonic
1027289735 7:76693075-76693097 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027294178 7:76750049-76750071 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027490320 7:78815940-78815962 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1027512065 7:79095467-79095489 ATGATTAGGCTTAGTGAGGAAGG - Intronic
1027623128 7:80517484-80517506 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1028064958 7:86372230-86372252 ATTACTAAGCTTAGTGAGGAAGG + Intergenic
1028408605 7:90503482-90503504 ATGATTAAACTTAGTGAGGAAGG - Intronic
1028578205 7:92377114-92377136 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1028660951 7:93274183-93274205 ATGATTAAGCTTAGTGAAGATGG + Intronic
1030022510 7:105289820-105289842 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1030136859 7:106260629-106260651 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1030151097 7:106405956-106405978 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030224339 7:107132275-107132297 ATGTGGATGCTTTATCAGGAAGG + Intronic
1030411351 7:109184210-109184232 ATGTGGAAGTTTAATCAAGATGG - Intergenic
1030479111 7:110080021-110080043 ATGATGAAATTTAGTGAGGAAGG - Intergenic
1030992982 7:116323691-116323713 ATGATGAAGCTTAGTGAAGAAGG + Intronic
1031057336 7:117007119-117007141 ATGATTAAGCTTAATGACGAAGG + Intronic
1031234635 7:119159074-119159096 ATGATTGAGCTTATTGAGGAAGG - Intergenic
1031281740 7:119811572-119811594 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1031570241 7:123350222-123350244 GTGAGGAAGAGTAGTGAGGAGGG - Intergenic
1031851551 7:126870444-126870466 AAGATGAAGCTTAATGAGGAAGG - Intronic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1032180868 7:129676344-129676366 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1032235501 7:130118640-130118662 TTGACTAAGCTTAGTGAGGAAGG - Intronic
1032622360 7:133548959-133548981 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1032667721 7:134053658-134053680 AGGACAAAGCTTGATGAGGATGG + Intronic
1032701616 7:134385326-134385348 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1032730366 7:134636195-134636217 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1032769025 7:135029745-135029767 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032778899 7:135146033-135146055 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032861774 7:135886600-135886622 ATGACTAAGCTTAGTGAGAAAGG + Intergenic
1033080558 7:138293036-138293058 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1033107558 7:138542240-138542262 ATGAGTAAGCTTACTGAGGAAGG - Intronic
1033112484 7:138593558-138593580 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1033241608 7:139684392-139684414 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1033266276 7:139889944-139889966 ATCAGGAAGCTGCATTAGGAAGG + Intronic
1033386496 7:140881663-140881685 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1033388440 7:140902509-140902531 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1033393870 7:140955627-140955649 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1034134112 7:148749772-148749794 ATGATTAAGCCAAATGAGGAAGG + Intronic
1034361653 7:150504948-150504970 ATGATGAAGCTTAGTGGGGCAGG + Intergenic
1034727521 7:153351957-153351979 ATGATTAAGTTTAATGAAGAAGG + Intergenic
1034743314 7:153498368-153498390 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034743319 7:153498424-153498446 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034873254 7:154702346-154702368 ATGAGTAAGCTTAATGAGGAAGG + Intronic
1035167096 7:156997939-156997961 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1035637416 8:1156877-1156899 ATGAGGAGGCTGACTCAGGAAGG + Intergenic
1036115421 8:5954940-5954962 ATGATTAACCTTAATGAGAAAGG + Intergenic
1036469129 8:9034761-9034783 ATGATTAATCTTAAAGAGGAAGG + Intronic
1036709108 8:11066990-11067012 ATGTGGAAGCTTCATGGGGGTGG + Intronic
1036735688 8:11313507-11313529 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1036950450 8:13134154-13134176 ATTAGGAAGCCTAATGTGAAGGG + Intronic
1037145908 8:15572629-15572651 ATGATTAAACTTAGTGAGGAAGG - Intronic
1037218530 8:16487801-16487823 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1037263390 8:17033175-17033197 ATGATTAAGCTTAATGAGGAAGG + Intronic
1037327816 8:17711744-17711766 ATGATTGAGTTTAATGAGGAGGG - Intronic
1037447676 8:18983459-18983481 ATGATTAAGCTTAGTGAGAAGGG - Intronic
1038025640 8:23587113-23587135 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1038056533 8:23863642-23863664 ATGAAGCAGCTTAGGGAGGAGGG + Intergenic
1038198249 8:25387779-25387801 ATAAGGAAGCGTAAAGAGAAGGG - Intronic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039381980 8:37094005-37094027 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1039556198 8:38476980-38477002 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1039815185 8:41087409-41087431 ATGAGTAAGCCTAGTGAGAAAGG + Intergenic
1039983866 8:42431105-42431127 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1040636286 8:49277389-49277411 GTAATTAAGCTTAATGAGGAAGG + Intergenic
1040722795 8:50346572-50346594 ATAATTAAGCTTAATGAGAAAGG + Intronic
1040774104 8:51018243-51018265 ATGATTACGCTTAATGAGGAAGG - Intergenic
1040833101 8:51699655-51699677 ATGATTATGCTTAGTGAGGAAGG - Intronic
1041100130 8:54388108-54388130 ATTAAGAATCTTAGTGAGGAAGG - Intergenic
1041450838 8:58005078-58005100 ATGATTTTGCTTAATGAGGAAGG - Intronic
1041475994 8:58266556-58266578 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
1041751292 8:61263785-61263807 ATGATAACCCTTAATGAGGAAGG - Intronic
1041822295 8:62050772-62050794 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1042045525 8:64646988-64647010 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042099975 8:65265186-65265208 ATAATTAAGCTTATTGAGGACGG - Intergenic
1042108464 8:65354342-65354364 ATGAGGAAGCTTAGTTTGGCTGG + Intergenic
1042419401 8:68567885-68567907 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1042421245 8:68591410-68591432 ATGAGTAACATTAATGAGGTGGG - Intronic
1042548029 8:69968219-69968241 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1042732696 8:71954859-71954881 CTGAGGAAGCTAAAGCAGGAGGG - Intronic
1042785813 8:72545721-72545743 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1042851768 8:73223880-73223902 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1042882397 8:73508216-73508238 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1044044121 8:87409075-87409097 ATGATTAAGCTTAATGAGGAAGG + Intronic
1044089770 8:87984839-87984861 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1044259600 8:90102172-90102194 ATGGGTAAGCCTAGTGAGGAAGG - Intergenic
1044287861 8:90430489-90430511 ATGATGAAGCTTAGAGAGAAAGG + Intergenic
1044668996 8:94659592-94659614 ATGATTAAGCTTAGTCAGGAAGG + Intronic
1045038669 8:98199343-98199365 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1045073155 8:98532164-98532186 ATGATTAAACTTAGTGAGGAAGG - Intronic
1045129527 8:99133557-99133579 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1045158320 8:99505339-99505361 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1045232925 8:100322650-100322672 ATGATTAAGCTTAATGAGGAAGG - Intronic
1045563523 8:103289829-103289851 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045889586 8:107139109-107139131 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045948342 8:107823383-107823405 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1046040705 8:108900289-108900311 ATGAGTGAGCTTAGTGATGAAGG + Intergenic
1046130328 8:109959730-109959752 ATGATTAAGCTTAATGAAGAAGG + Intergenic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1046545499 8:115644707-115644729 ATGATTATGCTTAGTGAGGAAGG - Intronic
1046571739 8:115974800-115974822 ATGATTAAGCTTAATGAGGAGGG - Intergenic
1046743822 8:117855998-117856020 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1047009882 8:120660730-120660752 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1047400663 8:124543931-124543953 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1047560415 8:125981648-125981670 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1047630743 8:126705127-126705149 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1047726297 8:127686912-127686934 CTGAGGAAATTTAATCAGGATGG + Intergenic
1047794933 8:128245534-128245556 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1048824319 8:138409097-138409119 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1048902484 8:139052094-139052116 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1049231128 8:141482457-141482479 GTGAGGGAGCTTAACCAGGAAGG - Intergenic
1049337737 8:142095562-142095584 CTGAGGAACCTTACTGGGGAGGG + Intergenic
1049408833 8:142463515-142463537 AGGAGGAAGGTTAGAGAGGAGGG + Intronic
1049629102 8:143642559-143642581 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1049739481 8:144230473-144230495 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050244258 9:3671550-3671572 AAGAGGCAGCTTAATGAGACTGG - Intergenic
1050349578 9:4727777-4727799 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050383772 9:5061810-5061832 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050495665 9:6239265-6239287 ATAAGGAAGCTTGCTCAGGAGGG + Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050755486 9:8997707-8997729 ATGATTAGGCTTGATGAGGAAGG + Intronic
1050923022 9:11229770-11229792 TTGAGAAAGGTTAATTAGGAAGG + Intergenic
1051085008 9:13338284-13338306 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1051123770 9:13780530-13780552 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
1051201520 9:14631604-14631626 ATGATGAAACCTAATGAGAAAGG - Intronic
1051298258 9:15619244-15619266 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051601678 9:18881290-18881312 ATGATTAAGCTTAGTGGGGAAGG - Intronic
1051721638 9:20043111-20043133 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1051852987 9:21530514-21530536 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1051893455 9:21965851-21965873 TTGAGGAAGGGTAAGGAGGAAGG + Intronic
1051967921 9:22851651-22851673 ATTACTAAGCTTAGTGAGGAAGG - Intergenic
1052186613 9:25604539-25604561 AAGATTAAGCTTAGTGAGGAAGG + Intergenic
1052705650 9:31990455-31990477 ATGATGAAGCTTCTAGAGGAAGG + Intergenic
1052850177 9:33373425-33373447 GTGAGGAAGGCTAATGAGGAAGG - Intergenic
1053250341 9:36568924-36568946 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053296494 9:36918180-36918202 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1053465614 9:38305922-38305944 ATGATCAAGCTTAGTGAGGAAGG - Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1054795784 9:69300657-69300679 AAAATGAAGCTTAGTGAGGAAGG - Intergenic
1054839431 9:69720116-69720138 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1054912666 9:70468136-70468158 CTCAGGAAGCTGAATGAGGCAGG + Intergenic
1054994516 9:71370277-71370299 ATAATTAAGCTTAGTGAGGATGG + Intronic
1055150690 9:72995406-72995428 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1055297094 9:74844821-74844843 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1055434637 9:76280417-76280439 TTGATTAAGCTTAGTGAGGAAGG + Intronic
1055557162 9:77486570-77486592 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1055812627 9:80167102-80167124 ATTAAAAATCTTAATGAGGAAGG + Intergenic
1056361269 9:85860224-85860246 TTCAGGAAGCTTACTCAGGATGG - Intergenic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056959604 9:91111437-91111459 ATGATTAAGCTTAGTGAGTAAGG - Intergenic
1056979265 9:91293268-91293290 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1057063870 9:92029954-92029976 AGTAGGAAGCTTAAGGATGATGG - Intergenic
1057287353 9:93768741-93768763 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1057370578 9:94469153-94469175 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057539007 9:95947101-95947123 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1057823695 9:98354938-98354960 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058348764 9:103996713-103996735 ATGATTAAGCTTATTGAGGATGG - Intergenic
1058628130 9:106957113-106957135 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059092984 9:111381139-111381161 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059158128 9:112007849-112007871 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1059290087 9:113215217-113215239 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1059711862 9:116875114-116875136 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1059805613 9:117797034-117797056 ATGAGGAAGCATGATCATGATGG + Intergenic
1059917506 9:119119761-119119783 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1060066465 9:120505534-120505556 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1060128862 9:121075674-121075696 ATGAGGAAACATGATCAGGAAGG - Intronic
1060336566 9:122729239-122729261 AAGAGGAAGCTTCAAGAGGCAGG + Intergenic
1060565219 9:124584846-124584868 ATCGTTAAGCTTAATGAGGAAGG + Intronic
1060843963 9:126819723-126819745 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1061121500 9:128645729-128645751 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1061494655 9:130965278-130965300 TTGATTAAGCTTAATGAGGAAGG + Intergenic
1203483861 Un_GL000224v1:33295-33317 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1203708833 Un_KI270742v1:77266-77288 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1186034469 X:5406131-5406153 AGGAGGAAGATGAAGGAGGAAGG + Intergenic
1186969852 X:14829957-14829979 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1187026669 X:15442499-15442521 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1187424103 X:19161570-19161592 ATTAAGAATCTTAATGAGGCTGG + Intergenic
1187516629 X:19977252-19977274 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1187662912 X:21570600-21570622 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1187760134 X:22574079-22574101 ATGATTAAGCTTCATGAGGAAGG + Intergenic
1187814933 X:23221250-23221272 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1187908787 X:24091380-24091402 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1188132272 X:26451378-26451400 ATTATTAAGTTTAATGAGGATGG - Intergenic
1188231091 X:27664103-27664125 ATGATCAAACTTAGTGAGGAAGG + Intronic
1188278859 X:28238072-28238094 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1188448232 X:30280125-30280147 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1188822111 X:34788279-34788301 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1188833576 X:34930648-34930670 ATGATTAAGCCTAATGAGAAAGG + Intergenic
1188899327 X:35710765-35710787 GTAAGGAAACTTAATGAGAAAGG + Intergenic
1189014552 X:37083290-37083312 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189174577 X:38942806-38942828 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189358832 X:40332595-40332617 ATGTGGAAGCTTCAAGGGGATGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1189708638 X:43785607-43785629 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1189788029 X:44577193-44577215 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189827790 X:44937768-44937790 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1189830240 X:44965404-44965426 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1189942624 X:46141320-46141342 ATGATTAAACTTGATGAGGAAGG + Intergenic
1190141911 X:47854493-47854515 ATGATTGAGCTTATTGAGGAAGG - Intronic
1190189494 X:48265315-48265337 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190460801 X:50671885-50671907 ATGCTTAAGCTTAGTGAGGAAGG - Intronic
1190658254 X:52631816-52631838 ATGGCTAAGCTTAGTGAGGAGGG - Intergenic
1190660187 X:52646834-52646856 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190663396 X:52675978-52676000 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190676027 X:52782504-52782526 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190715679 X:53101267-53101289 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
1190989484 X:55531318-55531340 ATGAAGAAACTTGATGATGAAGG - Intergenic
1191824810 X:65353452-65353474 ATCATTAAACTTAATGAGGAAGG + Intergenic
1191957757 X:66664729-66664751 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1192016559 X:67337813-67337835 ATGATGAATTTTTATGAGGATGG + Intergenic
1192084593 X:68083684-68083706 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1192091681 X:68165298-68165320 ATGATTAAGCTTAATGAGGAAGG - Intronic
1192207346 X:69105237-69105259 ATGAGGAATGTTGATGAGGGCGG + Intergenic
1192388635 X:70700689-70700711 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1192754541 X:74033647-74033669 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1192964262 X:76160093-76160115 AGGAAGAAGCTTACAGAGGAAGG + Intergenic
1193020178 X:76783175-76783197 AGGATTAAGCTTACTGAGGAAGG + Intergenic
1193867256 X:86749320-86749342 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1193971277 X:88057009-88057031 ATGATTAAGCTTTGTGAGGAAGG + Intergenic
1194120809 X:89961404-89961426 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194588637 X:95769492-95769514 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194591241 X:95802520-95802542 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195200745 X:102547851-102547873 ATGAGGCAGCTAAAGGAGTAAGG + Intergenic
1195254317 X:103078367-103078389 TTTAGGAAGCTGAATGTGGAAGG - Intronic
1195338748 X:103883608-103883630 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1195966370 X:110433456-110433478 ACTAGGAAGGGTAATGAGGAAGG + Intronic
1195987907 X:110651206-110651228 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
1196029342 X:111078713-111078735 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1196260351 X:113572017-113572039 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1196361127 X:114860780-114860802 ATGAGGAAACTTGATGGGGATGG - Intronic
1196461913 X:115941042-115941064 AAGAGGAAGCTTTTTGAGCATGG + Intergenic
1197114065 X:122811182-122811204 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197129334 X:122986612-122986634 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197456359 X:126680699-126680721 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197628208 X:128827261-128827283 ATGACAAAGCTTAGTGAGAAAGG + Intergenic
1198034622 X:132788587-132788609 ATGATTAAACTTAGTGAGGAAGG + Intronic
1198199699 X:134403131-134403153 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1198323126 X:135539646-135539668 ATGATTAAACTTAGTGAGGAAGG - Intronic
1198542915 X:137659307-137659329 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198621341 X:138514108-138514130 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198690349 X:139276623-139276645 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1199260182 X:145764061-145764083 ATGATTAAGCTTAGGGAGGAAGG + Intergenic
1199343776 X:146714348-146714370 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1199916829 X:152351752-152351774 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1200473675 Y:3618909-3618931 ATAATTAAGCTTAATGAGGAAGG + Intergenic
1200949506 Y:8880728-8880750 AGGAGGAAGAGTAATGAAGAAGG + Intergenic