ID: 1031883885

View in Genome Browser
Species Human (GRCh38)
Location 7:127225518-127225540
Sequence GAGAATGATCTGATGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031883882_1031883885 21 Left 1031883882 7:127225474-127225496 CCTATCTGCTGGAAAAAAAAAAA 0: 1
1: 1
2: 34
3: 522
4: 5196
Right 1031883885 7:127225518-127225540 GAGAATGATCTGATGCAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031883885 Original CRISPR GAGAATGATCTGATGCAGCT AGG Intronic
No off target data available for this crispr