ID: 1031884574

View in Genome Browser
Species Human (GRCh38)
Location 7:127232491-127232513
Sequence CTGTGGGAGGCCAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269561
Summary {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031884574_1031884580 11 Left 1031884574 7:127232491-127232513 CCATCCACCTTGGCCTCCCACAG 0: 14
1: 1357
2: 26592
3: 81400
4: 160198
Right 1031884580 7:127232525-127232547 CAAGTGTGTGCAACCACACCTGG 0: 1
1: 110
2: 2369
3: 13644
4: 47762

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031884574 Original CRISPR CTGTGGGAGGCCAAGGTGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr