ID: 1031889583

View in Genome Browser
Species Human (GRCh38)
Location 7:127278512-127278534
Sequence CTATGGAAGAGAACCCGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031889576_1031889583 25 Left 1031889576 7:127278464-127278486 CCTTTAAGGCTCATTACACATGG 0: 9
1: 30
2: 58
3: 69
4: 128
Right 1031889583 7:127278512-127278534 CTATGGAAGAGAACCCGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031889583 Original CRISPR CTATGGAAGAGAACCCGGTA GGG Intergenic
No off target data available for this crispr