ID: 1031894765

View in Genome Browser
Species Human (GRCh38)
Location 7:127336444-127336466
Sequence TAGCAGAAGCAGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031894765_1031894772 24 Left 1031894765 7:127336444-127336466 CCCTCCAGCCTCTGCTTCTGCTA No data
Right 1031894772 7:127336491-127336513 CTGGATCCCCTTTTACTTAGAGG No data
1031894765_1031894770 5 Left 1031894765 7:127336444-127336466 CCCTCCAGCCTCTGCTTCTGCTA No data
Right 1031894770 7:127336472-127336494 ATCTTCTTCTCTGATTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031894765 Original CRISPR TAGCAGAAGCAGAGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr