ID: 1031895740

View in Genome Browser
Species Human (GRCh38)
Location 7:127346710-127346732
Sequence TTGCACATTGAACCCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031895740_1031895743 6 Left 1031895740 7:127346710-127346732 CCAAGACAGGGTTCAATGTGCAA No data
Right 1031895743 7:127346739-127346761 TATTAAGGGAACTCCTGTGAAGG No data
1031895740_1031895742 -8 Left 1031895740 7:127346710-127346732 CCAAGACAGGGTTCAATGTGCAA No data
Right 1031895742 7:127346725-127346747 ATGTGCAAGAGTTTTATTAAGGG No data
1031895740_1031895746 25 Left 1031895740 7:127346710-127346732 CCAAGACAGGGTTCAATGTGCAA No data
Right 1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG No data
1031895740_1031895747 30 Left 1031895740 7:127346710-127346732 CCAAGACAGGGTTCAATGTGCAA No data
Right 1031895747 7:127346763-127346785 TAAACAGAAGGAAGCAGGAGCGG No data
1031895740_1031895744 18 Left 1031895740 7:127346710-127346732 CCAAGACAGGGTTCAATGTGCAA No data
Right 1031895744 7:127346751-127346773 TCCTGTGAAGGATAAACAGAAGG No data
1031895740_1031895741 -9 Left 1031895740 7:127346710-127346732 CCAAGACAGGGTTCAATGTGCAA No data
Right 1031895741 7:127346724-127346746 AATGTGCAAGAGTTTTATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031895740 Original CRISPR TTGCACATTGAACCCTGTCT TGG (reversed) Intergenic
No off target data available for this crispr