ID: 1031895746

View in Genome Browser
Species Human (GRCh38)
Location 7:127346758-127346780
Sequence AAGGATAAACAGAAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031895740_1031895746 25 Left 1031895740 7:127346710-127346732 CCAAGACAGGGTTCAATGTGCAA No data
Right 1031895746 7:127346758-127346780 AAGGATAAACAGAAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031895746 Original CRISPR AAGGATAAACAGAAGGAAGC AGG Intergenic
No off target data available for this crispr