ID: 1031900042

View in Genome Browser
Species Human (GRCh38)
Location 7:127398772-127398794
Sequence CTCTGAGTGCCTTTAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031900042_1031900047 27 Left 1031900042 7:127398772-127398794 CCCTGTGCTAAAGGCACTCAGAG 0: 1
1: 0
2: 1
3: 23
4: 194
Right 1031900047 7:127398822-127398844 GCATGCAGCATGCTGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031900042 Original CRISPR CTCTGAGTGCCTTTAGCACA GGG (reversed) Intronic
900652561 1:3737125-3737147 ATGTGAGTGCTTTCAGCACAAGG + Intergenic
902254737 1:15180726-15180748 CTCACAGAGCCTTTAGCACGGGG + Intronic
903992720 1:27285340-27285362 CTCTAAGGGCCATTAGAACAAGG - Intronic
904239651 1:29135433-29135455 CTCTGTGTGACTTTAGCAGGGGG - Intergenic
906520072 1:46461647-46461669 CTCAGAGACCCTTTAGCCCAAGG + Intergenic
906811885 1:48835474-48835496 CTATGAGTGCATATAGCAAAGGG + Intronic
907993750 1:59608524-59608546 CTCTGAGTTCCTTAAAGACAAGG + Intronic
912690182 1:111799031-111799053 CTCTGTTTGCTTTTAGCCCAAGG - Intronic
917683480 1:177392012-177392034 CTCTGAGTGCCTGTGGCATTTGG - Intergenic
919570780 1:199244246-199244268 CTCTAATTTCCTTTAGGACATGG - Intergenic
921286409 1:213613720-213613742 GACTGTGTGACTTTAGCACAGGG - Intergenic
921498846 1:215875175-215875197 CTAGGAGTGCCTTTAGCCCAAGG - Intronic
921811811 1:219523501-219523523 CTCTGTGTCCCTTCACCACATGG + Intergenic
922785987 1:228282481-228282503 GTCTGAGTGCCCTGAGCACTTGG + Intronic
923473309 1:234311266-234311288 CTCTCAGTCCCTTTGGCACATGG - Intronic
924170680 1:241336925-241336947 CTCTCACTGCCTTAAACACATGG + Intronic
1067239514 10:44478590-44478612 CTCTGAGTGAGTTAATCACAGGG + Intergenic
1067480815 10:46596529-46596551 CTCAGAGTGGGGTTAGCACACGG - Intergenic
1067511689 10:46900730-46900752 CTCTGAGAGAATTTAGAACAAGG - Intergenic
1067613924 10:47745272-47745294 CTCAGAGTGGGGTTAGCACACGG + Intergenic
1067650557 10:48151095-48151117 CTCTGAGAGAATTTAGAACAAGG + Intergenic
1067681336 10:48443344-48443366 CTCTGAGGGCCTATCGCCCATGG - Intergenic
1067793259 10:49303271-49303293 ATCTGAGCACCTTCAGCACATGG + Intronic
1068904603 10:62309043-62309065 TTCTGAGAGCTTGTAGCACAGGG + Intergenic
1069954678 10:72042716-72042738 CTCTGAGGGTCCTCAGCACAGGG + Intergenic
1070514124 10:77187838-77187860 CTCTGAGTGCCTGTAGTTTACGG + Intronic
1071629330 10:87205249-87205271 CTCAGAGTGGGGTTAGCACACGG + Intergenic
1075667373 10:124240701-124240723 CTGTGAGTGCCTTGAGGGCAGGG + Intergenic
1075703644 10:124485230-124485252 CTGCTAGTGCCTTTAGAACATGG + Intronic
1076009374 10:126975170-126975192 CTCTGTGTCCCTTTAGTCCATGG + Intronic
1076906581 10:133365354-133365376 CTCTGAGTGCATTTATCTCGAGG - Intronic
1077126107 11:937974-937996 CTCTGATTGCCTGGAGCACCAGG + Intronic
1078457530 11:11486833-11486855 CTTTGGCTGCTTTTAGCACATGG - Intronic
1078803572 11:14672151-14672173 TTCTGAGTTTCTTAAGCACAAGG + Intronic
1079736615 11:24005147-24005169 CTCTGTGTCTCTTTAGAACAAGG - Intergenic
1079969573 11:27019840-27019862 CTCTGAGTGCCCTTCTCACTTGG - Intergenic
1081517439 11:43846794-43846816 GTGTGTGTGCCTTCAGCACAGGG - Intronic
1081635889 11:44721780-44721802 CTCTGAGTGTTTTTAGCACAAGG - Intergenic
1085807997 11:79654113-79654135 CTCTGAATGCCTTGAAAACAAGG - Intergenic
1086045471 11:82526737-82526759 CTCTGAATGCCTTCAGGGCAAGG + Intergenic
1087166808 11:95012812-95012834 CTCTGTCTACCTTTAGCACCAGG - Intergenic
1089780097 11:120867646-120867668 CTCTCAGTGCCCTTAGAACGGGG - Intronic
1091023717 11:132123716-132123738 CTGTTGATGCCTTTAGCACACGG - Intronic
1091243037 11:134067247-134067269 CTCTGATTCCCTTCTGCACAGGG + Intergenic
1091395964 12:154398-154420 CTCTGAGTGCCTTCTGCCCCAGG - Intronic
1091704107 12:2682065-2682087 CTCTCTGTGCCTTTACCCCAGGG + Intronic
1092655527 12:10680449-10680471 CTCTTAGAGGCTTTAGCATATGG - Intergenic
1094846881 12:34365239-34365261 CACTGAATGCCTTGAGCCCACGG - Intergenic
1095353913 12:41247946-41247968 GTCTGTGAGCCTTCAGCACATGG - Intronic
1098013278 12:66077243-66077265 CTCTGAATGTCTTGAGTACATGG + Intergenic
1098441709 12:70525968-70525990 CACTGATTGCCTTAAACACAAGG - Intronic
1102112544 12:110375259-110375281 CTATGAAAGCCCTTAGCACATGG + Intronic
1102776813 12:115526808-115526830 CTCTTAGTGCCTACAACACAGGG + Intergenic
1106457136 13:29937382-29937404 TTCTGAGAGCCTCTAGCACAGGG + Intergenic
1106822146 13:33477339-33477361 TTCTAAGTCCCTTTACCACAGGG + Intergenic
1107085485 13:36423508-36423530 CTCTAAGTGCCTATATCAAAAGG + Intergenic
1107729607 13:43335078-43335100 CTCTGGGAGCCTTTAGAACAGGG + Intronic
1107987789 13:45790572-45790594 TGCTGAGTGCCTTCAGGACAGGG + Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108377834 13:49829689-49829711 CTCTGACACCCTTTAGCACAAGG - Intergenic
1108710914 13:53031461-53031483 CTCTGAGTGCTTACAGCAGAAGG - Intronic
1108881581 13:55125888-55125910 CTCTGAGTCCCTTTAAAATAAGG - Intergenic
1117250084 14:53928192-53928214 CTCTGAGAGCGTTTGACACATGG - Intergenic
1120729824 14:87990168-87990190 CTCTTAGTTCCTTAAGGACATGG + Intronic
1122064754 14:99165050-99165072 CTCTGACTACCTTTGGCACTTGG - Intergenic
1122714369 14:103685502-103685524 TTCTGAGTGGCTTTAGGACTGGG - Intronic
1125594634 15:40876635-40876657 CCCTGAGTTCCTTTAGCTGAGGG - Intergenic
1127898079 15:63320633-63320655 CTTTTAGTGCCTTTAGCCCCTGG + Intergenic
1128350613 15:66885932-66885954 CTCTGAGTGCCTTCTGCATTTGG + Intergenic
1128855225 15:71005298-71005320 CTCTGTGTTCCCTTAGCATATGG + Intronic
1129180666 15:73872850-73872872 CCCTGAGTTCCTTTAGGCCAGGG - Intergenic
1130187097 15:81694521-81694543 CTCTGCCTGCTTTTTGCACATGG - Intergenic
1131054738 15:89368609-89368631 CCCTGAGCGCCATTAGCATACGG + Intergenic
1132077962 15:98838749-98838771 CTCAGAGTGCCTTTTGGCCACGG - Intronic
1135671411 16:24378646-24378668 CTCTGAGGTCCTTTAGCCCTTGG - Intergenic
1137435803 16:48453477-48453499 CTCTGGGTGCCCTGAGCTCAGGG - Intergenic
1137543721 16:49383156-49383178 CTCTGAGCACCTTTTGCACTTGG - Intronic
1142419858 16:89963534-89963556 CGTGGAGTGCCTTTAGCAGAGGG + Intronic
1143626029 17:8110525-8110547 CTCTGTGTGCCTTCTGCAGAGGG - Exonic
1143684772 17:8504919-8504941 CTCTGAGTGCCTCTTGCGCCTGG - Intronic
1144026129 17:11277426-11277448 CTGTAAGTGCCTTGAGTACAGGG + Intronic
1144305473 17:13966022-13966044 ATCTAAGTGCCTTTAGAATATGG + Intergenic
1147441047 17:40447422-40447444 CTCTCAGTCCCTTTGGGACAGGG + Intronic
1147918620 17:43902829-43902851 CTCAGAGGGCCTCTAGCACAGGG + Intronic
1149731253 17:58948318-58948340 GGGTGAGTGCATTTAGCACATGG - Intronic
1151589012 17:75031177-75031199 CTCTGAGTCCCTTGAGGACAGGG - Intergenic
1154221581 18:12459445-12459467 CTCAGAGTGCCTGCTGCACATGG + Intronic
1155306591 18:24484568-24484590 CTCAGACTGCCTTCTGCACAGGG + Intergenic
1155517069 18:26634889-26634911 CTCAGAGGGCGTTTAGCAAATGG - Intronic
1155705335 18:28803381-28803403 TACTGAGTGCCTTTGGCTCAAGG - Intergenic
1157476544 18:48027707-48027729 CTCTTTGTGCCCATAGCACAGGG + Exonic
1157527593 18:48396484-48396506 CTCTGACTGTCTTTAGCCCTTGG - Intronic
1159603390 18:70450019-70450041 CTTTCAGAGCCTTTATCACAAGG + Intergenic
1164562317 19:29300704-29300726 CTCTGCTTGCCTCTAGCACATGG - Intergenic
1166334933 19:42099983-42100005 CTCTGGGTGCCCTTAGCTCAGGG - Intronic
1166894995 19:46017391-46017413 CTCTGAATGCCTTTGGCAATAGG + Intronic
1167568497 19:50272035-50272057 CACTGAGGCCCTGTAGCACATGG - Intronic
926444707 2:12928015-12928037 CTGTGAGCTCCTTTAGGACAGGG + Intergenic
928336139 2:30400116-30400138 CTATGAGTGCCTTTTCCCCATGG + Intergenic
928376973 2:30783332-30783354 CTCTCAGTGCCATTTGCACAGGG + Intronic
931116978 2:59175423-59175445 CTCTGTGTGACTTTAGCTAAAGG + Intergenic
932429607 2:71666196-71666218 CTGTGAGCAACTTTAGCACAGGG + Intronic
933140975 2:78792630-78792652 ATCTAAGTGCCTTTAGAATAAGG + Intergenic
934104370 2:88682272-88682294 CTCTGTTTGCCTTTTGCAGATGG + Intergenic
935055649 2:99564227-99564249 GTGTGAGTACCTTGAGCACAGGG - Intronic
936228946 2:110682515-110682537 CTCTGAATACCCCTAGCACAGGG - Intergenic
937491091 2:122368709-122368731 CTGTAAGTGCTATTAGCACATGG + Intergenic
938695421 2:133830842-133830864 TTCTGCATGCCTTTGGCACATGG - Intergenic
938751554 2:134335829-134335851 CTCTGTGACCCTTTAGCAAATGG - Intronic
939615197 2:144354562-144354584 CTCTAAGCACCTTGAGCACAGGG - Intergenic
943310716 2:186321232-186321254 CTATAAGTGCCTTTATCAAAGGG + Intergenic
945862603 2:215140679-215140701 CTCTGAGCCCCTTGAGTACAGGG + Intergenic
947828364 2:233121891-233121913 CTCTGTGTGCCTTTTGCAGAAGG + Intronic
947922548 2:233890674-233890696 CTGTGAGTGCTTTAAGGACAGGG + Intergenic
1169893932 20:10482227-10482249 CTCTAAGTGCCTTAAGCAATTGG + Intronic
1173135079 20:40432267-40432289 CTTTGAGTTCCTTGAGGACATGG + Intergenic
1173857397 20:46259059-46259081 CTGTGACTGCCTTAAGAACAGGG - Intronic
1174207534 20:48851616-48851638 CTGTGAGCCCCTTTAGCACTGGG + Intergenic
1174442465 20:50566987-50567009 CTCCGAGTCCCTTCAGCACAGGG + Intronic
1174635427 20:51995620-51995642 CTGTGTGTGCCTTTACCAAAGGG - Intergenic
1174874280 20:54210137-54210159 CTCTGAGTGCATTTAATACAAGG + Intronic
1175679357 20:60974561-60974583 CTCTCTGTGCCTTTAGCTCATGG - Intergenic
1175761894 20:61566918-61566940 CTCCCAGTGTCTTCAGCACACGG + Intronic
1176102748 20:63372042-63372064 CTCTGAGTCCCGTGAGGACAAGG + Intronic
1178762079 21:35412629-35412651 CTCTGAATTCCTTAAGCGCAAGG - Intronic
1179396518 21:41045260-41045282 CGCTGGGTGCCTCTAGAACATGG + Intergenic
1181679898 22:24487273-24487295 ATATGAGTGCCTTAATCACATGG - Intergenic
1184209921 22:43029376-43029398 CTCTGAGTGCCCTCAGCTGAAGG - Intergenic
950159843 3:10752158-10752180 GTCTGAGTGCCTTGAGGACCCGG + Intergenic
950897950 3:16470381-16470403 CTCTGATGGCTTTTAGCCCAAGG + Intronic
950908907 3:16566989-16567011 CTCTGAGGGCCTTTGCGACATGG + Intergenic
951845424 3:27079616-27079638 CTCTGAGTGGCCTGAGCACTGGG - Intergenic
952090590 3:29880766-29880788 CTCTGAGTACCTTTGGCAAGAGG - Intronic
952853761 3:37750883-37750905 TGCTGAGTGCATTTTGCACAGGG + Intronic
953328943 3:42035778-42035800 CTCTGAATGGCTTTAGCAAGGGG - Intronic
954842456 3:53523899-53523921 CTCTGAGAGCCTTGAGGGCAAGG + Intronic
955134624 3:56204238-56204260 CTCTAAGTGCCATGAGGACAGGG + Intronic
956361188 3:68449622-68449644 CTCTGAGTCCATATTGCACATGG + Intronic
956644336 3:71441532-71441554 CTCCTAGAGCATTTAGCACAGGG - Intronic
957993300 3:87654008-87654030 CTTTGGGTGCCTATACCACAAGG - Intergenic
961155477 3:124676042-124676064 CTTTGAGGGCCTTTATCCCAAGG - Intronic
961514484 3:127424204-127424226 CTTTGAGTGCTTTAAGCGCAGGG - Intergenic
962108577 3:132417950-132417972 CTTTGAGTGACATTAGCTCAGGG + Intronic
964224924 3:154387351-154387373 CTCTGAGTTACTTGAGAACAAGG + Intronic
965457861 3:168926552-168926574 AACTGAGAGCCATTAGCACAAGG + Intergenic
965519491 3:169658760-169658782 CTCTGGGTGCCTTGGGAACAGGG + Intronic
967824238 3:193866036-193866058 CTCAGAATGCCTCTAGCACCTGG + Intergenic
968741488 4:2333710-2333732 CTGTGAGTGCCCTTGGGACAAGG + Intronic
970899404 4:21141341-21141363 CTGTGAGTGCCCTAAGAACAGGG + Intronic
970945924 4:21691655-21691677 CTCTGATTACCTTTAGCAAGAGG + Intronic
971016147 4:22491142-22491164 CTCTGAGAGCAATGAGCACAAGG + Intronic
971139446 4:23907915-23907937 CTGTGGGTGCCTTGCGCACATGG + Intergenic
975022277 4:69503591-69503613 CTCTGTGCAGCTTTAGCACAAGG - Intronic
975303523 4:72820229-72820251 CTGTCAGTGAATTTAGCACATGG + Intergenic
976997050 4:91447009-91447031 CTTGGTGTGGCTTTAGCACAGGG + Intronic
980485296 4:133450136-133450158 CTCTATCTGCCTTTAGCAGATGG - Intergenic
981810561 4:148769482-148769504 CTCAGAATGCCTTTCTCACAAGG + Intergenic
982047104 4:151459026-151459048 CTCTAAGTGACTTTAACACAAGG + Intronic
984348110 4:178557765-178557787 ATGTGACTGCCTTTAGCACAGGG - Intergenic
984792784 4:183629518-183629540 CTCTGAGTGTCTATGGAACAGGG + Intergenic
984863311 4:184258471-184258493 CGCTGAGTCCCTTTGCCACAGGG - Intergenic
984949336 4:184995128-184995150 CTCTGAGTTCTTTTGGCACTTGG - Intergenic
989320761 5:40131172-40131194 CCTTGGGTGCCTATAGCACAAGG - Intergenic
989986981 5:50712637-50712659 CTGTGAATGCCTTCAGGACAGGG - Intronic
990478709 5:56186558-56186580 TTCTGTGTGCTTTTAGAACAAGG + Intronic
999127297 5:149255017-149255039 CTCTGAGCTCCTTGAGGACAGGG - Intronic
999635369 5:153616358-153616380 CTTTGAGTTCCTCTAGGACAGGG + Intronic
1001704204 5:173730091-173730113 CTCTGAGCTCCTTGAGGACAGGG - Intergenic
1001954888 5:175842476-175842498 CTCTCAGCTCCTTTAGCAAACGG + Intronic
1003136426 6:3438140-3438162 TTCTTGGTGCCTCTAGCACACGG - Intronic
1005324896 6:24690432-24690454 CTCTGAAGGCCTCTATCACATGG - Intronic
1005755262 6:28920442-28920464 CTCTGAGTTGCTTGAGAACAGGG - Intronic
1006565570 6:34953627-34953649 CTCTGACATCCTTTAGGACAGGG + Intronic
1008255675 6:49297021-49297043 CTCTGAGTTTCTTTATCACAAGG + Intergenic
1008730705 6:54479436-54479458 GCCTGAGTGTCTTTAGCACATGG - Intergenic
1008962463 6:57279735-57279757 CTGTGATTCCCTTGAGCACAGGG - Intergenic
1010051475 6:71509288-71509310 CTCTTGGTGGCTTCAGCACATGG + Intergenic
1011017303 6:82771197-82771219 CTCTGATAGCCTTTATCACTTGG - Intergenic
1014702125 6:124702776-124702798 CTCTGATTGCCTTTAGGGCGTGG - Intronic
1016022853 6:139254457-139254479 CTCACAGTCCCTTTAGCACTTGG + Intronic
1018386219 6:163305632-163305654 CTCTCAGTGCCATAAACACATGG - Intronic
1020000983 7:4755413-4755435 CTCTGAAGGCCCTTAGAACATGG + Intronic
1021195340 7:17668049-17668071 CTCTGATTCCCTTTAGAAAAGGG - Intergenic
1023814809 7:43941520-43941542 TACTGAGTGCCTAGAGCACAGGG + Intronic
1024440773 7:49414835-49414857 CTCTTACTTCCTTTGGCACATGG - Intergenic
1024584858 7:50833365-50833387 CTCTGAGCTCCTTTATCACAAGG - Intergenic
1026307709 7:69156216-69156238 CTCAAAGTGCCTTAAGCAGAAGG + Intergenic
1026438505 7:70421490-70421512 CTCTGATTGCCTCTGTCACAGGG + Intronic
1027245267 7:76362775-76362797 CTCTGAATTCCTTGAGGACAGGG - Intergenic
1031900042 7:127398772-127398794 CTCTGAGTGCCTTTAGCACAGGG - Intronic
1033137300 7:138796166-138796188 CCTTGAGTTCCTTGAGCACAAGG + Intronic
1035415720 7:158683898-158683920 CTCTGAGTACCATTAGTGCATGG - Intronic
1038494316 8:27990761-27990783 CTCTGAGAGCTTGAAGCACATGG + Intronic
1038590689 8:28834642-28834664 TTCTGAGTGCCTACAGCACTGGG + Intronic
1041495507 8:58481526-58481548 CTCTGAGTGCCTTGAGGGCAGGG + Intergenic
1043755761 8:84001076-84001098 CTCTGCGTGCCTATCCCACAAGG - Intergenic
1043796754 8:84551902-84551924 CTCTGAATGCCTATTGCAAAGGG + Intronic
1044300929 8:90582058-90582080 ATCTGAGTGCCTGGAACACACGG + Intergenic
1044843048 8:96354382-96354404 CTCAGAGTGCCTTGAGGAGATGG - Intergenic
1045329112 8:101140308-101140330 CACTGGAGGCCTTTAGCACAAGG - Intergenic
1045593305 8:103623888-103623910 CTCTGATGACCTTCAGCACAAGG + Intronic
1045950382 8:107844944-107844966 CTCAGAGTGACTTCTGCACAGGG - Intergenic
1047440960 8:124878303-124878325 CTGTGAGTTCCTTGAGGACAGGG - Intergenic
1047982873 8:130201335-130201357 TCCCGAGTGCCTTTAGCACATGG - Intronic
1049975832 9:860880-860902 GCCTGAGTGCTTTGAGCACAGGG + Intronic
1053505527 9:38640280-38640302 CTCTGTGTGCTTGTACCACATGG - Intergenic
1056212901 9:84381621-84381643 CTCTCAGTGACTTTAGAACAGGG + Intergenic
1057304170 9:93902869-93902891 TGCTGGGTGACTTTAGCACAAGG + Intergenic
1059161563 9:112039876-112039898 CTCTGAGTGCCTTGGGCTTATGG - Intergenic
1059351529 9:113668837-113668859 CTCTGAATGCCCCTGGCACATGG + Intergenic
1060210490 9:121707177-121707199 CTCTAAATGCCTCTGGCACAGGG - Intronic
1060291626 9:122308153-122308175 GTCAGAGAGCCTCTAGCACAAGG - Intronic
1060390212 9:123270231-123270253 CTCTCAGTCCCTTGAGGACAGGG + Intergenic
1188359119 X:29230889-29230911 CTCTGAGAGCCTCTAACTCATGG + Intronic
1188904182 X:35772569-35772591 CTCTAAGTTCCTTGGGCACAGGG - Intergenic
1195438707 X:104876259-104876281 CTCTGAAGGCATTTAGCACATGG + Intronic
1197151088 X:123220616-123220638 TTCTGCTTCCCTTTAGCACAAGG - Intronic
1199134456 X:144234270-144234292 ATCTGAGTGCCTTTAAGCCAAGG - Intergenic
1200759576 Y:7025634-7025656 ATCTGACTGTCTTTACCACAGGG - Intronic