ID: 1031903365

View in Genome Browser
Species Human (GRCh38)
Location 7:127434432-127434454
Sequence ATTTCTTTATAGCAGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031903365_1031903369 10 Left 1031903365 7:127434432-127434454 CCATCACACTGCTATAAAGAAAT No data
Right 1031903369 7:127434465-127434487 AGGTAATTAATAAGTGAAACAGG No data
1031903365_1031903366 -10 Left 1031903365 7:127434432-127434454 CCATCACACTGCTATAAAGAAAT No data
Right 1031903366 7:127434445-127434467 ATAAAGAAATACCCAAGACTAGG 0: 216
1: 3296
2: 7335
3: 12797
4: 13512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031903365 Original CRISPR ATTTCTTTATAGCAGTGTGA TGG (reversed) Intergenic
No off target data available for this crispr