ID: 1031903366

View in Genome Browser
Species Human (GRCh38)
Location 7:127434445-127434467
Sequence ATAAAGAAATACCCAAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37156
Summary {0: 216, 1: 3296, 2: 7335, 3: 12797, 4: 13512}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031903365_1031903366 -10 Left 1031903365 7:127434432-127434454 CCATCACACTGCTATAAAGAAAT No data
Right 1031903366 7:127434445-127434467 ATAAAGAAATACCCAAGACTAGG 0: 216
1: 3296
2: 7335
3: 12797
4: 13512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031903366 Original CRISPR ATAAAGAAATACCCAAGACT AGG Intergenic
Too many off-targets to display for this crispr