ID: 1031903369

View in Genome Browser
Species Human (GRCh38)
Location 7:127434465-127434487
Sequence AGGTAATTAATAAGTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031903365_1031903369 10 Left 1031903365 7:127434432-127434454 CCATCACACTGCTATAAAGAAAT No data
Right 1031903369 7:127434465-127434487 AGGTAATTAATAAGTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031903369 Original CRISPR AGGTAATTAATAAGTGAAAC AGG Intergenic
No off target data available for this crispr