ID: 1031903775

View in Genome Browser
Species Human (GRCh38)
Location 7:127439056-127439078
Sequence TACTCCTATCCCAAATTATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031903775_1031903776 0 Left 1031903775 7:127439056-127439078 CCGCATAATTTGGGATAGGAGTA No data
Right 1031903776 7:127439079-127439101 AGATCAGTGTCTCCCACAAATGG No data
1031903775_1031903779 21 Left 1031903775 7:127439056-127439078 CCGCATAATTTGGGATAGGAGTA No data
Right 1031903779 7:127439100-127439122 GGCCAAGCCTGATCTATCTTAGG No data
1031903775_1031903783 28 Left 1031903775 7:127439056-127439078 CCGCATAATTTGGGATAGGAGTA No data
Right 1031903783 7:127439107-127439129 CCTGATCTATCTTAGGGAAGTGG No data
1031903775_1031903780 22 Left 1031903775 7:127439056-127439078 CCGCATAATTTGGGATAGGAGTA No data
Right 1031903780 7:127439101-127439123 GCCAAGCCTGATCTATCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031903775 Original CRISPR TACTCCTATCCCAAATTATG CGG (reversed) Intergenic
No off target data available for this crispr