ID: 1031905626

View in Genome Browser
Species Human (GRCh38)
Location 7:127457421-127457443
Sequence TGCAGCTTGAGGTGGAGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1031905626_1031905633 14 Left 1031905626 7:127457421-127457443 CCCCTTCTCCACCTCAAGCTGCA No data
Right 1031905633 7:127457458-127457480 AGAAAGAATAAGTGTGCTTGAGG No data
1031905626_1031905634 15 Left 1031905626 7:127457421-127457443 CCCCTTCTCCACCTCAAGCTGCA No data
Right 1031905634 7:127457459-127457481 GAAAGAATAAGTGTGCTTGAGGG No data
1031905626_1031905635 18 Left 1031905626 7:127457421-127457443 CCCCTTCTCCACCTCAAGCTGCA No data
Right 1031905635 7:127457462-127457484 AGAATAAGTGTGCTTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1031905626 Original CRISPR TGCAGCTTGAGGTGGAGAAG GGG (reversed) Intergenic
No off target data available for this crispr